Table 1.

Combination of primers used for PCR

Forward and Reverse Primers (5′–3′)
S16ATTCGGAATGGGCGCCTGGGTGACCATC;
GATGGTCACCCAGGCGCCCATTCCGAA
I20ATCCTGGGTGACCGCCAATGGGCTCTGG;
CCAGAGCCCATTGGCGGTCACCCAGGA
W24AATCAATGGGCTCGCGGTAGAGCTGCCC;
GGGCAGCTCTACCGCGAGCCCATTGAT
N94QGCCTTCCTCTGGCAAATGACCTCCTGG;
CCAGGAGGTCATTTGCCAGAGGAAGGA
F142ACTCACCACCTTCGCTGTGGGTGAAGGA;
TCCTTCACCCACAGCGAAGGTGGTGAG
C120ACTGGCCCTGGTGGACGCCACCTCTTCAGTGACC
GGTCACTGAAGAGGTGGCGTCCACCAGGGCCAG
N168QACTACCTGCGTCCAAGTCACTGAGATA;
TATCTCAGTGACTTGGACGCAGGTAGT
T314AGTCAACGCGCTCGCCAACGGCATGCTG;
CAGCATGCCGTTGGCGAGCGCGTTGAC
N315AAACGCGCTCACCGCCGGCATGCTGCCC;
GGGCAGCATGCCGGCGGTGAGCGCGTT
  • The nucleotide changes in forward and reverse primers (boldface) used for generating point mutations.