Table 1.

List of siRNA sequences for chick GSNOR and eGFP

Sequence NameTarget SequenceStrand GuideStrand Passenger
siRNA eGFPACGTAAACGGCCACAAGTTCAGC (85–107)UGAACUUGUGGCCGUUUACGUGUAAACGGCCACAAGUUCAGC
siRNA GSNOR sequence no. 1CCGGATCATTGGCATTGACATAA (716–738)AUGUCAAUGCCAAUGAUCCGGGGAUCAUUGGCAUUGACAUAA
siRNA GSNOR sequence no. 2GCAGGTAAACCTCTCTCTATTGA (111–133)AAUAGAGAGAGGUUUACCUGCAGGUAAACCUCUCUCUAUUGA
siRNA GSNOR sequence no. 3CCGATATCTCAGTAGCTAAGATA (523–545)UCUUAGCUACUGAGAUAUCGGGAUAUCUCAGUAGCUAAGAUA