Table 1.

RT-PCR primers

GenePrimer Sequence (5′–3′)
GAPDHCACCAACTGCTTAG (sense)
TGGTCATGAGTCCT (antisense)
ATF3TTCTCCCAGCGTTAACACAAAA (sense)
AGAGGACCTGCCATCATGCT (antisense)
IL-6CTGCGCAGCTTTAAGGAGTTC (sense)
TTGCCGAAGAGCCCTCAG (antisense)
IL-8CCTTTCCACCCCAAATTTATCA (sense)
TGGTCCACTCTCAATCACTCTCAG (antisense)
KLF4ACTGGAAGTTGTGGATATCAGGG (sense)
CTCCCCCAACTCACGGATATAA (antisense)
CXCL1TTTCTGAGGAGCCTGCAACA (sense)
GATCCGCCAGCCTCTATCAC (antisense)
MIP-2α (CXCL2)GAGAGACACAGCTGCAGAGGC (sense)
TGCTCAAACACATTAGGCGC (antisense)
MIP-2β (CXCL3)TAGGGACAGCTGGAAAGGGA (sense)
ACCCTCGTAAGAAATAGTCAAACACAT (antisense)
MIP-3α (CCL-20)TCCTGGCTGCTTTGATGTCA (sense)
CTGATTCGCCGCAGAGGT (antisense)
NR4A2TGCAGGCAGAACCTGAAAGG (sense)
CTAAATCCAGGATGCCCCG (antisense)
DDIT3AGGGCCAACAGAGGTCACAC (sense)
GAATCTGGAGAGCGAGGGCT (antisense)
DDIT4GCAGCTGCGTTTAAGCCTTC (sense)
TGCCAGCTCAACTCTGCAGT (antisense)
GDF15GTGTCCCCACCTGTATCGCT (sense)
CGTGCTTTGATCTGCGCAT (antisense)
COX2 (PTGS2)CTGAATGTGCCATAAGACTGACCT (sense)
TCCACAGATCCCTCAAAACATTT (antisense)
ITGB1TTCATGACAGAAGGGAGTTTGCT (sense)
TGGCATTCATTTTCTCCTTTTCA (antisense)
SMAD7GCTTAGCAGTCCCCTTCCCT (sense)
CTTGGGTTATGACGGACCAAAT (antisense)
SOX9TACCCAAATTTCCAAGACACAAAC (sense)
AGTGGGTAATGCGCTTGGAT (antisense)
PGFCCCCTCACACTTTGCCATTT (sense)
TGGCCGGAAAGAACAATGTC (antisense)
SIX1CTCCCCAAAGTCCAGACCAG (sense)
CCATATTGCCCTGCAGCAG (antisense)
  • The oligonucleotide sequences for each primer sequence were obtained from Affymetrix database using the probe set IDs. The primers were custom prepared and used as described in materials and methods.