Table 1.

Combination of primers used for PCR

Forward and Reverse Primers (5′–3′)
hSMVT-RTTGTCTACCTTCTCCATCATGGA; TAGAGCCCAATGGCAAGAGA
hβ-Actin-RTCATCCTGCGTCTGGACCT; TAATGTCACGCACGATTTCC
mSMVT-RTGGATCTGTGGGACTGTGA; CACATCTGTCCAGATGACA
mβ-Actin-RTATCCTCTTCCTCCCTGGA; TTCATGGATGCCACAGGA
Thr78AlaCTGTCCCTGCTGGCCGCCTTCCAGTCAGCCGTG; CACGGCTGACTGGAAGGCGGCCAGCAGGGACAG
Ser128AlaCGCCTGCATCTCACCGCTGCCTATGAGTACCTG; CAGGTACTCATAGGCAGCGGTGAGATGCAGGCG
Ser242AlaCAGCACGGCCGCATCGCTGGGTTTGAGCTGGAT; ATCCAGCTCAAACCCAGCGATGCGGCCGTGCTG
Thr366AlaAGCGGCTCTCTCAGCGCTATATCCTCTGCTTTT; AAAAGCAGAGGATATAGCGCTGAGAGAGCCGCT
Thr627AlaCAGGGGAGCAGCTCCGCCTGCATCCTCCAGGAG; CTCCTGGAGGATGCAGGCGGAGCTGCTCCCCTG
  • SMVT-RT and β-actin-RT represent the primer sequences used for quantitative real-time PCR for SMVT and β-actin, respectively. The bold-underlined nucleotides represent the mutation in respective primers used for site-directed mutagenesis in hSMVT. “h” and “m” prefixes denote human and mouse, respectively.