Table 1.

Primer sequences based on gene transcripts available in GenBank

Primer (5′ → 3′)
GeneForwardReverse
CoxivCTCCAACGAATGGAAGACAGTGACAACCTTCTTAGGGAAC
TfamGAAGGGAATGGGAAAGGTAGAAACAGGACATGGAAAGCAGAT
Bnip3lGGAAAGCGGCACAGAGAAGAATGACGCCAGTGCTGAT
Park2GTCTGCAATTTGGTTTGGAGTAGCATCATGGGATTGTCTCTTAAA
Sqstm1TGTGGTGGGAACTCGCTATAACAGCGGCTATGAGAGAAGCTAT
Maplc3bGCTTGCAGCTCAATGCTAACCCTGCGAGGCATAAACCATGTA
Atg7TTTCTGTCACGGTTCGATAATGTGAATCCTTCTCGCTCGTACT
Lamp2GCTGAACAACAGCCAAATTACTGAGCCATTAGCCAAATACAT
CatsdTTTGCCAATGCTGTCGTACTAGCGAGTGTGACTATGTGTGAG
TFEBAGCTCCAACCCGAGAAAGAGTTTGCGTTCAGGTGGCTGCTAGAC
Foxo3ATGGACGACCTGCTGGATAACGGAGCTCTTGGCGGTATATG
Beclin1AGGCTGAGGCGGAGAGATTTCCACACTCTTGAGTTCGTCAT
NPC1AGCATCACCGCATCTTACAAGCATGGCTGTTCTGGAAGTAA
ActbTGTGACGTTGACATCCGTAAGCTAGGAGCCAGAGCAGTAA
GapdhAACACTGAGCATCTCCCTCAGTGGGTGCAGCGAACTTTAT