|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
VASCULAR BIOLOGY
Department of Physiology, University of Tennessee Health Science Center, Memphis, Tennessee
Submitted 10 July 2008 ; accepted in final form 12 September 2008
| ABSTRACT |
|---|
|
|
|---|
61%. Antibodies targeting IP3R1 and IP3R1 knockdown reduced UTP-induced nonselective cation current (Icat) activation. IP3R1 knockdown also reduced UTP-induced vasoconstriction in pressurized arteries with both intact and depleted sarcoplasmic reticulum (SR) Ca2+ by
45%. These data indicate that IP3R1 is the predominant IP3R isoform expressed in rat cerebral artery smooth muscle cells. IP3R1 stimulation contributes to UTP-induced Icat activation, Ca2+ wave generation, global [Ca2+]i elevation, and vasoconstriction. In addition, IP3R1 activation constricts cerebral arteries in the absence of SR Ca2+ release by stimulating plasma membrane Icat. cerebral artery smooth muscle cells; calcium wave; short hairpin RNA
Three IP3R isoforms, designated IP3R1, IP3R2, and IP3R3, are encoded by distinct genes (6, 37). IP3R isoform expression varies widely between different cell types. Cerebellar Purkinje neurons express predominantly IP3R1, pancreatic β-cells primarily express IP3R3, and cardiac myocytes express IP3R2 (14, 48). All three IP3R isoforms are expressed in whole aorta, mesenteric and basilar arteries, and cultured aortic smooth muscle cells (17, 56). In primary cultured portal vein smooth muscle cells, IP3R1 and IP3R2 were detected by immunofluorescence, whereas IP3R3 was absent (32). In contrast, in primary cultured rat ureter smooth muscle cells and cultured A7r5 cells, IP3R1 and IP3R3 were expressed and IP3R2 was absent (32, 51).
IP3R isoforms may also regulate vascular smooth muscle Ca2+ signaling in a cell-specific manner. IP3R2 activation contributes to ACh-induced Ca2+ oscillations in cultured portal vein smooth muscle cells (32). In contrast, IP3R1 was required for ACh-induced Ca2+ elevations in cultured portal vein smooth muscle cells (32), ATP-induced Ca2+ transients in cultured aortic smooth muscle cells (56), and vasopressin-evoked Ca2+ release and capacitative Ca2+ entry in cultured A7r5 smooth muscle cells (51). These studies suggest that IP3R isoform expression may differ between smooth muscle cell types, leading to tissue-specific regulation of intracellular Ca2+ signaling.
The major goal of this study was to determine the functional significance of IP3R isoforms that are expressed in smooth muscle cells of resistance-size cerebral arteries. We demonstrate that all three IP3R isoforms are expressed in rat cerebral artery smooth muscle cells and that IP3R1 is, by far, the most abundant. We also show that IP3R1 suppression using antibodies and short hairpin RNA (shRNA) reduces UTP-induced elevations in Ca2+ wave frequency and global [Ca2+]i, cation current (Icat) activation, and vasoconstriction. These data identify IP3R1 as the principal molecular and functional IP3R isoform in cerebral artery smooth muscle cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
50–200 µm diameter) were removed and cleaned of connective tissue. When appropriate, endothelium was removed by introducing an air bubble into the arterial lumen for 2 min, followed by a 30-s wash with PSS. Cerebral artery smooth muscle cells were isolated as previously described (10). RT-PCR and real-time PCR. IP3R fragments were amplified by nested PCR using the Taq DNA polymerase kit (Invitrogen). Reactions were run at 94°C for 30 s, 56°C for 30 s, and 72°C for 1 min 30 s for 35 cycles each, with the following primers: CACCCAAAGAAGAGCTGCTCC (forward, F1), CTGTCATCTGGTCCTTTAGTTCTGAC (reverse, R1), CTCTGTTTGCTGCAAGGGTGATC (F2), and GTCCTTCACTTTCACCAGCACG (R2) for IP3R1; CCTGTTCTCCATCATCGGCTTC (F1), TGTCATCTGCTCCTTCAGCTCTG (R1), ATTGTCACCGTGCTGAACCAG (F2), and GCCACAGATGAAGCAGGTTGTC (R2) for IP3R2; and ATCCTGCTCTTTGACCTCATCTACC (F1), GTTCTTGTTCTTGATCATCTGAGCCAC (R1), CCTGAGATCCTAGAAGAGGACGAG (F2), and TCTCCAGACCACAGATGAAGCAC (R2) for IP3R3. PCR products were separated on 2% agarose gels, and bands were visualized by staining with ethidium bromide.
For real-time PCR, IP3R isoform-specific primers were as follows: GAGATGAGCCTGGCTGAGGTTCAA (forward) and TGTTGCCTCCTTCCAGAAGTGCGA (reverse) for IP3R1, CAACCAGACCCTGGAGAGCTTGAC (forward) and GTCAGGAACTGGCAGATGGCAGGT (reverse) for IP3R2, AGACCCGCTGGCCTACTATGAGAA (forward), GTCAGGAACTGGCAGATGGCAGGT (reverse) for IP3R3, and ATCCTGTGGCATTCCATGAAACTAC (forward) and AGGAGCCAGGGCAGTAATCTC (reverse) for β-actin. Each PCR mixture (25 µl) contained 12.5 µl of SYBR Green PCR Master Mix (Applied Biosystems), 400 nM primer, and an equal volume of cDNA template. Reactions were performed in triplicate on a sequence detection system (Prism 7700, Applied Biosystems) at 95°C for 10 min and 40 cycles of 20 s at 95°C, 20 s at 65°C, and 45 s at 72°C. A negative control, with smooth muscle cell RNA, instead of cDNA, was carried out in each experiment. The integrity of each PCR was verified by using dissociation curve analysis. Relative IP3R isoform mRNA expression was calculated from the difference between fluorescence threshold (Ct) values (
Ct) of each IP3R isoform sample using the
Ct method.
Immunoblotting. Rat whole brain or cerebral arteries were homogenized in Laemmli sample buffer (2.5% SDS, 10% glycerol, 0.01% bromphenol blue, and 5% β-mercaptoethanol in 100 mM Tris·HCl, pH 6.8) and centrifuged at 10,000 g for 10 min. Proteins (30 µg/lane) were separated by 4–15% gradient SDS-polyacrylamide gels and transferred onto polyvinylidene difluoride membranes using a Mini Trans Blot Cell (Bio-Rad, Hercules, CA). Membranes were then incubated with polyclonal anti-IP3R1 (1:1,000 dilution; Alomone Labs), IP3R2 (1:500 dilution; Santa Cruz Biotechnology), or monoclonal anti-IP3R3 (1:500 dilution, BD Transduction Laboratories) antibodies overnight at 4°C in Tris-buffered solution (TBS) with 0.1% Tween 20 (TBS-T) and 5% nonfat dry milk. After three washes with TBS-T, membranes were incubated for 1 h with horseradish peroxidase-conjugated secondary antibody (1:10,000 dilution; Pierce Biotechnology) and then washed with TBS-T. Membranes were developed using enhanced chemiluminescence (Amersham, Arlington Heights, IL). Membranes were reprobed with monoclonal anti-actin antibody (1:10,000 dilution; Chemicon International) and then with horseradish peroxidase-conjugated anti-mouse IgG. Band intensities were quantified by digital densitometry using Quantity One version 4.4.1 software. IP3R isoform band intensity was normalized to actin.
Immunofluorescence. Freshly isolated smooth muscle cells were fixed with 3.7% paraformaldehyde in PBS (Invitrogen, Carlsbad, CA) for 15 min and permeabilized with 0.1% Triton X-100 for 1 min at room temperature. After 1 h of incubation in PBS containing 5% BSA, smooth muscle cells were treated overnight at 4°C with antibodies to IP3R1 (UC Davis/NINDS/NIMH NeuroMab Facility). IP3R2 (Affinity Bio), or IP3R3 (BD Transduction Laboratories), each at a dilution of 1:100 in PBS containing 5% BSA. After they were washed and blocked with 10% goat serum, smooth muscle cells were incubated with secondary antibodies (1:100 dilution; Invitrogen-Molecular Probes) as follows: goat anti-mouse IgG with Alexa Fluor 546 for IP3R1, goat anti-rabbit IgG with Alexa Fluor 488 for IP3R2, or anti-mouse IgG2a with Alexa Fluor 555 for IP3R3. The cells were washed and mounted, and fluorescence images were obtained using a Zeiss LSM Pascal scanning confocal microscope. Negative controls were prepared by omission of primary antibodies.
IP3R1 knockdown. Two different IP3R1 silencing vectors were constructed by GenScript (Piscataway, NJ) using pRNA-U6.1/Neo as a backbone plasmid to encode shRNA targeting IP3R1. The vectors encode CGGTCGAAATGTCCAGTATA (IP3R1shV1) or GCAGCAACGTGATGAGATCTA (IP3R1shV2). A pRNA-U6.1/Neo vector that encodes a scrambled sequence (TGAACATCAGTGCTAGGTTAC) was used as a control (IP3R1scrm). To deliver plasmids into arterial wall cells, reverse permeabilization was used (54). IP3R1shV1 (10 µg/ml) was used for Western blotting, patch clamp, and diameter measurements, and IP3R1shV1 (5 µg/ml) + IP3R1shV2 (5 µg/ml) was used for Western blotting and Ca2+ imaging experiments, with IP3R1scrm (10 µg/ml) as control for each.
Patch-clamp electrophysiology. Icat was measured in the presence or absence of UTP (30 µM) using the conventional whole cell patch-clamp configuration (Axopatch 200B, Clampex 8.2). The pipette solution contained (in mM) 140 CsCl, 10 HEPES, 10 glucose, 5 MgATP, and 5 EGTA (with pH adjusted to 7.2 with CsOH), with free Ca2+ adjusted to 100 nM using Ca2+-sensitive (catalog no. 476041, Corning) and reference (catalog no. 476370, Corning) electrodes. Bath solution contained (in mM) 140 NaCl, 1.8 CaCl2, 1.2 MgCl2, 10 HEPES, and 10 glucose (with pH adjusted to 7.4 with NaOH). For experiments studying Icat regulation in myocytes treated with IP3R1 scrambled and suppression vectors, thapsigargin (100 nM) was included in the pipette solution to induce SR Ca2+ depletion. Where appropriate, IP3R1 antibody (Alomone Labs) or a denatured IP3R1 antibody control (95°C, 10 min) was included in the pipette solution (1:100 dilution). Whole cell currents were measured by applying 940-ms voltage ramps between –120 and +20 mV with a holding potential of –40 mV. Current amplitude was analyzed offline using Clampfit 9.2.
Laser-scanning confocal Ca2+ imaging. Cerebral artery segments were cannulated and incubated in the dark with fluo-4 AM (10 µM) and 0.05% Pluronic F-127 for 1 h. Intracellular Ca2+ signals in cerebral artery smooth muscle cells were imaged using a Noran Oz laser-scanning confocal microscope, as described previously (11). Fluo-4 AM was excited with 488-nm light, and emitted light >510 nm was collected. Images (112.6 x 105.6 µm) were acquired at a rate of 30 s–1. Under each condition, at least two different representative areas of the same arterial segment were each scanned for 10 s. The same area of artery was scanned only once to avoid any laser-induced changes in Ca2+ signaling, and the effects of pharmacological agents were measured in paired experiments. Ca2+ wave frequency and global [Ca2+]i were analyzed offline using custom software kindly provided by Dr. M. T. Nelson (University of Vermont), as previously described (11). Global [Ca2+]i was calculated using the following equation: [Ca2+]i = KR/{K/([Ca2+]rest + 1 – R)}, where K is the apparent affinity of fluo-4 AM for Ca2+ (770 nM) (10), R is the fractional fluorescence increase (F/F0), and [Ca2+]rest is [Ca2+]i at F0 (193 nM) (10).
Fura-2 imaging. IP3R1scrm- or IP3R1shV-treated cerebral artery segments were incubated in HEPES-buffered solution (in mM: 134 NaCl, 6 KCl, 2 CaCl2, 1 MgCl2, 10 HEPES, and 10 glucose, with pH adjusted to 7.4 with NaOH) containing fura-2 AM (5 µM) and 0.05% Pluronic F-127 for 30 min and then washed for 15 min. Fura-2 was alternately excited at 340 or 380 nm using a personal computer-driven hyperswitch (Ionoptix, Milton, MA). Background-corrected ratios were collected every 1 s at 510 nm using a photomultiplier tube. SR Ca2+ load was estimated by measuring the amplitude of caffeine (10 mM)-induced [Ca2+]i transients, as we described previously (11).
Pressurized artery diameter measurement. Endothelium-denuded cerebral artery segments were cannulated at each end in a perfusion chamber. The chamber was continuously perfused with PSS and maintained at 37°C. Intravascular pressure was altered using an attached reservoir and monitored using a pressure transducer. Wall diameter was measured at 1 Hz using a charge-coupled device camera and the edge-detection function of IonWizard (Ionoptix). Pharmacological agents were applied via chamber perfusion. Passive diameter was determined by applying Ca2+-free PSS supplemented with 5 mM EGTA. The magnitude of myogenic tone was calculated using the following equation: myogenic tone (%) = (1 – active diameter/passive diameter) x 100.
Reagents. Unless otherwise specified, all reagents were purchased from Sigma-Aldrich (St. Louis, MO). Fluo-4 AM, fura-2 AM, and Pluronic F-127 were purchased from Molecular Probes (Eugene, OR), and papain was obtained from Worthington Biochemical (Lakewood, NJ).
Statistical analysis. Values are means ± SE. Student's t-test and Student-Newman-Keuls test were used for comparison of paired or unpaired data and multiple data sets, respectively. P < 0.05 was considered significant.
| RESULTS |
|---|
|
|
|---|
10-fold (Fig. 1, A and B). UTP also elevated mean global [Ca2+]i from 193 nM (10) to
318 nM (Fig. 1C). 2-Aminoethoxydiphenyl borate (2-APB) and xestospongin C (XeC), IP3R blockers both prevented UTP-induced Ca2+ wave activation (Fig. 1, A and B). The mean UTP-induced global [Ca2+]i elevation was reduced by
54% by XeC and blocked by 2-APB (Fig. 1C). XeC did not significantly change spontaneous Ca2+ wave frequency (0.07 ± 0.05 Hz, n = 4, P > 0.05), whereas 2-APB abolished these events (0 ± 0 Hz, n = 4, P < 0.05). These data indicate that IP3R activation contributes to UTP-induced Ca2+ waves and global [Ca2+]i elevation in cerebral artery smooth muscle cells.
|
100) of individually collected cerebral artery smooth muscle cells, as we have done previously (9). Transcripts for all three IP3R isoforms were amplified using conventional RT-PCR (Fig. 2A). Quantitative real-time PCR indicated that IP3R1 mRNA was the most abundant, at
82% of total IP3R message (Fig. 2B). Western blotting was performed using IP3R isoform-specific antibodies to detect proteins in rat cerebral artery lysate. Consistent with data obtained from RT-PCR experiments, protein bands for IP3R1, IP3R2, and IP3R3 were detected in whole brain and rat cerebral artery lysates, with the IP3R1 band the most prominent and IP3R2 the least intense (Fig. 2C). Immunofluorescence also identified IP3R1, IP3R2, and IP3R3 protein in freshly isolated cerebral artery smooth muscle cells (Fig. 2D). Collectively, these data indicate that IP3R1 is the most abundant IP3R isoform expressed in rat cerebral artery smooth muscle cells.
|
67 and 53%, respectively, of that in arteries treated with IP3R1scrm (Fig. 3). Insertion of both IP3R1shV1 + IP3R1shV2 decreased mean IP3R1 expression to
48% of that in arteries treated with IP3R1scrm (Fig. 3). IP3R1 knockdown did not alter IP3R3 protein, as determined by reprobing membranes with an IP3R3-selective antibody (Fig. 3B).
|
61% (Fig. 4, A and B). IP3R1 knockdown did not alter resting [Ca2+]i [fura-2 ratio at 340-nm emission to 380-nm emission = 1.03 ± 0.05 (n = 16) for IP3R1scrm and 1.08 ± 0.08 (n = 14, P > 0.05) for IP3R1shV] or SR Ca2+ load, as determined by measuring caffeine (10 mM)-induced [Ca2+]i transients (Fig. 4, C and D). These data indicate that IP3R1 activation is essential for UTP-induced Ca2+ signal modification in arterial smooth muscle cells.
|
70% and attenuated the UTP-induced Icat elevation by
85% compared with a denatured antibody control (Fig. 5). Icat regulation was also studied in smooth muscle cells isolated from arteries in which IP3R1 expression was reduced using shRNA. Baseline current density in IP3R1scrm and IP3R1shV were similar [–3.8 ± 0.7 pA/pF (n = 11) and –3.9 ± 1.1 pA/pF (n = 4), respectively, P > 0.05; Fig. 6]. However, UTP-induced Icat activation was reduced by
87% in IP3R1shV-treated smooth muscle cells compared with cells treated with IP3R1scrm (Fig. 6). These data indicate that IP3R1 is required for UTP-induced Icat activation in cerebral artery smooth muscle cells.
|
|
52% compared with scrambled control (Fig. 7). Thapsigargin (100 nM–1 µM), at concentrations that deplete SR Ca2+ in cerebral artery smooth muscle cells (54), did not alter arterial diameter (Fig. 7). In SR Ca2+-depleted arteries, IP3R1 knockdown also reduced mean UTP-induced vasoconstriction by
57% (100 nM thapsigargin) and 62% (1 µM thapsigargin). These data indicate that IP3R1 activation is essential for UTP-induced vasoconstriction in cerebral arteries.
|
| DISCUSSION |
|---|
|
|
|---|
Previous studies detected IP3R isoforms that are expressed in the vasculature by performing RT-PCR and immunofluorescence on whole vessels or cultured vascular smooth muscle cells (17, 32, 51, 56). These studies suggested that all three IP3R isoforms are expressed in cultured aortic smooth muscle cells, whole aorta, and mesenteric and basilar arteries, whereas IP3R3 was absent in cultured portal vein smooth muscle cells (17, 32, 51, 56). Using quantitative RT-PCR, we show that all three IP3R isoforms are expressed in freshly isolated, selected cerebral artery smooth muscle cells, with IP3R1 message being the most abundant. Immunofluorescence also identified all three IP3R isoforms in isolated smooth muscle cells, and Western blotting of cerebral artery lysate supported the quantitative PCR data suggesting that IP3R1 was the most abundant protein. These data indicate that IP3R1 is by far the most prevalent IP3R isoform expressed in cerebral artery smooth muscle cells.
UTP-induced phospholipase C activation elevates diacylglycerol (DAG), leading to PKC activation, and increases IP3, leading to IP3R activation (35, 44). Vasoconstrictors, including UTP, block Ca2+ sparks, activate Ca2+ waves and oscillations, and elevate global [Ca2+]i in arterial smooth muscle cells (23, 31, 52). UTP-induced Ca2+ spark inhibition occurs as a result of PKC activation (23). Mechanisms that generate Ca2+ waves and the physiological functions of these Ca2+ signals in vascular smooth muscle cells are unclear. Vasoconstrictors elevate Ca2+ wave frequency, and depletion of SR Ca2+ abolishes these events (23, 30). Different proposals have been developed to explain mechanisms that generate and propagate Ca2+ waves (7, 15, 16, 18). One model suggests that ryanodine receptor (RyR) channel and IP3R activation is required for Ca2+ wave generation and propagation (7, 15, 16, 26). In this scenario, IP3 acts as a primer to trigger Ca2+ release through SR IP3Rs. Released Ca2+ then stimulates further Ca2+ release by activating RyR channels, and waves proceed independently of IP3Rs. Another proposal suggests that IP3R activation alone is sufficient to initiate and propagate waves through Ca2+-induced Ca2+ release (18, 26). Both concepts indicate that IP3Rs are required for Ca2+ wave generation. In cultured human coronary artery smooth muscle cells, IP3 generation and subsequent IP3R activation are required for UTP-induced SR Ca2+ release (44). Our data obtained using pharmacological blockers, antibodies, and protein knockdown indicate that IP3R1 is required for UTP-induced Ca2+ wave generation and propagation. IP3R1 knockdown did not change SR Ca2+ load, which would have indirectly affected Ca2+ wave frequency (23, 30). Thus data suggest that IP3R1 knockdown inhibits Ca2+ waves by reducing the number of IP3R1 channels that contribute to these signaling events. Intracellular IP3 concentration should be low in the absence of exogenous receptor agonists, although UTP may be released from endothelial cells under resting conditions, which may generate additional IP3 (24, 25, 38). Since IP3R1 knockdown and XeC did not alter baseline Ca2+ wave frequency in the absence of UTP, our data suggest that the contribution of IP3 to Ca2+ waves in the absence of agonists is small. These data support previous evidence that spontaneous Ca2+ waves occur due to RyR channel activation and that RyR channel activation alone can produce Ca2+ waves (8, 19). In contrast to effects of XeC and IP3R knockdown, 2-APB abolished spontaneous Ca2+ waves. This effect may occur as a result of nonspecific actions of 2-APB on mitochondria and nonselective cation channels, in addition to IP3R inhibition (33). In cultured portal vein smooth muscle cells, IP3R2 activation was required for ACh-induced global Ca2+ oscillations, whereas targeting of IP3R1 had no effect on these Ca2+ signals (32). These different findings raise the possibility that IP3Rs exhibit variable expression profiles and physiological functions in smooth muscle cells of anatomically different vessels and in cultured versus noncultured smooth muscle cells.
Collectively, data presented here and in our previous study indicate that IP3R1 activation contributes to agonist-induced Icat activation in cerebral artery smooth muscle cells (54). TRPC channels, including TRPC1, TRPC3, TRPC5, TRPC6, and TRPC7, are expressed in vascular smooth muscle cells and may contribute to Icat (2, 12, 28, 36, 39, 40, 54). In cerebral artery smooth muscle cells, TRPC3 channel knockdown attenuated endothelin-1- and IP3-induced [Ca2+]i elevation and constriction, indicating that this isoform is a major contributor to the IP3R-induced Icat in this cell type (54). The mechanism by which IP3R activation stimulates Icat in arterial smooth muscle cells is unclear. Studies using protein overexpression have demonstrated that a consensus sequence present on the COOH terminus of all TRPC channel isoforms recognizes an NH2-terminal binding domain found in all IP3R isoforms (46). It has been proposed that physical coupling of these two domains removes inhibitory calmodulin from the TRPC channel COOH terminus, leading to channel activation (46, 55). Whether a similar coupling mechanism underlies IP3R regulation of Icat and TRPC3 channels in arterial smooth muscle cells remains to be determined but is one possibility.
Our data indicate that IP3R1 suppression with antibodies or shRNA attenuated UTP-induced Icat activation by
85%. This level of inhibition is large, given that UTP-induced phospholipase C activation also elevates DAG, and DAG and 1-oleoyl-2-acetyl-sn-glycerol (OAG), a DAG analog, activated Icat in rat cerebral and rabbit coronary artery smooth muscle cells, portal vein smooth muscle cells, and cells overexpressing TRPC channels (3, 20, 34, 42). In cerebral artery smooth muscle cells, PKC activation stimulates an Icat by increasing the apparent micromolar Ca2+ sensitivity of TRPM4 channels (13, 42). In our patch-clamp experiments, EGTA was used to clamp free Ca2+ at a physiological concentration of 100 nM. Therefore, UTP-induced PKC activation would not be expected to activate TRPM4 channels, and the strong inhibitory effect of IP3R1 inhibition on UTP-induced Icat may be due to an effect on TRPC channels alone. However, PKC regulation of TRPC channels is complex, with studies reporting activation, inhibition, or no effect on TRP channels, including those using smooth muscle cells from a variety of blood vessels (4, 34, 41, 49, 50). In rabbit coronary artery smooth muscle cells, IP3 potentiated DAG-induced Icat activation, and heparin blocked this activation, indicating that IP3Rs mediated this response (34). In cerebral artery smooth muscle cell inside-out patches, IP3 and OAG did not activate cation channels, and OAG did not facilitate IP3-induced cation channel activation (54). Whether interactions occur between IP3Rs and PKC in Icat activation and what the mechanisms are in cerebral artery smooth muscle cells remain to be determined. Nevertheless, our data indicate that IP3R activation is a key mechanism mediating agonist-induced Icat activation in these cells.
An elevation in global [Ca2+]i stimulates vasoconstriction, whereas a reduction in global [Ca2+]i leads to vasodilation. UTP elevated global [Ca2+]i, and this effect was blocked by 2-APB and attenuated by XeC and IP3R1 knockdown. To study physiological functions of IP3R1 that occur through SR Ca2+ release-dependent and -independent mechanisms, diameter measurements were obtained at an intravascular pressure of 20 mmHg to reduce the influence of SR Ca2+ depletion regulating diameter through Ca2+ spark inhibition, as we have done previously (54). UTP-induced vasoconstriction was inhibited by IP3R1 knockdown, consistent with effects on Ca2+ signals. More importantly, UTP-induced vasoconstriction was inhibited by IP3R1 knockdown, even though SR Ca2+ depletion did not alter UTP-induced vasoconstriction. In addition, SR Ca2+ depletion did not alter arterial diameter at 20 mmHg, consistent with previous data (54). Taken together, data indicate that 1) IP3R1 activation contributes to UTP-induced vasoconstriction, 2) at 20 mmHg, SR Ca2+ release does not contribute to UTP-induced vasoconstriction, 3) SR Ca2+ load does not regulate arterial diameter at low pressure, and 4) UTP-induced IP3R1 activation constricts cerebral arteries through an SR Ca2+ release-independent mechanism. We propose that, in cerebral artery smooth muscle cells, UTP stimulates IP3R1, leading to Icat activation, membrane depolarization, voltage-dependent Ca2+ channel activation, a global [Ca2+]i elevation, and vasoconstriction. We also show that UTP-induced Ca2+ waves require IP3R1 activation and SR Ca2+ release (22). Since SR Ca2+ depletion did not alter UTP-induced vasoconstriction, our data suggest that SR Ca2+ release and, thus, Ca2+ waves do not contribute to UTP-induced vasoconstriction. These data support our previous observation that SR Ca2+ release does not contribute to IP3-induced vasoconstriction at low pressure (54). We have also shown that elevating pressure to 60 mmHg increases the contribution of SR Ca2+ release to IP3-induced vasoconstriction (54). Conceivably, vasoconstrictor-induced Ca2+ waves may directly contribute to contraction at higher pressures.
Physiological functions of IP3R2 and IP3R3 were not directly investigated in the present study. By comparing effects of XeC, a blocker of all IP3R isoforms, and those of IP3R1 knockdown and antibodies, data suggest that IP3R1 is the principal molecular isoform mediating UTP-induced Icat activation, Ca2+ wave stimulation, and contraction in cerebral artery smooth muscle cells. Partial IP3R1 knockdown almost completely blocked UTP-induced Icat and Ca2+ wave activation and partially attenuated vasoconstriction. IP3R2 and IP3R3 are expressed and therefore, these proteins are highly likely to perform physiological functions in arterial myocytes. We do not rule out physiological functions for IP3R2 and IP3R3. However, our data indicate a principal function for IP3R1 in mediating these responses.
In summary, the present study provides evidence that all three IP3R isoforms are expressed in rat cerebral artery smooth muscle cells and that IP3R1 is the most abundant subtype. We also show that IP3R1 activation contributes to UTP-induced Icat activation, Ca2+ wave stimulation, global [Ca2+]i elevation, and vasoconstriction. These data indicate that IP3R1 activation is necessary for UTP-induced vasoconstriction.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Albert AP, Large WA. Store-operated Ca2+-permeable non-selective cation channels in smooth muscle cells. Cell Calcium 33: 345–356, 2003.[CrossRef][Web of Science][Medline]
3. Albert AP, Large WA. Synergism between inositol phosphates and diacylglycerol on native TRPC6-like channels in rabbit portal vein myocytes. J Physiol 552: 789–795, 2003.
4. Albert AP, Large WA. Inhibitory regulation of constitutive transient receptor potential-like cation channels in rabbit ear artery myocytes. J Physiol 560: 169–180, 2004.
5. Blatter LA, Wier WG. Agonist-induced [Ca2+]i waves and Ca2+-induced Ca2+ release in mammalian vascular smooth muscle cells. Am J Physiol Heart Circ Physiol 263: H576–H586, 1992.
6. Blondel O, Takeda J, Janssen H, Seino S, Bell GI. Sequence and functional characterization of a third inositol trisphosphate receptor subtype, IP3R-3, expressed in pancreatic islets, kidney, gastrointestinal tract, and other tissues. J Biol Chem 268: 11356–11363, 1993.
7. Boittin FX, Macrez N, Halet G, Mironneau J. Norepinephrine-induced Ca2+ waves depend on InsP3 and ryanodine receptor activation in vascular myocytes. Am J Physiol Cell Physiol 277: C139–C151, 1999.
8. Cheng H, Lederer MR, Lederer WJ, Cannell MB. Calcium sparks and [Ca2+]i waves in cardiac myocytes. Am J Physiol Cell Physiol 270: C148–C159, 1996.
9. Cheng X, Liu J, Asuncion-Chin M, Blaskova E, Bannister JP, Dopico AM, Jaggar JH. A novel CaV1.2 N terminus expressed in smooth muscle cells of resistance size arteries modifies channel regulation by auxiliary subunits. J Biol Chem 282: 29211–29221, 2007.
10. Cheranov SY, Jaggar JH. Mitochondrial modulation of Ca2+ sparks and transient KCa currents in smooth muscle cells of rat cerebral arteries. J Physiol 556: 755–771, 2004.
11. Cheranov SY, Jaggar JH. Sarcoplasmic reticulum calcium load regulates rat arterial smooth muscle calcium sparks and transient KCa currents. J Physiol 544: 71–84, 2002.
12. Dietrich A, Kalwa H, Rost BR, Gudermann T. The diacylgylcerol-sensitive TRPC3/6/7 subfamily of cation channels: functional characterization and physiological relevance. Pflügers Arch 451: 72–80, 2005.[CrossRef][Web of Science][Medline]
13. Earley S, Straub SV, Brayden JE. Protein kinase C regulates vascular myogenic tone through activation of TRPM4. Am J Physiol Heart Circ Physiol 292: H2613–H2622, 2007.
14. Foskett JK, White C, Cheung KH, Mak DO. Inositol trisphosphate receptor Ca2+ release channels. Physiol Rev 87: 593–658, 2007.
15. Goldbeter A, Dupont G, Berridge MJ. Minimal model for signal-induced Ca2+ oscillations and for their frequency encoding through protein phosphorylation. Proc Natl Acad Sci USA 87: 1461–1465, 1990.
16. Gordienko DV, Bolton TB. Crosstalk between ryanodine receptors and IP3 receptors as a factor shaping spontaneous Ca2+-release events in rabbit portal vein myocytes. J Physiol 542: 743–762, 2002.
17. Grayson TH, Haddock RE, Murray TP, Wojcikiewicz RJ, Hill CE. Inositol 1,4,5-trisphosphate receptor subtypes are differentially distributed between smooth muscle and endothelial layers of rat arteries. Cell Calcium 36: 447–458, 2004.[CrossRef][Web of Science][Medline]
18. Hajnoczky G, Thomas AP. Minimal requirements for calcium oscillations driven by the IP3 receptor. EMBO J 16: 3533–3543, 1997.[CrossRef][Web of Science][Medline]
19. Heppner TJ, Bonev AD, Santana LF, Nelson MT. Alkaline pH shifts Ca2+ sparks to Ca2+ waves in smooth muscle cells of pressurized cerebral arteries. Am J Physiol Heart Circ Physiol 283: H2169–H2176, 2002.
20. Hofmann T, Obukhov AG, Schaefer M, Harteneck C, Gudermann T, Schultz G. Direct activation of human TRPC6 and TRPC3 channels by diacylglycerol. Nature 397: 259–263, 1999.[CrossRef][Web of Science][Medline]
21. Iino M, Kasai H, Yamazawa T. Visualization of neural control of intracellular Ca2+ concentration in single vascular smooth muscle cells in situ. EMBO J 13: 5026–5031, 1994.[Web of Science][Medline]
22. Jaggar JH. Intravascular pressure regulates local and global Ca2+ signaling in cerebral artery smooth muscle cells. Am J Physiol Cell Physiol 281: C439–C448, 2001.
23. Jaggar JH, Nelson MT. Differential regulation of Ca2+ sparks and Ca2+ waves by UTP in rat cerebral artery smooth muscle cells. Am J Physiol Cell Physiol 279: C1528–C1539, 2000.
24. Lazarowski ER, Boucher RC. UTP as an extracellular signaling molecule. News Physiol Sci 16: 1–5, 2001.
25. Lazarowski ER, Homolya L, Boucher RC, Harden TK. Direct demonstration of mechanically induced release of cellular UTP and its implication for uridine nucleotide receptor activation. J Biol Chem 272: 24348–24354, 1997.
26. Lechleiter JD, Clapham DE. Molecular mechanisms of intracellular calcium excitability in X. laevis oocytes. Cell 69: 283–294, 1992.[CrossRef][Web of Science][Medline]
27. Liu M, Albert AP, Large WA. Facilitatory effect of Ins(1,4,5)P3 on store-operated Ca2+-permeable cation channels in rabbit portal vein myocytes. J Physiol 566: 161–171, 2005.
28. Maruyama Y, Nakanishi Y, Walsh EJ, Wilson DP, Welsh DG, Cole WC. Heteromultimeric TRPC6-TRPC7 channels contribute to arginine vasopressin-induced cation current of A7r5 vascular smooth muscle cells. Circ Res 98: 1520–1527, 2006.
29. Mauban JR, Lamont C, Balke CW, Wier WG. Adrenergic stimulation of rat resistance arteries affects Ca2+ sparks, Ca2+ waves, and Ca2+ oscillations. Am J Physiol Heart Circ Physiol 280: H2399–H2405, 2001.
30. McCarron JG, Bradley KN, MacMillan D, Chalmers S, Muir TC. The sarcoplasmic reticulum, Ca2+ trapping, and wave mechanisms in smooth muscle. News Physiol Sci 19: 138–147, 2004.
31. Miriel VA, Mauban JR, Blaustein MP, Wier WG. Local and cellular Ca2+ transients in smooth muscle of pressurized rat resistance arteries during myogenic and agonist stimulation. J Physiol 518: 815–824, 1999.
32. Morel JL, Fritz N, Lavie JL, Mironneau J. Crucial role of type 2 inositol 1,4,5-trisphosphate receptors for acetylcholine-induced Ca2+ oscillations in vascular myocytes. Arterioscler Thromb Vasc Biol 23: 1567–1575, 2003.
33. Peppiatt CM, Collins TJ, Mackenzie L, Conway SJ, Holmes AB, Bootman MD, Berridge MJ, Seo JT, Roderick HL. 2-Aminoethoxydiphenyl borate (2-APB) antagonises inositol 1,4,5-trisphosphate-induced calcium release, inhibits calcium pumps and has a use-dependent and slowly reversible action on store-operated calcium entry channels. Cell Calcium 34: 97–108, 2003.[Web of Science][Medline]
34. Peppiatt-Wildman CM, Albert AP, Saleh SN, Large WA. Endothelin-1 activates a Ca2+-permeable cation channel with TRPC3 and TRPC7 properties in rabbit coronary artery myocytes. J Physiol 580: 755–764, 2007.
35. Ralevic V, Burnstock G. Receptors for purines and pyrimidines. Pharmacol Rev 50: 413–492, 1998.
36. Reading SA, Earley S, Waldron BJ, Welsh DG, Brayden JE. TRPC3 mediates pyrimidine receptor-induced depolarization of cerebral arteries. Am J Physiol Heart Circ Physiol 288: H2055–H2061, 2005.
37. Ross CA, Danoff SK, Schell MJ, Snyder SH, Ullrich A. Three additional inositol 1,4,5-trisphosphate receptors: molecular cloning and differential localization in brain and peripheral tissues. Proc Natl Acad Sci USA 89: 4265–4269, 1992.
38. Saiag B, Shacoori V, Bodin P, Catheline M, Burnstock G. Lack of uptake, release and action of UTP at sympathetic perivascular nerve terminals in rabbit ear artery. Eur J Pharmacol 358: 139–145, 1998.[CrossRef][Web of Science][Medline]
39. Saleh SN, Albert AP, Peppiatt CM, Large WA. Angiotensin II activates two cation conductances with distinct TRPC1 and TRPC6 channel properties in rabbit mesenteric artery myocytes. J Physiol 577: 479–495, 2006.
40. Saleh SN, Albert AP, Peppiatt-Wildman CM, Large WA. Diverse properties of store-operated TRPC channels activated by protein kinase C in vascular myocytes. J Physiol 586: 2463–2476, 2008.
41. Shi J, Mori E, Mori Y, Mori M, Li J, Ito Y, Inoue R. Multiple regulation by calcium of murine homologues of transient receptor potential proteins TRPC6 and TRPC7 expressed in HEK293 cells. J Physiol 561: 415–432, 2004.
42. Slish DF, Welsh DG, Brayden JE. Diacylglycerol and protein kinase C activate cation channels involved in myogenic tone. Am J Physiol Heart Circ Physiol 283: H2196–H2201, 2002.
43. Somlyo AP, Somlyo AV. Signal transduction and regulation in smooth muscle. Nature 372: 231–236, 1994.[CrossRef][Web of Science][Medline]
44. Strobaek D, Olesen SP, Christophersen P, Dissing S. P2-purinoceptor-mediated formation of inositol phosphates and intracellular Ca2+ transients in human coronary artery smooth muscle cells. Br J Pharmacol 118: 1645–1652, 1996.[Web of Science][Medline]
45. Takei K, Shin RM, Inoue T, Kato K, Mikoshiba K. Regulation of nerve growth mediated by inositol 1,4,5-trisphosphate receptors in growth cones. Science 282: 1705–1708, 1998.
46. Tang J, Lin Y, Zhang Z, Tikunova S, Birnbaumer L, Zhu MX. Identification of common binding sites for calmodulin and inositol 1,4,5-trisphosphate receptors on the carboxyl termini of trp channels. J Biol Chem 276: 21303–21310, 2001.
47. Tasker PN, Taylor CW, Nixon GF. Expression and distribution of InsP3 receptor subtypes in proliferating vascular smooth muscle cells. Biochem Biophys Res Commun 273: 907–912, 2000.[CrossRef][Web of Science][Medline]
48. Taylor CW, Genazzani AA, Morris SA. Expression of inositol trisphosphate receptors. Cell Calcium 26: 237–251, 1999.[CrossRef][Web of Science][Medline]
49. Trebak M, Hempel N, Wedel BJ, Smyth JT, Bird GS, Putney JW Jr. Negative regulation of TRPC3 channels by protein kinase C-mediated phosphorylation of serine 712. Mol Pharmacol 67: 558–563, 2005.
50. Venkatachalam K, Zheng F, Gill DL. Regulation of canonical transient receptor potential (TRPC) channel function by diacylglycerol and protein kinase C. J Biol Chem 278: 29031–29040, 2003.
51. Wang Y, Chen J, Wang Y, Taylor CW, Hirata Y, Hagiwara H, Mikoshiba K, Toyo-oka T, Omata M, Sakaki Y. Crucial role of type 1, but not type 3, inositol 1,4,5-trisphosphate (IP3) receptors in IP3-induced Ca2+ release, capacitative Ca2+ entry, and proliferation of A7r5 vascular smooth muscle cells. Circ Res 88: 202–209, 2001.
52. Welsh DG, Brayden JE. Mechanisms of coronary artery depolarization by uridine triphosphate. Am J Physiol Heart Circ Physiol 280: H2545–H2553, 2001.
53. Wilkerson MK, Heppner TJ, Bonev AD, Nelson MT. Inositol trisphosphate receptor calcium release is required for cerebral artery smooth muscle cell proliferation. Am J Physiol Heart Circ Physiol 290: H240–H247, 2006.
54. Xi Q, Adebiyi A, Zhao G, Chapman KE, Waters CM, Hassid A, Jaggar JH. IP3 constricts cerebral arteries via IP3 receptor-mediated TRPC3 channel activation and independently of sarcoplasmic reticulum Ca2+ release. Circ Res 102: 1118–1126, 2008.
55. Zhang Z, Tang J, Tikunova S, Johnson JD, Chen Z, Qin N, Dietrich A, Stefani E, Birnbaumer L, Zhu MX. Activation of Trp3 by inositol 1,4,5-trisphosphate receptors through displacement of inhibitory calmodulin from a common binding domain. Proc Natl Acad Sci USA 98: 3168–3173, 2001.
56. Zhou H, Nakamura T, Matsumoto N, Hisatsune C, Mizutani A, Iesaki T, Daida H, Mikoshiba K. Predominant role of type 1 IP3 receptor in aortic vascular muscle contraction. Biochem Biophys Res Commun 369: 213–219, 2008.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
J. P. Bannister, A. Adebiyi, G. Zhao, D. Narayanan, C. M. Thomas, J. Y. Feng, and J. H. Jaggar Smooth Muscle Cell {alpha}2{delta}-1 Subunits Are Essential for Vasoregulation by CaV1.2 Channels Circ. Res., November 6, 2009; 105(10): 948 - 955. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.-W. Zhou, Y. Jin, S. G. Matta, M. Xu, and F.-M. Zhou An Ultra-Short Dopamine Pathway Regulates Basal Ganglia Output J. Neurosci., August 19, 2009; 29(33): 10424 - 10435. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |