Am J Physiol Cell Physiol  AJP: Regulatory, Integrative and Comparative Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 295: C138-C145, 2008. First published April 23, 2008; doi:10.1152/ajpcell.00512.2007
0363-6143/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
295/1/C138    most recent
00512.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thieme, K.
Right arrow Articles by Oliveira-Souza, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thieme, K.
Right arrow Articles by Oliveira-Souza, M.

RECEPTORS AND SIGNAL TRANSDUCTION

The effect of angiotensin II on intracellular pH is mediated by AT1 receptor translocation

Karina Thieme, Débora Mai N. Eguti, Margarida Mello-Aires, and Maria Oliveira-Souza

Department of Physiology and Biophysics, Instituto de Ciências Biomédicas, University of São Paulo, São Paulo, Brazil

Submitted 30 October 2007 ; accepted in final form 22 April 2008


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The effect of ANG II on intracellular pH (pHi) recovery rate and AT1 receptor translocation was investigated in transfected MDCK cells. The pHi recovery rate was evaluated by fluorescence microscopy using the fluorescent probe BCECF-AM. The human angiotensin II receptor isoform 1 (hAT1) translocation was analyzed by immunofluorescence and confocal microscope. Our data show that transfected cells in control situation have a pHi recovery rate of 0.219 ± 0.017 pH U/min (n = 11). This value was similar to nontransfected cells [0.211 ± 0.009 pH U/min (n = 12)]. Both values were significantly increased with ANG II (10–9 M) but not with ANG II (10–6 M). Losartan (10–7 M) and dimethyl-BAPTA-AM (10–7 M) decreased significantly the stimulatory effect of ANG II (10–9 M) and induced an increase in Na+/H+ exchanger 1 (NHE-1) activity with ANG II (10–6 M). Immunofluorescence studies indicated that in control situation, the hAT1 receptor was predominantly expressed in cytosol. However, it was translocated to plasma membrane with ANG II (10–9 M) and internalized with ANG II (10–6 M). Losartan (10–7 M) induced hAT1 translocation to plasma membrane in all studied groups. Dimethyl-BAPTA-AM (10–7 M) did not change the effect of ANG II (10–9 M) on the hAT1 receptor distribution but induced its accumulation at plasma membrane in cells treated with ANG II (10–6 M). With ionomycin (10–6 M), the receptor was accumulated in cytosol. The results indicate that, in MDCK cells, the effect of ANG II on NHE-1 activity is associated with ligand binding to AT1 receptor and intracellular signaling events related to AT1 translocation.

cytosolic Ca2+ levels; Madin-Darby canine kidney cells; Na+/H+ exchanger


THE OCTAPEPTIDE ANGIOTENSIN II (ANG II) is a multifunctional hormone that regulates many physiological processes such as blood pressure, plasma volume, sympathetic nervous activity, and thirst responses. All of these processes depend on the initial binding of the peptide to its specific membrane receptors, AT1 or AT2, followed by intracellular signaling pathways (4, 5, 6, 23).

In humans, the AT1 receptor not only regulates physiological responses to ANG II but is also the major ANG II receptor involved in pathophysiological signaling in many tissues (26). It is a seven-transmembrane G protein-coupled receptor (GPCR), which interacts with various G proteins, including G{alpha}q/11, Gi, and G{alpha}12/13 (11, 12, 24). The regulatory carboxy terminus T332-S335-T336-S338 of AT1 receptor is the major site for G protein coupling, activation, and phosphorylation in response to ANG II (22). For many GPCRs, the phosphorylation causes desensitization of the receptor by binding of β-arrestin proteins, which disrupt the interaction of receptor with G proteins. β-Arrestins have also been implicated in receptor endocytosis by a clathrin-dependent pathway (2). Additional internalization mechanisms, such as endocytosis via caveolae or noncoated vesicles, may also occur (10, 15, 27, 31).

Previous studies demonstrated that in low concentrations, ANG II, via AT1 and G{alpha}q/11 protein, modulates the PLC-catalyzed hydrolysis of phosphatidyl-inositol 4,5-bisphosphate, generating inositol triphosphate (IP3) and diacylglicerol (DAG), which are respectively involved in Ca2+ mobilization and protein kinase C (PKC) activation (6, 14, 21, 28, 32). However, in high concentrations, ANG II also induces PLC pathway and the activation of PLA2, release of arachidonic acid (AA), and mobilization of high intracellular Ca2+ levels (6, 14, 21). These different pathways are associated with Na+/H+ exchanger (NHE) regulation by ANG II (1, 21).

It is known that Madin-Darby canine kidney (MDCK) cells express vacuolar H+-ATPase (8), H+/K+-ATPase (7), and only the Na+/H+ exchanger 1 (NHE-1) (29). Using the same cell line, we previously demonstrated that ANG II has a dose-response effect on intracellular Ca2+ levels and Na+-dependent pH recovery rate, after acid loading (21). Thus, the purpose of the present study was to examine whether the effect of ANG II on NHE-1 activity is associated with AT1 receptor translocation and intracellular Ca2+ levels. To address this study, we used MDCK cells expressing only endogenous AT1 or overexpressing the recombinant hAT1/pEGFP-N1 [human angiotensin II receptor isoform 1 (hAT1) cloned into the green fluorescent protein vector in its NH2 terminus (pEGFP-N1)] to investigate the AT1 receptor translocation through the different cellular compartments and its association with NHE-1 activity. Our results suggest that the effect of ANG II on intracellular pH (pHi) recovery rate depends on many events, including receptor-ligand binding, receptor conformational state, intracellular signaling cascades involved with Ca2+ levels, and receptor recycling.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Solutions and reagents. Dulbecco's modified Eagle's medium (DMEM), penicillin, streptomycin, and geneticin (G418) were purchased from GIBCO (Grand Island, NY); TRIzol LS Reagent kit was purchased from Life Technologies; nigericin, ANG II, N-methyl-D-glucamine (NMDG), and protease inhibitor cocktail were purchased from Sigma; 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein-acetoxymethyl ester (BCECF-AM), dimethyl-[1,2-bis (2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid]-BAPTA-AM (dimethyl-BAPTA-AM), ionomycin, and anti-green fluorescent protein (GFP) antibody were purchased from Molecular Probes; anti-AT1 antibody was purchased from Santa Cruz Biotechnology; conjugated antibodies (anti-rabbit or anti-mouse) were purchased from Jackson ImmunoResearch Laboratories; pEGFP-N1 vector-Clontech was provided by Dr. Carlos Menck from University of São Paulo; chemiluminescence system and immunoblot reagents were purchased from Amersham Biosciences; fetal bovine serum and trypsin were purchased from Cultilab, and losartan was provided by M. de Mello Aires from University of São Paulo. All other chemicals were purchased from Invitrogen or Sigma. All solutions presented osmolality around 300 mosmol/kgH2O, which is the value found in the culture medium used for these cells.

Cell culture. Wild-type MDCK cells, a permanent cell line derived from renal collecting duct (16), were obtained from the American Type Culture Collection (ATCC, Manassas, VA) and were cultured in DMEM supplemented with 10% fetal bovine serum, 100 IU/ml penicillin, 100 µg/ml streptomycin, and 2 mmol/l L-glutamine. Cells were grown at 37°C, pH 7.4, with 5% CO2 in a CO2 incubator. For each experiment, cells (passages 5565) were cultured until 80–90% confluent.

RT-PCR and PCR. The total RNA from human colon (T84 cells) was obtained through RT-PCR with the TRIzol LS Reagent kit. The mRNA of the hAT1 receptor was selected from the total RNA with random primers. This mRNA was used to obtain the first cDNA, which was amplified through PCR, with a set of PCR primers containing sites of the Bgl II and BamH I restriction enzymes (sense: ccccagatctgagatgattctcaactctt; antisense: caggatccctcaacctcaaaac). The cDNA (PCR product) was cloned into the pEGFP-N1 expression vector in the same restriction enzymes sites. The GFP vectors, when bound to the DNA of interest and transfected into the cells, facilitate the identification of the studied protein through fluorescence microscopy.

Stable transfection. Twenty-four hours before the transfection, cells were harvested with trypsin in ethyleneglycol-bis (β-aminoethyl ether)-N,N'-tetraacetic acid (0.02%) and then seeded onto six-well culture plates up to 60% of confluence. For each well, cells were transfected with 1 ml Opti-MEM, 10 µl Lipofectamine 2000, and 6 µg cDNA (hAT1/pEGFP-N1). Cells were incubated for 5 h at 37°C with 5% CO2 and then cultured for 24 h in DMEM supplemented with 10% fetal bovine serum, 100 IU/ml penicillin, 100 µg/ml streptomycin, and 2 mmol/l L-glutamine. The individual cell lines that stably expressed the recombinant hAT1/pEGFP-N1 were selected with geneticin (G418 1 mg/ml) and used for all experiments (passages 419).

Immunoblot. Cells were rinsed with ice-cold 1% PBS and scraped from the plate with a rubber scraper. The cellular suspension was pelleted through centrifugation at 3000 g. The pellet was resuspended in 50 µl sodium phosphate buffer (5 mM pH 8.0) plus protease inhibitor cocktail. All protein concentrations were determined through Micro BCA assay (Pierce). Samples containing total proteins were diluted 1:1 in buffer A (62.5 mM Tris·HCl, pH 6.8, 2% SDS, 20% glycerol, 1.96% β-mercaptoethanol, 0.05% bromophenol blue, and protease inhibitor cocktail), resolved by 10% SDS-PAGE, and transferred to nitrocellulose membrane. After being blocked with 5% nonfat milk for 1 h, blots were probed in the same buffer overnight at 4°C with anti-AT1 or anti-GFP antibodies at dilution of 1:1,000. Blots were washed five times for 10 min in PBS plus 0.05% Tween 20 and were then incubated with a 1:1,000 dilution of the secondary antibody (anti-rabbit for anti-AT1 and anti-mouse for anti-GFP). Blots were washed as described above and then visualized with an enhanced chemiluminescence kit.

Fluorescence pHi measurement. pHi was monitored by using the BCECF-AM fluorescent probe. Cells grown to confluence on glass coverslips were dyed through exposure for 20 min to 15 µl BCECF-AM in control solution containing Na+ [(in mM) 134 NaCl, 5 KCl, 1 MgCl2, 0.8 NaH2PO4, 0.83 Na2HPO4, 1.8 CaCl2, 8 HEPES, and 5 glucose, pH 7.4]. Intracellular esterasis rapidly converted the BCECF-AM that entered the cells into its anionic-free acid form. After this, the glass coverslips were rinsed with the control solution to remove the BCECF-containing solution and were placed into a thermoregulated chamber assembled on an inverted epifluorescence microscope (Nikon, TMD). The area measured under the microscope presented a diameter of 260 µm, and all experiments were performed at 37°C. The cells were alternately excited at 440 or 495 nm with a 150 W xenon lamp, and the fluorescence emission was monitored at 530 nm through a photomultiplier-based fluorescence system (PMT-400, Georgia Instruments) at 5-s intervals. The 495/440 excitation ratio corresponds to a specific pHi. At the end of each experiment, the calibration of the BCECF signal was achieved using the high K+-nigericin method, exposing cells for 15 min to a "high-K+ solution" [(in mM) 20 NaCl, 130 KCl, 1 MgCl2, 1 CaCl2, and 5 HEPES] containing 10 µM nigericin adjusted to various pH values.

Cell pH recovery. Cell pH recovery was examined after acid loading (NH4Cl pulse technique) (3), by exposing cells for 2 min to 20 mM NH4Cl [(in mM) 125 NaCl, 5 KCl, 1 MgCl2, 0.8 NaH2PO4, 0.83 Na2HPO4, 1 CaCl2, 8 HEPES, 5 glucose, and 20 NH4Cl, pH 7.4]. The Na+-independent pHi recovery was induced by reperfusion with a Na+-free solution (NaCl from control solution was replaced by 134 mM NMDG; pH 7.4). The Na+-dependent pHi recovery was induced by bathing cells with 134 mM Na+ solution or plus ANG II (10–9 or 10–6 M), and/or losartan (10–7 M; AT1 receptor inverse agonist), and/or dimethyl-BAPTA-AM (10–7 M; an intracellular calcium chelator). In all experiments, the initial pHi recovery rate was calculated (dpHi/dt, pH U/min) during the first 2 min of the recovery curve through linear regression analysis.

Immunofluorescence. Transfected MDCK cells were grown to partial confluence on glass coverslips. The cells were then treated with control solution or ANG II (10–9 or 10–6 M) and/or losartan (10–7 M) and/or dimethyl-BAPTA-AM (10–7 M) or ionomycin (10–6 M, a calcium ionophore) for 2 min. Cells were then washed with cold 1% PBS, immediately immersed in 4% paraformaldehyde at room temperature for 5 min, and then washed three times with 1% PBS. Cells were analyzed at room temperature using laser excitation at 488 nm on a Zeiss LSM 510 real-time confocal microscope.

Statistical analysis. The results are presented as means ± SE; n is the number of experiments. Data were statistically analyzed through analysis of variance followed by Bonferroni's contrast test.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Recombinant construction. The mRNA was initially obtained through RT-PCR technique using human colon (T84 cells). The mRNA fragments were amplified by PCR and then used for a second PCR with specific primers to obtain the cDNA of hAT1 receptor, which was analyzed in 1% agarose gel. As shown in Fig. 1A, PCR primers synthesized a hAT1 receptor cDNA with ~1,080 bp, which can be confirmed by Basic Local Alignment Search Tool (BLAST; gi: 471120). The PCR product was cloned into the pEGFP-N1 expression vector in the Bgl II and BamH I restriction sites, since after digestion with the restriction enzymes, two fragments were obtained: 1,080 bp (hAT1) and 4,700 bp (pEGFP-N1 vector) (Fig. 1B). The recombinant (hAT1/pEGFP-N1) was submitted to complete nucleic acid sequencing. However, only start and end sequences were shown (Figs. 2, A and B), to confirm the AT1 cDNA and restriction enzyme site integrity. COOH-terminal residues involved in receptor phosphorylation sites and the interaction with β-arrestins were also confirmed (Fig. 2C; BLAST: NM_000685 [GenBank] .4).


Figure 1
View larger version (7K):
[in this window]
[in a new window]

 
Fig. 1. A: full-length (1,080 bp) PCR cDNA product of human angiotensin II receptor isoform 1 (hAT1) receptor obtained from T84 cells. Analysis in agarose gel (1%). M, marker (1 Kb DNA plus ladder). B: agarose gel (1%) showing the bands of the green fluorescent protein expression vector pEGFP-N1 (4,700 bp) and hAT1 (1,080 bp) after digestion with Bgl II and BamH I restriction enzymes.

 

Figure 2
View larger version (75K):
[in this window]
[in a new window]

 
Fig. 2. A and B: nucleic acid sequencing showing the transcription start (A) and end (B) of the hAT1, Bgl II, and BamH I restriction enzyme sites. C: COOH-terminal residues T332-S335-T336-S338 of the receptor involved in receptor phosphorylation and interaction with β-arrestins. T, threonine; S, serine.

 
Stable expression. Positive clones of transfected MDCK cells were detected through immunofluorescence using confocal microscopy (Fig. 3B) and compared with nontransfected MDCK cells (Fig. 3A). One positive clone was selected to be used in all other experiments.


Figure 3
View larger version (17K):
[in this window]
[in a new window]

 
Fig. 3. A and B: immunofluorescence of nontransfected (A) and transfected (B) Madin-Darby canine kidney (MDCK) cells (n = 4). Recombinant (hAT1/pEGFP-N1) is labeled in green. Cy, cytosol; PM, plasma membrane. Image was captured on a Zeiss LSM 510 real-time confocal microscope equipped with a x20 objective and a laser excitation of 488 nm. Bar, 20 µm.

 
Immunoblot. As expected and shown in Fig. 4, nontransfected (Fig. 4A) and transfected (Fig. 4B) MDCK cells endogenously express the AT1 receptor, a protein with ~45 kDa, detected by anti-AT1 antibody. However, in transfected cells (Fig. 4C), anti-GFP antibody also detected the recombinant with ~80 kDa (45 kDa of the hAT1 receptor and 35 kDa of the pEGFP-N1 vector).


Figure 4
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 4. Immunoblot with 100 µg total protein (n = 3). Anti-AT1 antibody recognized the endogenous AT1 (protein with 45 kDa) in MDCK cells A: nontransfected. B: transfected. C: recombinant (hAT1/pEGFP-N1) expression was confirmed using anti-GFP antibody, which recognized an 80-kDa protein. {alpha}-Actin, internal control.

 
pH measurement. Our results indicate that nontransfected and transfected MDCK cells in HCO3-free solution, 134 mM Na+ and pH 7.4, present a mean pHi baseline of 7.19 ± 0.01 (n = 77). After acid loading in the presence of extracellular Na+-free solution, the pHi recovery decreased and returned to basal value in the presence of extracellular Na+ solution (Fig. 5A). In the other experimental groups (Fig. 5B), ANG II (10–9 M) (1) but not ANG II (10–6 M) (3) increased the pH recovery when compared with control (2).


Figure 5
View larger version (10K):
[in this window]
[in a new window]

 
Fig. 5. A and B: representative experiments of intracellular pH (pHi) recovery in the first 2 min after acid loading, with free Na+ solution (A) or with different experimental solutions (B): 1) control; 2) 10–9 M ANG II; and 3) 10–6 M ANG II. C, control; NMDG, N-methyl-D-glucamine.

 
Effect of ANG II on the pH recovery rate and hAT1 translocation. After acid loading, in control situation, the main recovery rate in the first 2 min was 0.211 ± 0.009 pH U/min (n = 12) in nontransfected MDCK cells. This value was not significantly different in transfected cells: 0.219 ± 0.017 pH U/min (n = 11). Addition of ANG II (10–9 M) increased the pHi recovery rate (about 45% and 49% of the control value for nontransfected and transfected cells, respectively). However, ANG II (10–6 M) did not change the control response in both cell groups (Fig. 6 and Table 1). Immunofluorescence studies were performed in transfected MDCK cells to evaluate the hAT1 translocation in response to ANG II. After acid loading, cells were treated with different hormone concentrations for 2 min and analyzed by confocal microscope (Fig. 7). In the control situation (Fig. 7A), the recombinant (hAT1/pEGFP-N1) was predominantly detected in cytosol. ANG II (10–9 M) (Fig. 7B), but not ANG II (10–6 M) (Fig. 7C), induced translocation of the recombinant from cytosol to the plasma membrane.


Figure 6
View larger version (10K):
[in this window]
[in a new window]

 
Fig. 6. Effect of ANG II (10–9 and 10–6 M) on the initial pHi recovery rate was calculated (dpHi/dt) after acid loading in nontransfected and transfected MDCK cells; n, number of experiments. *P < 0.05 vs. control.

 

View this table:
[in this window]
[in a new window]

 
Table 1. Effect of ANG II on the pHi recovery rate in nontransfected and transfected MDCK cells

 

Figure 7
View larger version (21K):
[in this window]
[in a new window]

 
Fig. 7. Effect of ANG II (10–9 or 10–6 M) on hAT1 distribution in MDCK cells (n = 6). In the control situation, the recombinant (hAT1/pEGFP-N1) was mostly detected in cytosol (A). ANG II 10–9 M induced a receptor accumulation in plasma membrane (B), whereas ANG II 10–6 M induced receptor internalization (C).

 
Effect of losartan on the ph recovery rate and hAT1 translocation. To evaluate the AT1 receptors involvement, transfected MDCK cells were pretreated with losartan (10–7 M) for 30 min and then exposed to ANG II plus losartan. The reverse agonist inhibited the ANG II (10–9 M) stimulatory effect and slightly increased (22.5%) the pH recovery rate with ANG II (10–6 M) (Fig. 8 and Table 2). However, as shown in Fig. 9, in all groups, losartan induced hAT1 expression predominantly in plasma membrane.


Figure 8
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 8. Effect of losartan (10–7 M) on the pHi recovery rate after acid loading in transfected MDCK cells. *P < 0.05 vs. control. #P < 0.05 vs. 10–9 M ANG II.

 

View this table:
[in this window]
[in a new window]

 
Table 2. Effect of ANG II (10–9 or 10–6 M) and/or losartan or Ca2+ on the pHi recovery rate in transfected MDCK cells

 

Figure 9
View larger version (25K):
[in this window]
[in a new window]

 
Fig. 9. Effect of losartan (10–7 M) on hAT1 receptor distribution (n = 5). In all experimental groups (B: control plus losartan; C: ANG II 10–9 M plus losartan; D: ANG II 10–6 M plus losartan), the AT1 inverse agonist maintained the hAT1 receptor in plasma membrane. A: control without losartan.

 
Effect of calcium on the pH recovery rate and hAT1 localization. Because several studies show the importance of cytosolic Ca2+ levels on intracellular signaling events (21, 26, 30), we investigated the effect of dimethyl-BAPTA-AM (10–7 M) on the pHi recovery rate and hAT1 translocation. Fig. 10 and Table 2 show that in the control situation, dimethyl-BAPTA-AM alone did not change the pHi recovery rate. However, it inhibited the stimulatory effect of ANG II (10–9 M) and induced an increase (~28%) in the pHi recovery rate with ANG II 10–6 M. Immunofluorescence analysis (Fig. 11) shows that in cells treated with dimethyl-BAPTA-AM alone (Fig. 11B), the hAT1 receptor was predominantly detected in cytosol, as in control situation without dimethyl-BAPTA-AM (Fig. 11A). The calcium chelator did not change the predominantly hAT1 expression in plasma membrane with ANG II (10–9 M) (Fig. 11C). However, it reduced the hAT1 internalization in cells treated with ANG II (10–6 M) (Fig. 11D). To confirm the effect of cytosolic calcium on hAT1 distribution, we used ionomycin (10–6 M) and, as shown in Fig. 11E, the calcium ionophore maintained the hAT1 receptor internalized.


Figure 10
View larger version (17K):
[in this window]
[in a new window]

 
Fig. 10. Effect of dimethyl-BAPTA-AM (10–7 M) plus ANG II (10–9 or 10–6 M) on the initial pHi recovery rate after acid loading in transfected MDCK cells. *P < 0.05 vs. control. #P < 0.05 vs. ANG II 10–9 M.

 

Figure 11
View larger version (19K):
[in this window]
[in a new window]

 
Fig. 11. Effect of ANG II (10–9 or 10–6 M) and Ca2+ on hAT1 receptor distribution. In cells treated only with dimethyl-BAPTA-AM (10–7 M)(B) (n = 5) or ionomycin (10–6 M)(E) (n = 4), the hAT1 receptor was accumulated in cytosol. With dimethyl-BAPTA-AM (10–7 M) and ANG II (10–9; C or 10–6 M; D), the receptor was detected predominantly in plasma membrane. A: control without treatment.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Our pH recovery studies demonstrate that nontransfected and transfected MDCK cells in pH 7.4 HCO3-free solution present a mean pHi baseline of 7.19 ± 0.01 (n = 77), according to our previous studies (21). The pHi recovery is mostly dependent on Na+/H+ exchanger (Fig. 5A). However, a slight pHi recovery was observed, probably due to Na+-independent proton extrusion mechanisms (8, 9, 20). Our results indicate that in nontransfected and transfected MDCK cells (Figs. 5B and 6), the effect of ANG II (10–9 and 10–6 M) on the pHi recovery rate is concentration dependent and suggests fine control. ANG II (10–9), via AT1 receptor/G protein/PLC, stimulates IP3 and DAG release and consequently stimulates NHE-1 activity. These data are in accordance with recent studies from our laboratory (data not shown) and other studies (14, 21) that proposed PKC pathway as the main signaling cascade involved in the NHE-1 stimulation with ANG II.

Nevertheless, our results also demonstrate that ANG II (10–6 M) did not change the pHi recovery rate in comparison to control, suggesting that ANG II via AT1 receptor/G protein/PLC and PLA2-AA induces a large increase in intracellular Ca2+ levels and, consequently, modulation of Na+/H+ exchanger (14, 21). We propose that the nonstimulation of NHE-1 through high hormone concentrations may occur because of high cytosolic Ca2+ levels and receptor internalization.

Immunofluorescence studies (Fig. 7) show that in the control situation, the fluorescence related to the recombinant (hAT1/pEGFP-N1) was predominantly detected in cytosol. These findings are in accordance with other studies that proposed that some GPCRs also recycle independently of ligand binding to maintain an internal reserve pool of receptors (13, 19, 22). However, in the presence of ANG II (10–9 M), the recombinant was mostly evident in the plasma membrane, and in the presence of ANG II (10–6 M), a large fraction of the recombinant moved back to cytosol.

Usually, the AT1 receptor isomerizes spontaneously between three states: basal, intermediate, and active. The transition from basal to intermediate state appears dependent on the docking of Tyr4 and Phe8 side-chains of ANG II onto the AT1 receptor. However, full activation of AT1 depends on other interactions between receptor and ligand, which are related to complete conformational change and G protein interaction (25). The fully activated receptor can be phosphorylated and then interacts with the internalization machinery, which promotes its endocytosis. Our studies suggest that ANG II (10–9 M) interacts with AT1 receptor and takes it to an active state, but not already phosphorylated, resulting in its permanence on plasma membrane. ANG II (10–6 M) also induces receptor translocation to plasma membrane, but the fully activated and phosphorylated AT1 receptor can interact with β-arrestins and then be internalized. An additional possibility is that in high hormone concentrations, the necessity of downregulation may activate other intracellular pathways involved in the rapid receptor internalization and long-term downregulation of the receptor expression (2).

Furthermore, Miserey-Lenkei et al. (17) showed that there is a positive correlation between the level of cell surface expression of the AT1 receptor and the G{alpha}q/11 protein. These data are in accordance with our pH recovery rate data and immunofluorescence studies with ANG II (10–6 M), which suggest that the internalization of the AT1 receptor and G{alpha}q/11 protein could be correlated with the interruption of the signaling cascade, not allowing an increase on the NHE-1 activity.

In this manner, we used losartan (10–7 M), an inverse agonist of the AT1 receptor, to evaluate the exact correlation between ANG II and hAT1 translocation on NHE-1 activity. In our studies, losartan prevented the stimulatory effect of ANG II (10–9 M) (Fig. 8) on pHi recovery rate, probably because of its binding to the specific amino acid residue (Lys199) of transmembrane III domain of the receptor. Because movement of transmembrane III is known to be responsible for an initial step in the activation of AT1, binding of losartan to this site inhibits receptor activation. Miserey-Lenkei et al. (18) demonstrated that pretreatment with losartan decreases ANG II-induced cytosolic Ca2+ levels, suggesting that in high concentration, ANG II (10–6 M) can compete with losartan for the same binding site in the AT1 receptor. This factor contributes to clarify the increase of the pH recovery rate found in our experiments (Fig. 8). Our immunofluorescence studies with losartan (Fig. 9) are in accordance with the data presented so far. In all treatments (control or ANG II plus losartan), the hAT1 receptor was mostly expressed in plasma membrane. These data are supported by other studies that demonstrated that inverse agonist keeps the receptor in its intermediate state, resulting in decreasing of receptor recycling and consequently its accumulation in plasma membrane (18).

Our previous studies showed that dimethyl-BAPTA-AM decreases ANG II-induced cytosolic Ca2+ levels (21). The present study suggests that the stimulatory effect of ANG II (10–9 M) on NHE-1 activity depends on a slight increase in Ca2+ levels, which were reduced by dimethyl-BAPTA-AM (10–7 M). On the other hand, the large increase in Ca2+ levels induced by ANG II (10–6 M) and partially blocked by dimethyl- BAPTA-AM, allowed stimulation (~28%) of NHE-1 activity. Immunofluorescence studies with ANG II (10–9 M) plus dimethyl-BAPTA-AM (Fig. 11C) showed no difference in the hAT1 receptor localization, which is predominantly expressed in the plasma membrane. In this situation, the intracellular signaling cascade, but not the conformational state of the hAT1 receptor, is altered with decrease in Ca2+ levels. Studies with ANG II (10–6 M; Fig. 11D) and dimethyl-BAPTA-AM demonstrate an accumulation of hAT1 receptor in plasma membrane, probably due to a reduction in the downregulation and internalization mechanisms, modulated by high Ca2+ levels.

To confirm the relevance of Ca2+ levels on hAT1 distribution, experiments with ionomycin (10–6 M) were performed, and the results demonstrated predominant hAT1 receptor localization in cytosol. These results suggest that the modulatory signs related to AT1 distribution require a much more specific intracellular pathway and not only enhanced Ca2+ levels.

In conclusion, the present study shows that, in MDCK cells, the effect of ANG II on NHE-1 activity is related to many events: AT1 receptor ligand-binding, receptor conformational state, and specific intracellular signaling cascades. ANG II or losartan binding to AT1 receptor induces its translocation to plasma membrane and the further intracellular signaling cascade, which involves cytosolic Ca2+ levels and determines the NHE-1 regulation and the maintenance of the receptor in plasma membrane or its recycling.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP).


    ACKNOWLEDGMENTS
 
The authors thank Dr. Carlos F. M. Menck for providing the pEGFP-N1 vector, Dr. Gerhard Malnic for providing several of the drugs, and Camila N. A. Bezerra and Fernanda M. da Cunha for help in DNA sequencing.


    FOOTNOTES
 

Address for reprint requests and other correspondence: M. Oliveira de Souza, Dept. of Physiology and Biophysics, Inst. de Ciências Biomédicas, Univ. of São Paulo, SP 05508-900, Brazil (e-mail: souza{at}icb.usp.br)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Aharonovitz O, Zaun HC, Balla T, York JD, Orlowski J, Grinstein S. Intracellular pH regulation by Na+/H+ exchanger requires phosphatidylinositol 4,5-bisphosphate. J Cell Biol 150: 213–224, 2000.[Abstract/Free Full Text]

2. Böhm SK, Grady EF, Bunnett NW. Regulatory mechanisms that modulate signaling by G-protein-coupled receptors. Biochem J 322: 1–18, 1997.[Web of Science][Medline]

3. Boron WF, de Weer P. Intracellular pH transients in squid giant axons caused by CO2, NH3, and metabolic inhibitors. J Gen Physiol 67: 91–112, 1976.[Abstract/Free Full Text]

4. Carey RM. Cardiovascular and renal regulation by the angiotensin type 2 receptor. The AT2 receptor comes of age. Hypertension 45: 840–844, 2005.[Free Full Text]

5. Douglas JG. Angiotensin receptor subtypes of the kidney cortex. Am J Physiol Renal Fluid Electrolyte Physiol 253: F1–F7, 1987.[Abstract/Free Full Text]

6. Douglas JG, Hopfer. Novel aspect of angiotensin receptors and signal transduction in the kidney. Annu Rev Physiol 56: 649–669, 1994.[CrossRef][Web of Science][Medline]

7. Feifel E, Krall M, Geibel J, Pfaller W. Differential activities of H+ extrusion systems in MDCK cells due to extracellular osmolality and pH. Am J Physiol Renal Physiol 273: F499–F506, 1997.[Abstract/Free Full Text]

8. Fernandez R, Oliveira-Souza M, Malnic G. Na+-independent proton secretion in MDCK-C11 cells. Pflügers Arch Eur J Physiol 441: 287–293, 2000.[CrossRef][Web of Science][Medline]

9. Fernandez R, Malnic G. H+ ATPase and Cl interaction in regulation of MDCK cell pH. J Membr Biol 163: 137–145, 1998.[CrossRef][Web of Science][Medline]

10. Gáborik Z, Szaszák M, Szidonya L, Balla B, Parku S, Catt KJ, Clark AJL, Hunyady L. β-Arrestin and dynamin-dependent endocytosis of the AT1 angiotensin receptor. Mol Pharmacol 59: 239–247, 2001.[Abstract/Free Full Text]

11. Goodfriend TL, Elliott ME, Catt KJ. Angiotensin receptors and their antagonists. N Engl J Med 334: 1649–1654, 1996.[Free Full Text]

12. Griendling KK, Lassègue B, Alexander RW. Angiotensin receptors and their therapeutic implications. Annu Rev Pharmacol Toxicol 36: 281–306, 1996.[Web of Science][Medline]

13. Hein L, Meinel L, Pratt RE, Dzau VJ, Kobilka BK. Intracellular trafficking of angiotensin II and its AT1 and AT2 receptors: evidence for selective sorting of receptor and ligand. Mol Endocrinol 75: 587–597, 1997.

14. Houillier P, Chambey R, Achard MJ, Froissart M, Poggiolli IJ, Paillard M. Signaling pathways in the biphasic effect of angiotensin II on apical Na+/H+ antiporter in proximal tubule. Kidney Int 50: 1496–1505, 1996.[Web of Science][Medline]

15. Kule CE, Karoor V, Day JNE, Thomas WG, Baker KM, Dinh D, Acker KA, Booz GW. Agonist-dependent internalization of the angiotensin II type one receptor (AT1): role of C-terminus phosphorylation in recruitment of β-arrestins. Regul Pept 120: 141–148, 2004.[CrossRef][Web of Science][Medline]

16. Madin SH, Darby NB Jr. Established kidney cell lines of normal adult bovine and ovine origin. Proc Soc Exp Biol Med 98: 574–576, 1958.[CrossRef][Medline]

17. Miserey-Lenkei S, Lenkei Z, Parnot C, Corvol P, Clauser E. A functional enhanced green fluorescent protein (EGFP)-tagged angiotensin II AT1A receptor recruits the endogenous G{alpha}q11 protein to the membrane and induces its specific internalization independently of receptor-G protein coupling in HEK-293 cells. Mol Endocrinol 15: 294–307, 2001.[Abstract/Free Full Text]

18. Miserey-Lenkei S, Parnot C, Bardin S, Corvol P, Clauser E. Constitutive internalization of constitutively active angiotensin II AT1A receptor mutants is blocked by inverse agonists. J Biol Chem 277: 5891–5901, 2002.[Abstract/Free Full Text]

19. Morris DP, Price RR, Smith MP, Lei B, Schwinn DA. Cellular trafficking of human alpha-1a-adrenergic receptor is continuous and primarily agonist-independent. Mol Pharmacol 66: 843–854, 2004.[Abstract/Free Full Text]

20. Oliveira-Souza M, Malnic G, Mello-Aires M. Atrial natriuretic peptide impairs the stimulatory effect of angiotensin II on H+-ATPase. Kidney Int 62: 1693–1699, 2002.[CrossRef][Web of Science][Medline]

21. Oliveira-Souza M, De Mello-Aires M. Interaction of angiotensin II and atrial natriuretic peptide on pHi regulation in MDCK cells. Am J Physiol Renal Physiol 279: F944–F953, 2000.[Abstract/Free Full Text]

22. Qian H, Pipolo L, Thomas WG. Association of β-arrestin 1 with the type 1A angiotensin II receptor involves phosphorylation of the receptor carboxyl terminus and correlates with receptor internalization. Mol Endocrinol 15: 1706–1719, 2001.[Abstract/Free Full Text]

23. Sechi LA, Grady EF, Griffin CA, Kalinyak JE, Schambelan M. Distribution of angiotensin II receptor subtypes in rat and human kidney. Am J Physiol Renal Fluid Electrolyte Physiol 262: F236–F240, 1992.[Abstract/Free Full Text]

24. Thomas WG. Regulation of angiotensin II type 1 (AT1) receptor function. Regul Pept 79: 2–23, 1999.

25. Thomas WG, Qian H, Chang C, Karnik S. Agonist-induced phosphorylation of the angiotensin II (AT1A) receptor requires generation of a conformation that is distinct from the inositol phosphate-signaling state. J Biol Chem 275: 2893–2900, 2000.[Abstract/Free Full Text]

26. Touyz RM, Schiffrin EL. Role of calcium influx and intracellular calcium stores in angiotensin II-mediated calcium hyper-responsiveness in smooth muscle from spontaneously hypertensive rats. J Hypertens 15: 1431–1439, 1997.[CrossRef][Web of Science][Medline]

27. Turu G, Szidonya L, Gáborik Z, Buday L, Spät A, Clark AJL, Hunyady L. Differential β-arrestin binding of AT1 and AT2 angiotensin receptors. FEBS Lett 580: 41–45, 2006.[CrossRef][Web of Science][Medline]

28. Ushio-Fukai M, Griendling KK, Akers M, Lyons PR, Alexander RW. Temporal dispersion of activation of phospholipase C-beta-1 and -gamma isoforms by angiotensin II in vascular smooth muscle cells. Role of alphaq/11, alpha 12, and beta gamma G protein subunits. J Biol Chem 273: 19772–19777, 1998.[Abstract/Free Full Text]

29. Vilella S, Guerra L, Helme-Kolb C, Murer H. Characterization of basolateral Na+/H+ exchanger (Na+/H-1) in MDCK cells. Pflügers Arch 420: 275–281, 1992.[CrossRef][Web of Science][Medline]

30. Wakabayashi S, Bertrand B, Ikeda T, Pouysségur J, Shigekawa M. Mutation of calmodulin-binding site renders the Na+/H+ exchanger (NHE1) highly H+-sensitive and Ca2+ regulation-defective. J Biol Chem 269: 13710–13715, 1994.[Abstract/Free Full Text]

31. Zhang J, Ferguson SSG, Barak LS, Menard L, Caron MG. Dynamin and β-arrestin reveal distinct mechanism for G-protein coupled receptor internalization. J Biol Chem 271: 18302–18305, 1996.[Abstract/Free Full Text]

32. Zhuo JL, Li XC, Garvin JL, Navar G, Carretero AO. Intracellular ANG II induces cytosolic Ca2+ mobilization by stimulating intracellular AT1 receptors in proximal tubule cells. Am J Physiol Renal Physiol 290: F1382–F1390, 2006.[Abstract/Free Full Text]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
295/1/C138    most recent
00512.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thieme, K.
Right arrow Articles by Oliveira-Souza, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thieme, K.
Right arrow Articles by Oliveira-Souza, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.