HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: 294/4/C945    most recent 00495.2007v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Web of Science (4) Citing Articles via Google Scholar Google Scholar Articles by Buttigieg, J. Articles by Nurse, C. A. Search for Related Content PubMed PubMed Citation Articles by Buttigieg, J. Articles by Nurse, C. A.

NERVOUS SYSTEM CELL BIOLOGY

Functional mitochondria are required for O₂ but not CO₂ sensing in immortalized adrenomedullary chromaffin cells

Department of Biology, McMaster University, Hamilton, Ontario, Canada

Submitted 18 October 2007 ; accepted in final form 23 January 2008

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
Catecholamine (CAT) release from adrenomedullary chromaffin cells (AMC) in response to stressors such as low O₂ (hypoxia) and elevated CO₂/H⁺ is critical during adaptation of the newborn to extrauterine life. Using a surrogate model based on a v-myc immortalized adrenal chromaffin cell line (i.e., MAH cells), combined with genetic perturbation of mitochondrial function, we tested the hypothesis that functional mitochondria are required for O₂ sensing. Wild-type MAH cells responded to both hypoxia and increased CO₂ (hypercapnia) with K⁺ current inhibition and membrane depolarization. Additionally, these stimuli caused a rise in cytosolic Ca²⁺ and CAT secretion, determined by fura-2 spectrofluorimetry and carbon fiber amperometry, respectively. In contrast, mitochondria-deficient (⁰) MAH cells were hypoxia insensitive, although responses to hypercapnia and expression of several markers, including carbonic anhydrase II, remained intact. Rotenone (1 µM), a mitochondrial complex I blocker known to mimic and occlude the effects of hypoxia in primary AMC, was effective in wild-type but not ⁰ MAH cells. These data demonstrate that functional mitochondria are involved in hypoxia-sensing by adrenal chromaffin cells. We also show for the first time that, like their neonatal chromaffin cell counterparts, MAH cells are CO₂ sensors; however, this property is independent of functional mitochondria.

hypercapnia; hypoxia; rho 0; rotenone

The upstream mechanisms by which chromaffin cells in the adrenal medulla, as well as their counterparts in the carotid body, sense acute hypoxia have been the subject of intense investigation and controversy (12, 22). While heme proteins of the mitochondrial electron transport chain (ETC) have long received strong support as candidates for the O₂ sensor, there is evidence for the involvement of extra-mitochondrial proteins including NADPH oxidase, hemeoxygenase-2, and AMP-kinase in the mediation of the hypoxic response (10). In the case of adrenal chromaffin cells, the mitochondrial ETC has been proposed as the site for the O₂ sensor based primarily on the use of pharmacological ETC blockers including the complex I blocker, rotenone, which was found to mimic and occlude the effects of hypoxia (8, 14, 22). However, general concern about the lack of specificity of these ETC blockers, as well as the demonstration that rotenone may block a putative extra-mitochondrial O₂ sensor in the carotid body (17), raises questions about the mitochondrial origin of the O₂ sensor.

More definitive studies on the O₂-sensing mechanisms in adrenal chromaffin cells can be greatly facilitated through the use of immortalized cell lines because their genetics can be conveniently manipulated. Also advantageous is a cell line that faithfully reproduces O₂-sensing properties characteristic of the native cell. An attractive candidate for this role is the v-myc adrenal-derived HNK1⁺ immortalized chromaffin cell line (MAH) derived from fetal rat adrenal medulla (1). Recent studies from this laboratory have demonstrated that MAH cells express several O₂-sensing properties of neonatal rat AMC, including hypoxic regulation of similar K⁺ channel subtypes as found in native cells (4). In the present study, we use wild-type (WT) MAH cells and mutant MAH cells, devoid of a functional ETC due to defective mitochondrial DNA (⁰ cells), to show that functional mitochondria are indeed required for O₂ sensing by chromaffin cells. Several independent assays of O₂ sensitivity were used to support this conclusion and involved whole cell recordings of K⁺ currents and membrane potential, ratiometric fura-2 intracellular Ca²⁺ (Ca_i) measurements, and carbon fiber amperometric determination of CAT secretion. We further show that the ability of rotenone to mimic hypoxia in these cells is dependent on functional mitochondria. Finally, we provide evidence for the first time that MAH cells can also act as CO₂ sensors and express the CO₂ marker carbonic anhydrase II (CA II). However, unlike hypoxia-sensing, CO₂ sensing occurs in mutant ⁰ MAH cells and is therefore independent of functional mitochondria.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
WT MAH cells. WT MAH cells (a generous gift from Dr. Laurie Doering) were grown in modified L-15/CO₂ medium supplemented with 0.6% glucose, 1% penicillin-streptomycin, 10% fetal bovine serum, and 5 µM dexamethasone (4). All cultures were grown in a humidified atmosphere of 95% air-5% CO₂ at 37°C. Cultures were fed every 1–2 days and split every 3–4 days. To passage cells, the culture medium was removed and 0.25% trypsin was added to detach cells from the culture substrate. The resulting cell suspension was pelleted by centrifugation, the supernatant discarded, and the pellet resuspended in fresh medium. Cells were then plated at a density of approximately 2 x 10⁴ cells/ml onto standard 35-mm culture dishes, which had been previously coated with poly-D-lysine and laminin to promote cell adhesion.

Mitochondria-deficient ⁰ MAH cells. To produce cultures of MAH cells deficient in functional mitochondria (⁰ MAH cells), WT cells were grown in modified L-15/CO₂ medium supplemented with 0.6% glucose, 1% penicillin-streptomycin, 10% fetal bovine serum, 5 µM dexamethasone, 10 mM sodium pyruvate, 2 mM uridine, and 200 ng/ml ethidium bromide, to inhibit mitochondrial function and division (18). After incubation with ethidium bromide for 3 wk, cells were treated with 20 µM rotenone or 20 µM myxothiazol to select for cells deficient in functional mitochondria. Ethidium bromide prevented replication of mitochondrial DNA, and the surviving cells lacked a functional ETC (see below). ⁰ MAH cells were fed every 1–2 days.

PCR determination of ⁰ status. Confirmation of ⁰ status in mutant MAH cells was obtained by examining the expression of mitochondrial DNA-encoded cytochrome oxidase I (COX I) subunit gene of complex IV (rat mitochondrial genome sequence 5161–5700). Primer sequences were derived from GeneBank accession number J05318, using the program GeneFisher. Primer sequences were as follows: (forward) 3' TGGAGCCTGAGCAGGAATAG and (reverse) 5' AATCTACGGATACCCCAGCA. PCR amplification of the β-actin gene was used as a control with the following primers: (forward) 3' CCTAGTCGTTCGTCCTCATGC and (reverse) 5' GAAGATCCTGACCGAGCGTG.

Quantitative RT-PCR. RNA from MAH cell cultures was extracted with the RNeasy Mini Kit (Qiagen). RNA was quantified in an Eppendorf Biophotometer, and 500 ng were treated with DNase I (Invitrogen). Reverse transcription was carried out on 100 ng of DNase-treated RNA using Superscript III (Invitrogen) and random primers (100 ng). Quantitative PCR was carried out with the Absolute QPCR SYBR Green Mix (ABgene) and analyzed with a Stratagene MX3000P machine. Gene-specific primers were designed using GeneFisher software and were synthesized by The Central Facility of the Institute for Molecular Biology and Biotechnology (MOBIX; McMaster University, Hamilton, ON, Canada). The following primers were used and listed as gene amplified, sequence (forward, reverse), and annealing temperature: Lamin A/C: 5'-GCAGTACAAGAAGGAGCTA-3' and 5'-CAGCAATTCCTGGTACTCA-3', 55°C; CA I: 5'-AACCAGCGAAGCCAAAC-3' and 5'-TGTGGTGGACGGTGGTTG-3', 55°C; CA II: 5'-CCGACAGTCCCCTGTGGA-3' and 5'-GCGGAGTGGTCAGAGAGCCA-3', 55°C. The primers for CA II span exons 2 through 6, whereas primers for CA I span exons 2 through 7. Lamin primer spans exons 6 through 8. Verification of the PCR products was done with the QIAquick Gel Extraction kit (Qiagen). The DNA sample was then sequenced (at MOBIX). The sequencing results were analyzed by the Basic Local Alignment Search Tool and were matched to the Rattus norvegicus Lamin A/C (GeneBank accession number BC062018.1 and X99257.1), CA I (XM_226922.4), and CA II (NM_019291.1). The results were analyzed by the C_t method, which reflects the difference in threshold for the target gene relative to that of lamin gene in each sample. To ensure the validity of our calculations, we confirmed that the primer sets used in the present study had the same efficiencies as ascertained by varying template concentrations. In each case, the log of the template concentration when plotted against C_t yielded values of <0.1 for the slope.

Electrophysiology. Whole cell recordings from WT and ⁰ MAH cells were obtained with the nystatin perforated-patch technique as previously described (4, 24). In voltage-clamp experiments, cells were held at –60 mV and step depolarized to the indicated test potential (between –100 and +80 mV in 10-mV increments) for 100 ms at a frequency of 0.1 Hz. In some cases, cells were held at –60 mV and were ramped from –80 to +50 mV for 500 ms at a frequency of 0.1 Hz. Currents were filtered at 5 kHz, digitized at 10 kHz, and stored on computer for later analysis. Capacitative transients were minimized by analog means.

In these experiments, the pipette solution contained (in mM) 95 K gluconate, 35 KCl, 5 NaCl, 2 CaCl₂, 10 HEPES, at pH 7.2, and nystatin (400 µg/ml). In some cases, the external bathing solution contained (in mM) 135 NaCl, 5 KCl, 2 CaCl₂, 2 MgCl₂, 10 glucose, and 10 HEPES, at pH 7.4. Solutions were changed via a gravity fed perfusion system. Hypoxic solutions (PO₂ 15–20 mmHg) were generated by bubbling N₂ (gas) in a reservoir that was surrounded by a warm water bath (37°C) to minimize temperature changes. The temperature of the bathing solution at the recording site was 37°C. The PO₂ was measured in the chamber with a dissolved PO₂ reader (WPI ISO2). In experiments designed to test the effects of CO₂, bicarbonate-buffered extracellular solutions were used. Normocapnic (control) extracellular solution consisted of a bicarbonate/CO₂-buffered saline of the following composition (in mM): 115 NaCl, 24 NaHCO₃, 5 KCl, 2 CaCl₂, 1 MgCl₂, and 10 glucose at pH 7.4 maintained by bubbling 95% air-5% CO₂. For isohydric hypercapnia (10% CO₂), the pH was kept constant at 7.4 by elevating NaHCO₃ to 48 mM (equimolar NaCl substituted). Solutions were made hypoxic by bubbling a 5% CO₂-95% N₂ gas mixture. The culture was perfused via gas-impermeable Tygon tubing, and excess solution was removed by vacuum suction. Data acquisition and analysis were performed with either an Axopatch 1D or Multiclamp 700 amplifier in combination with a Digidata 1200 or Digidata 1322A interface (respectively) and pCLAMP 9.2 software (Axon Instruments). Current densities were calculated by dividing the evoked current by cell capacitance.

Carbon fiber amperometry. CAT secretion from MAH cells was monitored with carbon fiber amperometry after the culture dish was placed on the stage of Zeiss Axioskop 2 upright microscope equipped with a x40 water immersion objective. The culture was perfused under gravity with bicarbonate-buffered extracellular solution, bubbled with 95% air-5% CO₂ (pH 7.4; see above) at 37°C. In some experiments, high K⁺ (30 mM) solutions were used after equimolar substitution for NaCl. Hypoxic solution (PO₂ = 15–20 mmHg) was obtained by continuously bubbling with a 5% CO₂ -95% N₂ gas mixture (see above). Catecholamine secretion was monitored with ProCFE low noise carbon fiber electrodes (electrode diameter 5 µm; Dagan) connected to a CV 23BU headstage and an Axopatch 200B amplifier set at 800 mV. Data acquisition and analysis were performed with Clampfit 9.2 (Axon Instruments); currents were filtered at 100 Hz, digitized at 250 Hz, and stored on a personal computer. Charge of individual secretory events was calculated by integrating the area under each spike, and total secretion during stimulus application was plotted as the cumulative charge (in fC). Events smaller than 3 pA were excluded from the analysis, and spike frequency was calculated as the number of spike events/min. Samples were compared with Student's t-test, and the level of significance was set at P < 0.05. Unless otherwise noted, the data are expressed as means ± SE.

Fura-2 Ca²⁺ measurements. Intracellular Ca²⁺ was monitored with the fluorescent Ca²⁺ indicator fura-2 AM. Cells were first plated into central wells of modified culture dishes, in which a central hole was drilled before a glass coverslip was attached to the underside. Cultures were loaded with 5 µM fura-2 AM for 30 min at 37°C, then rinsed (3 times) with extracellular solution, and allowed to deesterify for 30 min before use. Ratiometric Ca²⁺ measurements were obtained with a Nikon Eclipse TE2000-U inverted microscope equipped with a filter switching lambda DG-4 high-speed optical filter changer, a Hamamatsu OCRCA-ET digital CCD camera, and a Nikon S-Fluor x40 oil immersion objective lens with a numerical aperture of 1.3. Dual images (340- to 380-nm excitation, 510-nm emission) were collected, and pseudocolor ratiometric images were monitored during the experiments by using Simple PCI software (version 5.3, Compix). The imaging system was standardized with a two-point calibration, using Ca²⁺-free solution and Ca²⁺ solution (39 µM) obtained from Molecular Probes (F-6774). The parameters used for the two-point calibration include the dissociation constant of fura-2 (K_d 224 nM), the ratio values for the (–) and (+) concentration standards (R_min = 0.026 and R_max = 4.4) and β-value of 5.6. [Ca²⁺]_i (in nM) was calculated according to the equation previously described (6). All experiments were performed at 37°C. Cells were continuously perfused with 5% CO₂-bicarbonate-buffered extracellular solution as described above.

Rhodamine 123 staining. WT and ⁰ MAH cells were grown in wells of modified 35-mm dishes (see above) for 24 h and were then treated with 10 µg/ml of rhodamine 123 for 10 min at room temperature. Cells were then rinsed and examined with a Nikon Eclipse TE2000-U inverted microscope with x100 oil immersion objective (Nikon). Images were captured using a Hamamatsu OCRCA-ER digital CCD camera using Simple PCI software (version 5.3).

Drugs. All solutions containing drugs were made fresh on the day of the experiments. Drugs were obtained from Sigma-Aldrich unless otherwise stated.

Immunocytochemistry. MAH cells were grown in the central wells of modified 35-mm Nunc dishes as previously described (4). The well was formed by drilling a central hole (1 cm in diameter) in the dish and attaching a glass coverslip to the underside. Medium was removed, and the cells were washed two times in 3 ml phosphate-buffered saline (PBS). Cells were then fixed with 3 ml of 5% acetic acid-95% methanol at –20°C for 60 min, and the solution was replaced with 2 ml PBS. Samples were then washed three times with PBS, before the addition of 30 µl of primary antibody followed by incubation for 24 h at 4°C. The following primary antibodies were used at the dilutions indicated: anti-tyrosine hydroxylase, 1:1,000 (Millipore); anti-carbonic anhydrase, 1:50 (Biogenesis); anti-Kv1.2, 1:50; anti-Kv1.5, 1:50; and anti-Ca²⁺-dependent K⁺ or BK 1:100 (Alomone). Following incubation, the primary antibody solution was removed, and the samples were washed three times in PBS. Secondary antibody, conjugated with FITC or Texas red (Jackson Immunoresearch) (as indicated) was diluted in PBS (1:50) and incubated for 1 h at room temperature shielded from light. After removal of the solution, the samples were washed three times in PBS. Vecta-shield was then added to the dishes to prevent photobleaching. Control experiments, in which primary antibody was omitted from the first incubation step, were also performed. In the case of the BK, Kv1.2, and Kv1.5 channel antibodies, an additional control involved preincubating the primary antibody with excess blocking peptide overnight at 4°C (at 3 µg of fusion peptide per 1 µg of antibody), before addition to the cells. The samples were visualized with a Zeiss inverted microscope (IM 35) equipped with epifluorescence, as well as fluorescein and rhodamine filter sets. Images were acquired using a digital camera with Northern Eclipse software and were saved in TIFF format.

Western blot analysis. Confluent cultures of WT and ⁰ MAH cells were trypsinized (0.25%) and pelleted by centrifugation. Cells were then washed three times in PBS. Cell pellets were then homogenized in 0.2 ml ice-cold buffer A (in mM: 20 HEPES, 20 KCl, 2 EDTA, 2 EGTA, and 2 DTT) containing 1 pellet of complete mini, EDTA-free protease inhibitor cocktail (Roche 1836170) and were placed on ice for 15 min. Then 6.25 µl of 10% NP40 was added to the homogenate and vortexed for 15 s. The resulting solution was then centrifuged at 10,000 g for 30 s. Protein was extracted in lysis buffer containing (in mM): 10 HEPES (pH 7.6), 10 KCl, 0.1 EDTA (pH 8), 0.1 EGTA (pH 8), and 1 DTT. Thirty micrograms of protein were loaded onto an 8% SDS-polyacrylamide gel and run at 120V for 2 h. Protein was transferred from the gel onto a polyvinylidene difluoride membrane (Millipore) and incubated in either sheep polyclonal antibody against CA II (Biogenesis) or mouse monoclonal antibody against β-actin at 4°C overnight. The membrane was washed with PBS, incubated for 1 h at room temperature with a horseradish peroxidase (HRP)-linked secondary antibody, and rewashed in PBS. The blot was visualized with Immobilon Western Chemiluminescent HRP substrate (Millipore) and autoradiography.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
General properties and confirmation of mitochondria-deficient status in ⁰ MAH cells. As expected, the selection procedure for mitochondria-deficient ⁰ MAH cells produced cell populations that grew more slowly than WT MAH cells. The majority of ⁰ MAH cells appeared healthy when viewed under phase contrast microscopy (Fig. 1B). However, ⁰ MAH cell size appeared slightly smaller than that of WT MAH (Fig. 1A), and this was confirmed by measurements of whole cell capacitance, which is proportional to surface area. The mean input capacitance of ⁰ MAH cells was 5.8 ± 0.7 pF (n = 16), compared with 7.1 ± 0.5 pF (n = 15) for WT MAH cells (difference significant; P < 0.05). However, the mean input resistance of ⁰ MAH cells (2.4 ± 0.11 G; n = 15) was not significantly different from that of WT MAH cells (3.2 ± 0.7 G; n = 16; P > 0.05). The expression of characteristic markers was also used to validate that, except for the loss of functional mitochondria, ⁰ MAH cells were phenotypically similar to WT MAH cells. For example, ⁰ MAH cells showed positive immunoreactivity against tyrosine hydroxylase, the rate-limiting enzyme in catecholamine biosynthesis, similar to WT MAH cells (Fig. 1, C and D). Furthermore, expression of several ion channel proteins was also retained in ⁰ MAH cells, as will be discussed in K⁺ channel expression in ⁰ MAH cells. Both WT MAH and ⁰ MAH cells were also immunopositive for CA II (Fig. 1, E and F).

View larger version (15K): [in this window] [in a new window]   Fig. 1. Expression of characteristic markers in wild-type (WT) and 0 MAH cells. Phase contrast micrographs of WT (A) and 0 (B) MAH cells are shown. Positive immunoreactivity against tyrosine hydroxylase (TH), was obtained in both WT (C) and 0 (D) MAH cells with the aid of a FITC-conjugated secondary antibody. Similarly, both WT (E) and 0 (F) MAH cells were immunopositive for carbonic anhydrase II (CA II), visualized with a FITC-conjugated secondary antibody. WT MAH cells showed significant uptake of the mitochondrial fluorescent probe rhodamine 123 (Rh 123; G), whereas 0 MAH cells showed weak Rh 123 uptake (H), consistent with the absence of a functional electron transport chain (ETC). Confirmation of the 0 status was obtained during PCR amplification of the mitochondria-encoded cytochrome oxidase I (COX I) gene, a subunit of complex IV. The COX I gene was absent in 0 MAH cells but present in WT MAH cells (I). Both WT and 0 MAH cells expressed the genome-encoded β-actin gene (I).

Are functional mitochondria required for O₂ sensing in MAH cells? Previous studies in this laboratory have shown that the O₂ sensitivity of MAH cells involves hypoxia-induced inhibition of outward K⁺ current and membrane depolarization, via closure of several K⁺ channel subtypes (4). With the use of perforated-patch recording, outward K⁺ currents from both WT MAH and ⁰ MAH cells were monitored under voltage clamp. Exposure of WT MAH cells to acute hypoxia (PO₂ 15 mmHg), caused inhibition of outward K⁺ current at more positive potentials (Fig. 2, A and C). For a voltage step to +30 mV, from an initial holding potential of –60 mV, the mean outward current density decreased significantly from 46.1 ± 4.3 pA/pF under normoxia to 26.2 ± 5.2 pA/pF during hypoxia (n = 15, P < 0.05; Fig. 2C). In contrast, hypoxia had no effect on outward current in ⁰ MAH cells; for a step to +30 mV, the normoxic outward current density was 38.7 ± 6.3 pA/pF versus 36.3 ± 4.1 pA/pF in hypoxia (n = 16; Fig. 2, B and D).

View larger version (12K): [in this window] [in a new window]   Fig. 2. Whole cell recordings of the effects of hypoxia on outward K+ current and membrane potential in WT MAH vs. 0 MAH cells. Hypoxia (Hox; PO2 15 mmHg) caused reversible inhibition of outward K+ current in WT MAH cells at positive potentials (n = 15; A and C). Sample recordings at a step potential of +30 mV are shown in A, and current density (I) vs. voltage (V) plot is shown in C for 15 cells. In A, control traces (C) before hypoxia and after washout (W) are also shown. Holding potential was –60 mV. In contrast, hypoxia had no effect on outward current in 0 MAH cells as shown in sample traces (B), and in the I-V plot (D; n = 16). Under current clamp, hypoxia depolarized WT MAH cells (E; n = 11) but had no effect on membrane potential in 0 MAH cells (F; n = 10).

To validate further the important role of mitochondrial function in O₂ sensing by MAH cells, we tested the effects of rotenone, a blocker of complex I of the ETC. We previously showed that rotenone mimicked and occluded the effects of hypoxia in primary neonatal adrenal chromaffin cells (22). In the present study, rotenone (1 µM) caused a reversible inhibition of outward current in WT MAH cells at more positive potentials (n = 10; Fig. 3A), similar to hypoxia (Fig. 2, A and B). In contrast, rotenone had no detectable effect on outward current in ⁰ MAH cells (n = 12; Fig. 3B), consistent with the lack of complex I function in these mitochondria-deficient cells. These data also argue against a nonspecific effect of rotenone on K⁺ currents, of which several subtypes are expressed in both WT and ⁰ MAH cells (see below).

View larger version (10K): [in this window] [in a new window]   Fig. 3. Effect of rotenone (Rot) on outward K+ current in WT vs. 0 MAH cells. A: rotenone (1 µM), a blocker of complex I of the mitochondrial ETC, reversibly inhibited outward K+ currents in WT MAH cells at positive test potentials (n = 10). B: in the mitochondria-deficient 0 MAH cells, rotenone had no effect on outward current (n = 12), suggesting that the drug's action required functional mitochondria. Insets, sample traces at a test potential of +30 mV (A and B).

K⁺ channel expression in ⁰ MAH cells.

View larger version (16K): [in this window] [in a new window]   Fig. 4. K+ channel expression in WT and 0 MAH cells. Mean (±SE) current vs. voltage plots are shown for WT MAH cells exposed to control (C) and either the small-conductance Ca2+-activated K+ (SK) channel blocker, apamin (Apa, 100 nM, A1; n = 8), the large-conductance Ca2+-activated K+ (BK) channel blocker, iberiotoxin (IbTx, 100 nM; A2; n = 7), or the nonspecific blocker of Ca2+ channels, cadmium (Cd2+, 50 µM; A3; n = 10), which indirectly blocks Ca2+-dependent K+ channels. Insets, sample recordings at +30 mV; holding potential was –60 mV. Corresponding data for 0 MAH cells are shown in B1–B3 (n = 10). Note that the 0 MAH cells expressed similar Ca2+-dependent K+ currents as WT MAH cells. Error bars represent means ± SE. 0 MAH cells also showed expression of Kv1.2, Kv1.5 subunits and the BK channel -subunit, as determined by immunofluorescence (C). Staining was abolished in control experiments using blocking peptides (C, bottom).

MAH cells as CO₂ sensors: nonrequirement for functional mitochondria. Neonatal adrenal chromaffin cells also act as CO₂ sensors, which elicit catecholamine secretion during elevated CO₂ or hypercapnia (15). This property depends on intracellular CA activity and involves high CO₂-induced inhibition of outward K⁺ current and membrane depolarization. Two CA isoforms, CA I and CA II, are expressed in neonatal adrenal chromaffin cells, but it is unclear whether one or both isoforms are required for CO₂ sensing (15; see also Fig. 5A). Here, we tested for the first time whether MAH cells can act as a suitable surrogate model for CO₂ sensing by adrenal chromaffin cells. Indeed, both WT MAH and ⁰ MAH cells expressed mRNA for the CA II isoform (Fig. 5B), as well as the CA II protein (Fig. 1, E and F, and Fig. 5B). However, unlike neonatal chromaffin cells, they did not express mRNA for the CA I isoform (Fig. 5A). To test whether MAH cells are able to sense hypercapnia, whole cell recordings of ionic currents and membrane potential were obtained in bicarbonate-buffered medium. As illustrated in Fig. 6, A–D, isohydric hypercapnia (10% CO₂; pH 7.4) caused inhibition of outward K⁺ current in both WT MAH and ⁰ MAH cells at more positive potentials, as previously reported for neonatal rat adrenal chromaffin cells (15). For a voltage step to +30 mV, hypercapnia caused a significant reduction in outward K⁺ current density from 52.3 ± 4.7 to 33.8 ± 5.1 pA/pF (n = 15; P < 0.05). Interestingly, the combined effects of hypoxia and hypercapnia on outward K⁺ current in WT MAH cells were additive (Fig. 6C). Under current clamp, hypercapnia also induced a mean depolarization of 11.2 ± 4.9 mV in WT MAH cells (Fig. 4E); the membrane potential depolarized reversibly from a mean resting level of –45 ± 5.6 to –33.8 ± 4.9 mV (n = 10), as exemplified in Fig. 6E. Taken together, these data indicate that MAH cells possess several of the CO₂-sensing properties previously described for neonatal adrenal chromaffin cells.

View larger version (21K): [in this window] [in a new window]   Fig. 5. Expression of carbonic anhydrase I (CA I) and II (CA II) in chromaffin cells. A: RT-PCR was used to compare mRNA expression of CA I and CA II in WT MAH, 0 MAH, and primary neonatal rat adrenomedullary chromaffin cells (neo AMC). Interestingly, only CA II was found to be expressed in WT and 0 MAH cells (n = 4). However, both CA I and CA II were expressed in neonatal AMC. B: Western blot analysis showed similar expression levels of CA II protein in WT MAH and 0 MAH cells, using β-actin as control.

View larger version (15K): [in this window] [in a new window]   Fig. 6. Effects of isohydric hypercapnia and hypoxia on whole cell currents and membrane potential in WT vs. 0 MAH cells. Isohydric hypercapnia (10% CO2; pH 7.4) caused reversible inhibition of outward K+ current in WT MAH cells, as shown in sample traces during steps to +30 mV (A) and in the current density (pA/pF) plot (C). As seen in HEPES-buffered medium (Fig. 2), hypoxia also inhibited outward K+ current in bicarbonate-buffered medium, and the combined application of hypoxia and hypercapnia (10% CO2) led to an additive response (C). Data represent means ± SE for step to +30 mV (n = 15); independent t-test. *P < 0.05, significantly different from normoxic control (Nox); **P < 0.05, significantly different from hypoxia. Traces for control (C) and recovery after washout (W) in A were obtained under normocapnia (5% CO2; pH 7.4). In 0 MAH cells, isohydric hypercapnia still produced significant inhibition (t-test; *P < 0.001) of outward K+ current as shown in sample traces at +30 mV (B) and in the current density plot (D; n = 14). In contrast, hypoxia had no effect on outward K+ current in bicarbonate-buffered medium (D; n = 14), as was the case in HEPES-buffered medium (Fig. 2). Under current clamp, hypercapnia (10% CO2; pH 7.4) induced a depolarizing receptor potential in both WT (E) and 0 (F) MAH cells.

Intracellular Ca²⁺ responses in MAH cells. To learn more about the suitability of MAH cells as a surrogate model for O₂ and CO₂ sensing in neonatal adrenal chromaffin cells, we investigated Ca_i responses using ratiometric fura-2 spectrofluorimetry. Typically, elevations in Ca_i precede CAT secretion in adrenal chromaffin cells exposed to various secretagogues, e.g., hypoxia (13, 14). In WT MAH cells, both hypoxia (PO₂ 15 mmHg) and hypercapnia (10% CO₂; pH 7.4) caused a significant increase in Ca_i (Fig. 7A). Robust increases in Ca_i were also induced by the depolarizing stimulus high K⁺ (30 mM) and by 10 µM nicotine (Fig. 7A), which presumably acts via binding to nicotinic acetylcholine receptors expressed in these cells (unpublished observations). Consistent with our electrophysiological studies demonstrating the failure of hypoxia to modulate outward currents and membrane potential in mitochondria-deficient ⁰ MAH cells (Fig. 2), hypoxia failed to evoke increases in Ca_i in ⁰ MAH cells (Fig. 7B). The fact that the depolarizing stimulus high K⁺, and other chemostimuli including hypercapnia (10% CO₂) and 10 µM nicotine, did elicit rises in Ca_i in these cells (Fig. 7B) suggested that the ⁰ phenotype did not cause any major perturbations in Ca²⁺ entry pathways.

View larger version (10K): [in this window] [in a new window]   Fig. 7. Fura-2 spectrofluorimetric determination of intracellular calcium (Cai) levels in WT vs. 0 MAH cells exposed to various stimuli. A: in WT MAH cells, significant increases in Cai relative to normoxic control (ANOVA; *P < 0.001) occurred during exposure to hypoxia (PO2 15 mmHg), isohydric hypercapnia (10% CO2; pH 7.4), nicotine (Nic; 10 µM), and the depolarizing stimulus, high extracellular K+ (30 mM) as exemplified in upper traces. Mean (±SE) data for a group of WT MAH cells (n = 10 dishes; 98 cells studied) are summarized in lower histogram. B: comparative data for 0 MAH cells (n = 10 dishes; 115 cells studied). Note lack of effect of hypoxia on Cai levels in 0 MAH cells, although the remaining stimuli were effective in increasing Cai (ANOVA; *P < 0.001).

Effects of hypoxia and hypercapnia on secretion in WT MAH and ⁰ MAH cells.

View larger version (13K): [in this window] [in a new window]   Fig. 8. Effects of hypoxia, hypercapnia, and high extracellular K+ on secretion from WT vs. 0 MAH cells. Carbon fiber amperometry was used to detect stimulus-evoked release of catecholamines (CAT) from both WT MAH cells (A and C) and 0 MAH cells (B and D). Hypoxia, hypercapnia (10% CO2), and high K+ (30 mM) stimulated CAT release from WT MAH cells, as exemplified in A; trace of cumulative charge (femtocoulombs; fC) from the integrated area under the CAT spikes is plotted above the sample recording. Event frequency, determined from records similar to A and B, is plotted for 20 cells under the various conditions shown in C. In contrast, hypoxia failed to stimulate CAT secretion from mitochondria-deficient 0 MAH cells, although both hypercapnia (10% CO2) and high K+ were effective in stimulating CAT release (B and D; n = 15). (*P < 0.01, significantly different from normoxic control).

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

Preservation of downstream targets of the O₂-sensing pathway in ⁰ MAH cells. Although the mutant ⁰ MAH cells appeared healthy, they grew more slowly than their WT counterparts, as expected, and were slightly smaller in size as revealed by whole cell capacitance measurements. It was conceivable, however, that the mutation affected the cells in more subtle ways such that downstream targets in the O₂-sensing pathway, rather than the O₂ sensor per se, were absent or poorly expressed. Several tests suggested that this possibility was unlikely. In particular, we found that several of the K⁺ channel subtypes known to be downstream targets for hypoxic modulation in WT MAH cells as well as in primary AMCs were functionally expressed in the mutant ⁰ cells. These included both the iberiotoxin-sensitive large (BK) and apamin-sensitive small (SK) conductance Ca²⁺-dependent K⁺ channels, whose inhibition by hypoxia are thought to facilitate membrane depolarization, voltage-gated Ca²⁺ entry, and CAT secretion in chromaffin cells (2, 4, 8, 13, 24, 25). Because the hypoxia-induced depolarization in chromaffin cells may involve different K⁺ channels than those mediating the inhibition of outward current, these two measures were used as separate or distinct indices of hypoxia sensitivity in MAH cells in the present study. At least four different types of K⁺ currents (i.e., BK, SK, Kv, and ATP-sensitive K⁺) are known to be regulated by hypoxia in chromaffin cells (3, 4, 8, 9, 25), and of these, inhibition of the SK current appears to be important near the resting potential where these channels are active (8, 9). Because MAH cells also express T-type Ca²⁺ currents (3; unpublished observations), which are also known to be active at more negative potentials near rest, it is likely that they are the source of Ca²⁺ entry, leading to CAT secretion during hypoxia-induced depolarization in WT MAH cells.

We also demonstrated the presence of Kv1.2 and Kv1.5 K⁺ channel subunits in mutant ⁰ MAH cells using immunocytochemistry. These subunits were proposed to contribute to a heteromeric Kv1.2/Kv1.5 delayed-rectifier-type K⁺ channel that also appears to be inhibited by hypoxia in WT MAH cells (4). Thus, several of the normal O₂-sensitive K⁺ channel subtypes were expressed in ⁰ MAH cells, suggesting that the lack of O₂ sensitivity in these cells was not due to the absence of these key downstream targets. Although it was not possible in the present study to test for all the possible changes that could have been induced in ⁰ MAH cells, it was clear that subsequent downstream steps in the hypoxia response pathway, i.e., those mediating voltage-gated Ca²⁺ entry and secretion, were also preserved in the mutant cells. Accordingly, application of high K⁺ depolarizing stimuli, or stimulation of nicotinic acetylcholine receptors with bath-applied nicotine, led to increases in Ca_i signals and/or CAT secretion in ⁰ MAH cells. Taken together, these data suggest that the defect in the mutant cells leading to the loss of O₂ sensitivity occurs at an early upstream step that is critically dependent on a functional mitochondrial ETC.

Mitochondrial O₂ sensor in adrenal chromaffin cells. The present study provides strong support for the hypothesis that the O₂ sensor in adrenal chromaffin cells is located within the mitochondrial ETC or at an upstream site. It therefore substantiates, via a genetic approach, a similar conclusion reached in previous studies that used pharmacological ETC blockers (8, 14, 22). The ability of rotenone, a mitochondrial complex I blocker, to mimic and occlude the effects of hypoxia in perinatal adrenal chromaffin cells has been used to support the idea that complex I is, or is closely associated with, the O₂ sensor (8, 22). In the present study, we found that rotenone did mimic hypoxia in inhibiting outward K⁺ current in WT MAH cells, and, consistent with mitochondria being the target for the drug's action, rotenone had no effect in mutant ⁰ MAH cells. These data therefore do not support the thesis of a rotenone-sensitive, extra-mitochondrial O₂ sensor in adrenal chromaffin cells, as has been proposed for rat carotid body O₂ chemoreceptors (17). The signaling pathway that links the O₂ sensor to K⁺ channel inhibition has been a source of controversy in a variety of O₂-sensing cells including carotid body type I cells, neuroepithelial body cells, and pulmonary smooth muscle cells (26). Nevertheless, the more popular theories consider PO₂-induced changes in redox status or in the ADP/ATP ratio acting as the main intermediary signal. In the case of perinatal adrenal chromaffin cells, the link appears to be associated at least with a change in redox state, particularly a decrease in mitochondria-derived reactive oxygen species (8, 22). However, the question as to whether cellular reactive oxygen species levels increase or decrease during acute hypoxia remains a controversial one in the O₂-sensing field (26). In ⁰ MAH cells, the production of reactive oxygen species appears to be significantly impaired (unpublished observations), and this may play a role in the lack of a hypoxic response in these cells.

MAH cells as CO₂ sensors. A novel finding in the present study was that MAH cells also functioned as CO₂ sensors, indicating that this cell line expressed yet another property recently characterized in native chromaffin cells of the neonatal rat adrenal medulla (15). Because CO₂ sensing was preserved in mutant ⁰ MAH cells, functional mitochondria were not required for its expression. This finding was not surprising since enzymatic activity of cytosolic CA was shown to mediate CO₂ sensing in chromaffin cells of the adrenal medulla (15) and the developmentally related carotid body receptors (5, 16). In both organs, increased CO₂ sensing is inhibited by membrane-permeable CA inhibitors and involves acidification of the intracellular pH (pH_i) as a consequence of CA-catalyzed hydration of CO₂. The acidic pH_i in turn leads to inhibition of K⁺ conductance and may also cause activation of a resting cation conductance, at least in neonatal rat adrenal chromaffin cells (15). The net result of these acidic pH_i-induced changes is enhanced membrane depolarization, leading to voltage-gated Ca²⁺ entry and CAT secretion. In the present study, isohydric hypercapnia (10% CO₂; extracellular pH 7.4) caused inhibition of outward K⁺ current and a depolarizing receptor potential in both WT and ⁰ MAH cells. Moreover, this stimulus induced a rise in Ca_i and CAT secretion as determined by ratiometric fura-2 measurements and carbon fiber amperometry, respectively. Interestingly, although neonatal rat adrenal chromaffin cells expressed two CA isoforms, i.e., CA I and CA II (15), we found that only the CA II isoform was expressed in WT and ⁰ MAH cells using a combination of RT-PCR, Western blot, and immunofluorescence techniques. These data suggest that of the two isoforms, CA II may be the more important isoform, and certainly sufficient for CO₂ sensing in MAH cells.

In summary, these studies provide strong support for the idea that a functional mitochondrial ETC is essential for O₂ sensing by perinatal adrenal chromaffin cells. Additionally, these studies further highlight the immortalized MAH cell line as an attractive model for perinatal adrenal chromaffin cells because they respond in similar ways as their native counterparts to two key stressors associated with birth, i.e., hypoxia and hypercapnia. This cell line should allow detailed molecular analyses of the regulatory mechanisms involved in these processes, which are critical during adaptation to extrauterine life.

	GRANTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
This work was supported by operating and equipment grants from the Heart and Stroke Foundation (HSF) of Ontario (T-5819) and the Natural Sciences and Engineering Research Council of Canada (to C. A. Nurse). The calcium imaging rig was purchased with a grant from the Canadian Foundation for Innovation. J. Buttigieg and S. T. Brown were supported by Focus on Stroke awards from HSF of Canada.

	ACKNOWLEDGMENTS

 
The authors thank Cathy Vollmer for exceptional technical assistance.

	FOOTNOTES

 

Address for reprint requests and other correspondence: C. A. Nurse, Dept. of Biology, McMaster Univ., 1280 Main St. W, Hamilton, ON, Canada, L8S 4K1 (e-mail: nursec{at}mcmaster.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

	REFERENCES

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
1. Birren SJ, Anderson DJ. A v-myc-immortalized sympathoadrenal progenitor cell line in which neuronal differentiation is initiated by FGF but not NGF. Neuron 4: 189–201, 1990.[CrossRef][Web of Science][Medline]

2. Bournaud R, Hidalgo J, Yu H, Girard E, Shimahara T. Catecholamine secretion from rat foetal adrenal chromaffin cells and hypoxia sensitivity. Pflügers Arch 454: 83–92, 2007.[CrossRef][Web of Science][Medline]

3. Brown ST, Johnson RP, Senaratne R, Fearon IM. Amyloid beta peptides mediate physiological remodelling of the acute O₂ sensitivity of adrenomedullary chromaffin cells following chronic hypoxia. Cardiovasc Res 64: 536–543, 2004.[Abstract/Free Full Text]

4. Fearon IM, Thompson RJ, Samjoo I, Vollmer C, Doering LC, Nurse CA. O₂-sensitive K⁺ channels in immortalised rat chromaffin-cell-derived MAH cells. J Physiol 545: 807–818, 2002.[Abstract/Free Full Text]

5. Gonzalez C, Almaraz L, Obeso A, Rigual R. Carotid body chemoreceptors: from natural stimuli to sensory discharges. Physiol Rev 74: 829–898, 1994.[Free Full Text]

6. Grynkiewicz G, Poenie M, Tsien RY. A new generation of Ca²⁺ indicators with greatly improved fluorescence properties. J Biol Chem 260: 3440–3450, 1985.[Abstract/Free Full Text]

7. Hu Y, Moraes CT, Savaraj N, Priebe W, Lampidis TJ. Rho(0) tumor cells: a model for studying whether mitochondria are targets for rhodamine 123, doxorubicin, and other drugs. Biochem Pharmacol 60: 1897–1905, 2000.[CrossRef][Web of Science][Medline]

8. Keating DJ, Rychkov GY, Giacomin P, Roberts ML. Oxygen-sensing pathway for SK channels in the ovine adrenal medulla. Clin Exp Pharmacol Physiol 32: 882–887, 2005.[CrossRef][Web of Science][Medline]

9. Keating DJ, Rychkov GY, Roberts ML. Oxygen sensitivity in the sheep adrenal medulla: role of SK channels. Am J Physiol Cell Physiol 281: C1434–C1441, 2001.[Abstract/Free Full Text]

10. Kemp PJ. Detecting acute changes in oxygen: will the real sensor please stand up? Exp Physiol 91: 829–834, 2006.[Abstract/Free Full Text]

11. Lagercrantz H, Slotkin T. The "stress" of being born. Sci Am 254: 100–107, 1986.[Web of Science][Medline]

12. Lopez-Barneo J, Del Toro R, Levitsky KL, Chiara MD, Ortega-Saenz P. Regulation of oxygen sensing by ion channels. J Appl Physiol 96: 1187–1195, 2004.[Abstract/Free Full Text]

13. Mochizuki-Oda N, Takeuchi Y, Matsumura K, Oosawa Y, Watanabe Y. Hypoxia-induced catecholamine release and intracellular Ca²⁺ increase via suppression of K⁺ channels in cultured rat adrenal chromaffin cells. J Neurochem 69: 377–387, 1997.[Web of Science][Medline]

14. Mojet MH, Mills E, Duchen MR. Hypoxia-induced catecholamine secretion in isolated newborn rat adrenal chromaffin cells is mimicked by inhibition of mitochondrial respiration. J Physiol 504: 175–189, 1997.[Abstract/Free Full Text]

15. Munoz-Cabello AM, Toledo-Aral JJ, Lopez-Barneo J, Echevarria M. Rat adrenal chromaffin cells are neonatal CO₂ sensors. J Neurosci 25: 6631–6640, 2005.[Abstract/Free Full Text]

16. Nurse CA. Carbonic anhydrase and neuronal enzymes in cultured glomus cells of the carotid body of the rat. Cell Tissue Res 261: 65–71, 1990.[CrossRef][Web of Science][Medline]

17. Ortega-Saenz P, Pardal R, Garcia-Fernandez M, Lopez-Barneo J. Rotenone selectively occludes sensitivity to hypoxia in rat carotid body glomus cells. J Physiol 548: 789–800, 2003.[Abstract/Free Full Text]

18. Park KS, Nam KJ, Kim JW, Lee YB, Han CY, Jeong JK, Lee HK, Pak YK. Depletion of mitochondrial DNA alters glucose metabolism in SK-Hep1 cells. Am J Physiol Endocrinol Metab 280: E1007–E1014, 2001.[Abstract/Free Full Text]

19. Rico AJ, Prieto-Lloret J, Gonzalez C, Rigual R. Hypoxia and acidosis increase the secretion of catecholamines in the neonatal rat adrenal medulla: an in vitro study. Am J Physiol Cell Physiol 289: C1417–C1425, 2005.[Abstract/Free Full Text]

20. Seidler FJ, Slotkin TA. Adrenomedullary function in the neonatal rat: responses to acute hypoxia. J Physiol 358: 1–16, 1985.[Abstract/Free Full Text]

21. Slotkin TA, Seidler FJ. Adrenomedullary catecholamine release in the fetus and newborn: secretory mechanisms and their role in stress and survival. J Dev Physiol 10: 1–16, 1988.[Web of Science][Medline]

22. Thompson RJ, Buttigieg J, Zhang M, Nurse CA. A rotenone-sensitive site and H₂O₂ are key components of hypoxia-sensing in neonatal rat adrenomedullary chromaffin cells. Neuroscience 145: 130–141, 2007.[CrossRef][Web of Science][Medline]

23. Thompson RJ, Farragher SM, Cutz E, Nurse CA. Developmental regulation of O₂ sensing in neonatal adrenal chromaffin cells from wild-type and NADPH-oxidase-deficient mice. Pflügers Arch 444: 539–548, 2002.[CrossRef][Web of Science][Medline]

24. Thompson RJ, Jackson A, Nurse CA. Developmental loss of hypoxic chemosensitivity in rat adrenomedullary chromaffin cells. J Physiol 498: 503–510, 1997.[Abstract/Free Full Text]

25. Thompson RJ, Nurse CA. Anoxia differentially modulates multiple K⁺ currents and depolarizes neonatal rat adrenal chromaffin cells. J Physiol 512: 421–434, 1998.[Abstract/Free Full Text]

26. Weir EK, Lopez-Barneo J, Buckler KJ, Archer SL. Acute oxygen-sensing mechanisms. N Engl J Med 353: 2042–2055, 2005.[Free Full Text]

This article has been cited by other articles:

				J. Buttigieg, S. Brown, A. C. Holloway, and C. A. Nurse Chronic Nicotine Blunts Hypoxic Sensitivity in Perinatal Rat Adrenal Chromaffin Cells via Upregulation of KATP Channels: Role of {alpha}7 Nicotinic Acetylcholine Receptor and Hypoxia-Inducible Factor-2{alpha} J. Neurosci., June 3, 2009; 29(22): 7137 - 7147. [Abstract] [Full Text] [PDF]

				S. T. Brown and C. A. Nurse Induction of HIF-2{alpha} is dependent on mitochondrial O2 consumption in an O2-sensitive adrenomedullary chromaffin cell line Am J Physiol Cell Physiol, June 1, 2008; 294(6): C1305 - C1312. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 294/4/C945    most recent 00495.2007v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Web of Science (4) Citing Articles via Google Scholar Google Scholar Articles by Buttigieg, J. Articles by Nurse, C. A. Search for Related Content PubMed PubMed Citation Articles by Buttigieg, J. Articles by Nurse, C. A.