Am J Physiol Cell Physiol Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 294: C945-C956, 2008. First published January 30, 2008; doi:10.1152/ajpcell.00495.2007
0363-6143/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/4/C945    most recent
00495.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Buttigieg, J.
Right arrow Articles by Nurse, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Buttigieg, J.
Right arrow Articles by Nurse, C. A.

NERVOUS SYSTEM CELL BIOLOGY

Functional mitochondria are required for O2 but not CO2 sensing in immortalized adrenomedullary chromaffin cells

J. Buttigieg, S. T. Brown, M. Lowe, M. Zhang, and C. A. Nurse

Department of Biology, McMaster University, Hamilton, Ontario, Canada

Submitted 18 October 2007 ; accepted in final form 23 January 2008


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Catecholamine (CAT) release from adrenomedullary chromaffin cells (AMC) in response to stressors such as low O2 (hypoxia) and elevated CO2/H+ is critical during adaptation of the newborn to extrauterine life. Using a surrogate model based on a v-myc immortalized adrenal chromaffin cell line (i.e., MAH cells), combined with genetic perturbation of mitochondrial function, we tested the hypothesis that functional mitochondria are required for O2 sensing. Wild-type MAH cells responded to both hypoxia and increased CO2 (hypercapnia) with K+ current inhibition and membrane depolarization. Additionally, these stimuli caused a rise in cytosolic Ca2+ and CAT secretion, determined by fura-2 spectrofluorimetry and carbon fiber amperometry, respectively. In contrast, mitochondria-deficient ({rho}0) MAH cells were hypoxia insensitive, although responses to hypercapnia and expression of several markers, including carbonic anhydrase II, remained intact. Rotenone (1 µM), a mitochondrial complex I blocker known to mimic and occlude the effects of hypoxia in primary AMC, was effective in wild-type but not {rho}0 MAH cells. These data demonstrate that functional mitochondria are involved in hypoxia-sensing by adrenal chromaffin cells. We also show for the first time that, like their neonatal chromaffin cell counterparts, MAH cells are CO2 sensors; however, this property is independent of functional mitochondria.

hypercapnia; hypoxia; rho 0; rotenone


ADRENOMEDULLARY CATECHOLAMINE (CAT) release in response to perinatal stressors plays a vital role in the adaptation of the neonate to extrauterine life (20, 21). These stressors, including low O2 (hypoxia), elevated CO2 (hypercapnia), and low pH (acidity), accompany intermittent breathing and asphyxia experienced by the newborn (11) and directly stimulate adrenomedullary chromaffin cells (AMC) before they acquire functional splanchnic innervation. The downstream mechanisms of O2 sensing in these AMC involve hypoxic inhibition of a variety of K+ channels, leading to or facilitating membrane depolarization, voltage-gated Ca2+ entry, and CAT secretion (2, 8, 13, 14, 2325). Increases in CO2/H+ also cause membrane depolarization and CAT secretion in these cells via activation of a resting cation conductance as well as K+ channel inhibition (15, 19). Consequently, the combined effects of low O2 and increased CO2/H+ during perinatal asphyxia contribute to a robust adrenomedullary secretory response that aids critically in the transformation of the lung to an air-breathing organ and in the regulation of cardiac contractility (11, 15, 19, 20).

The upstream mechanisms by which chromaffin cells in the adrenal medulla, as well as their counterparts in the carotid body, sense acute hypoxia have been the subject of intense investigation and controversy (12, 22). While heme proteins of the mitochondrial electron transport chain (ETC) have long received strong support as candidates for the O2 sensor, there is evidence for the involvement of extra-mitochondrial proteins including NADPH oxidase, hemeoxygenase-2, and AMP-kinase in the mediation of the hypoxic response (10). In the case of adrenal chromaffin cells, the mitochondrial ETC has been proposed as the site for the O2 sensor based primarily on the use of pharmacological ETC blockers including the complex I blocker, rotenone, which was found to mimic and occlude the effects of hypoxia (8, 14, 22). However, general concern about the lack of specificity of these ETC blockers, as well as the demonstration that rotenone may block a putative extra-mitochondrial O2 sensor in the carotid body (17), raises questions about the mitochondrial origin of the O2 sensor.

More definitive studies on the O2-sensing mechanisms in adrenal chromaffin cells can be greatly facilitated through the use of immortalized cell lines because their genetics can be conveniently manipulated. Also advantageous is a cell line that faithfully reproduces O2-sensing properties characteristic of the native cell. An attractive candidate for this role is the v-myc adrenal-derived HNK1+ immortalized chromaffin cell line (MAH) derived from fetal rat adrenal medulla (1). Recent studies from this laboratory have demonstrated that MAH cells express several O2-sensing properties of neonatal rat AMC, including hypoxic regulation of similar K+ channel subtypes as found in native cells (4). In the present study, we use wild-type (WT) MAH cells and mutant MAH cells, devoid of a functional ETC due to defective mitochondrial DNA ({rho}0 cells), to show that functional mitochondria are indeed required for O2 sensing by chromaffin cells. Several independent assays of O2 sensitivity were used to support this conclusion and involved whole cell recordings of K+ currents and membrane potential, ratiometric fura-2 intracellular Ca2+ (Cai) measurements, and carbon fiber amperometric determination of CAT secretion. We further show that the ability of rotenone to mimic hypoxia in these cells is dependent on functional mitochondria. Finally, we provide evidence for the first time that MAH cells can also act as CO2 sensors and express the CO2 marker carbonic anhydrase II (CA II). However, unlike hypoxia-sensing, CO2 sensing occurs in mutant {rho}0 MAH cells and is therefore independent of functional mitochondria.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
WT MAH cells. WT MAH cells (a generous gift from Dr. Laurie Doering) were grown in modified L-15/CO2 medium supplemented with 0.6% glucose, 1% penicillin-streptomycin, 10% fetal bovine serum, and 5 µM dexamethasone (4). All cultures were grown in a humidified atmosphere of 95% air-5% CO2 at 37°C. Cultures were fed every 1–2 days and split every 3–4 days. To passage cells, the culture medium was removed and 0.25% trypsin was added to detach cells from the culture substrate. The resulting cell suspension was pelleted by centrifugation, the supernatant discarded, and the pellet resuspended in fresh medium. Cells were then plated at a density of approximately 2 x 104 cells/ml onto standard 35-mm culture dishes, which had been previously coated with poly-D-lysine and laminin to promote cell adhesion.

Mitochondria-deficient {rho}0 MAH cells. To produce cultures of MAH cells deficient in functional mitochondria ({rho}0 MAH cells), WT cells were grown in modified L-15/CO2 medium supplemented with 0.6% glucose, 1% penicillin-streptomycin, 10% fetal bovine serum, 5 µM dexamethasone, 10 mM sodium pyruvate, 2 mM uridine, and 200 ng/ml ethidium bromide, to inhibit mitochondrial function and division (18). After incubation with ethidium bromide for 3 wk, cells were treated with 20 µM rotenone or 20 µM myxothiazol to select for cells deficient in functional mitochondria. Ethidium bromide prevented replication of mitochondrial DNA, and the surviving cells lacked a functional ETC (see below). {rho}0 MAH cells were fed every 1–2 days.

PCR determination of {rho}0 status. Confirmation of {rho}0 status in mutant MAH cells was obtained by examining the expression of mitochondrial DNA-encoded cytochrome oxidase I (COX I) subunit gene of complex IV (rat mitochondrial genome sequence 5161–5700). Primer sequences were derived from GeneBank accession number J05318, using the program GeneFisher. Primer sequences were as follows: (forward) 3' TGGAGCCTGAGCAGGAATAG and (reverse) 5' AATCTACGGATACCCCAGCA. PCR amplification of the β-actin gene was used as a control with the following primers: (forward) 3' CCTAGTCGTTCGTCCTCATGC and (reverse) 5' GAAGATCCTGACCGAGCGTG.

Quantitative RT-PCR. RNA from MAH cell cultures was extracted with the RNeasy Mini Kit (Qiagen). RNA was quantified in an Eppendorf Biophotometer, and 500 ng were treated with DNase I (Invitrogen). Reverse transcription was carried out on 100 ng of DNase-treated RNA using Superscript III (Invitrogen) and random primers (100 ng). Quantitative PCR was carried out with the Absolute QPCR SYBR Green Mix (ABgene) and analyzed with a Stratagene MX3000P machine. Gene-specific primers were designed using GeneFisher software and were synthesized by The Central Facility of the Institute for Molecular Biology and Biotechnology (MOBIX; McMaster University, Hamilton, ON, Canada). The following primers were used and listed as gene amplified, sequence (forward, reverse), and annealing temperature: Lamin A/C: 5'-GCAGTACAAGAAGGAGCTA-3' and 5'-CAGCAATTCCTGGTACTCA-3', 55°C; CA I: 5'-AACCAGCGAAGCCAAAC-3' and 5'-TGTGGTGGACGGTGGTTG-3', 55°C; CA II: 5'-CCGACAGTCCCCTGTGGA-3' and 5'-GCGGAGTGGTCAGAGAGCCA-3', 55°C. The primers for CA II span exons 2 through 6, whereas primers for CA I span exons 2 through 7. Lamin primer spans exons 6 through 8. Verification of the PCR products was done with the QIAquick Gel Extraction kit (Qiagen). The DNA sample was then sequenced (at MOBIX). The sequencing results were analyzed by the Basic Local Alignment Search Tool and were matched to the Rattus norvegicus Lamin A/C (GeneBank accession number BC062018.1 and X99257.1), CA I (XM_226922.4), and CA II (NM_019291.1). The results were analyzed by the {Delta}Ct method, which reflects the difference in threshold for the target gene relative to that of lamin gene in each sample. To ensure the validity of our calculations, we confirmed that the primer sets used in the present study had the same efficiencies as ascertained by varying template concentrations. In each case, the log of the template concentration when plotted against {Delta}Ct yielded values of <0.1 for the slope.

Electrophysiology. Whole cell recordings from WT and {rho}0 MAH cells were obtained with the nystatin perforated-patch technique as previously described (4, 24). In voltage-clamp experiments, cells were held at –60 mV and step depolarized to the indicated test potential (between –100 and +80 mV in 10-mV increments) for 100 ms at a frequency of 0.1 Hz. In some cases, cells were held at –60 mV and were ramped from –80 to +50 mV for 500 ms at a frequency of 0.1 Hz. Currents were filtered at 5 kHz, digitized at 10 kHz, and stored on computer for later analysis. Capacitative transients were minimized by analog means.

In these experiments, the pipette solution contained (in mM) 95 K gluconate, 35 KCl, 5 NaCl, 2 CaCl2, 10 HEPES, at pH 7.2, and nystatin (400 µg/ml). In some cases, the external bathing solution contained (in mM) 135 NaCl, 5 KCl, 2 CaCl2, 2 MgCl2, 10 glucose, and 10 HEPES, at pH 7.4. Solutions were changed via a gravity fed perfusion system. Hypoxic solutions (PO2 ~15–20 mmHg) were generated by bubbling N2 (gas) in a reservoir that was surrounded by a warm water bath (37°C) to minimize temperature changes. The temperature of the bathing solution at the recording site was ~37°C. The PO2 was measured in the chamber with a dissolved PO2 reader (WPI ISO2). In experiments designed to test the effects of CO2, bicarbonate-buffered extracellular solutions were used. Normocapnic (control) extracellular solution consisted of a bicarbonate/CO2-buffered saline of the following composition (in mM): 115 NaCl, 24 NaHCO3, 5 KCl, 2 CaCl2, 1 MgCl2, and 10 glucose at pH 7.4 maintained by bubbling 95% air-5% CO2. For isohydric hypercapnia (10% CO2), the pH was kept constant at 7.4 by elevating NaHCO3 to 48 mM (equimolar NaCl substituted). Solutions were made hypoxic by bubbling a 5% CO2-95% N2 gas mixture. The culture was perfused via gas-impermeable Tygon tubing, and excess solution was removed by vacuum suction. Data acquisition and analysis were performed with either an Axopatch 1D or Multiclamp 700 amplifier in combination with a Digidata 1200 or Digidata 1322A interface (respectively) and pCLAMP 9.2 software (Axon Instruments). Current densities were calculated by dividing the evoked current by cell capacitance.

Carbon fiber amperometry. CAT secretion from MAH cells was monitored with carbon fiber amperometry after the culture dish was placed on the stage of Zeiss Axioskop 2 upright microscope equipped with a x40 water immersion objective. The culture was perfused under gravity with bicarbonate-buffered extracellular solution, bubbled with 95% air-5% CO2 (pH 7.4; see above) at 37°C. In some experiments, high K+ (30 mM) solutions were used after equimolar substitution for NaCl. Hypoxic solution (PO2 = 15–20 mmHg) was obtained by continuously bubbling with a 5% CO2 -95% N2 gas mixture (see above). Catecholamine secretion was monitored with ProCFE low noise carbon fiber electrodes (electrode diameter 5 µm; Dagan) connected to a CV 23BU headstage and an Axopatch 200B amplifier set at 800 mV. Data acquisition and analysis were performed with Clampfit 9.2 (Axon Instruments); currents were filtered at 100 Hz, digitized at 250 Hz, and stored on a personal computer. Charge of individual secretory events was calculated by integrating the area under each spike, and total secretion during stimulus application was plotted as the cumulative charge (in fC). Events smaller than 3 pA were excluded from the analysis, and spike frequency was calculated as the number of spike events/min. Samples were compared with Student's t-test, and the level of significance was set at P < 0.05. Unless otherwise noted, the data are expressed as means ± SE.

Fura-2 Ca2+ measurements. Intracellular Ca2+ was monitored with the fluorescent Ca2+ indicator fura-2 AM. Cells were first plated into central wells of modified culture dishes, in which a central hole was drilled before a glass coverslip was attached to the underside. Cultures were loaded with 5 µM fura-2 AM for 30 min at 37°C, then rinsed (3 times) with extracellular solution, and allowed to deesterify for 30 min before use. Ratiometric Ca2+ measurements were obtained with a Nikon Eclipse TE2000-U inverted microscope equipped with a filter switching lambda DG-4 high-speed optical filter changer, a Hamamatsu OCRCA-ET digital CCD camera, and a Nikon S-Fluor x40 oil immersion objective lens with a numerical aperture of 1.3. Dual images (340- to 380-nm excitation, 510-nm emission) were collected, and pseudocolor ratiometric images were monitored during the experiments by using Simple PCI software (version 5.3, Compix). The imaging system was standardized with a two-point calibration, using Ca2+-free solution and Ca2+ solution (39 µM) obtained from Molecular Probes (F-6774). The parameters used for the two-point calibration include the dissociation constant of fura-2 (Kd 224 nM), the ratio values for the (–) and (+) concentration standards (Rmin = 0.026 and Rmax = 4.4) and β-value of 5.6. [Ca2+]i (in nM) was calculated according to the equation previously described (6). All experiments were performed at 37°C. Cells were continuously perfused with 5% CO2-bicarbonate-buffered extracellular solution as described above.

Rhodamine 123 staining. WT and {rho}0 MAH cells were grown in wells of modified 35-mm dishes (see above) for 24 h and were then treated with 10 µg/ml of rhodamine 123 for 10 min at room temperature. Cells were then rinsed and examined with a Nikon Eclipse TE2000-U inverted microscope with x100 oil immersion objective (Nikon). Images were captured using a Hamamatsu OCRCA-ER digital CCD camera using Simple PCI software (version 5.3).

Drugs. All solutions containing drugs were made fresh on the day of the experiments. Drugs were obtained from Sigma-Aldrich unless otherwise stated.

Immunocytochemistry. MAH cells were grown in the central wells of modified 35-mm Nunc dishes as previously described (4). The well was formed by drilling a central hole (~1 cm in diameter) in the dish and attaching a glass coverslip to the underside. Medium was removed, and the cells were washed two times in 3 ml phosphate-buffered saline (PBS). Cells were then fixed with 3 ml of 5% acetic acid-95% methanol at –20°C for 60 min, and the solution was replaced with 2 ml PBS. Samples were then washed three times with PBS, before the addition of 30 µl of primary antibody followed by incubation for 24 h at 4°C. The following primary antibodies were used at the dilutions indicated: anti-tyrosine hydroxylase, 1:1,000 (Millipore); anti-carbonic anhydrase, 1:50 (Biogenesis); anti-Kv1.2, 1:50; anti-Kv1.5, 1:50; and anti-Ca2+-dependent K+ or BK 1:100 (Alomone). Following incubation, the primary antibody solution was removed, and the samples were washed three times in PBS. Secondary antibody, conjugated with FITC or Texas red (Jackson Immunoresearch) (as indicated) was diluted in PBS (1:50) and incubated for 1 h at room temperature shielded from light. After removal of the solution, the samples were washed three times in PBS. Vecta-shield was then added to the dishes to prevent photobleaching. Control experiments, in which primary antibody was omitted from the first incubation step, were also performed. In the case of the BK, Kv1.2, and Kv1.5 channel antibodies, an additional control involved preincubating the primary antibody with excess blocking peptide overnight at 4°C (at 3 µg of fusion peptide per 1 µg of antibody), before addition to the cells. The samples were visualized with a Zeiss inverted microscope (IM 35) equipped with epifluorescence, as well as fluorescein and rhodamine filter sets. Images were acquired using a digital camera with Northern Eclipse software and were saved in TIFF format.

Western blot analysis. Confluent cultures of WT and {rho}0 MAH cells were trypsinized (0.25%) and pelleted by centrifugation. Cells were then washed three times in PBS. Cell pellets were then homogenized in 0.2 ml ice-cold buffer A (in mM: 20 HEPES, 20 KCl, 2 EDTA, 2 EGTA, and 2 DTT) containing 1 pellet of complete mini, EDTA-free protease inhibitor cocktail (Roche 1836170) and were placed on ice for 15 min. Then 6.25 µl of 10% NP40 was added to the homogenate and vortexed for 15 s. The resulting solution was then centrifuged at 10,000 g for 30 s. Protein was extracted in lysis buffer containing (in mM): 10 HEPES (pH 7.6), 10 KCl, 0.1 EDTA (pH 8), 0.1 EGTA (pH 8), and 1 DTT. Thirty micrograms of protein were loaded onto an 8% SDS-polyacrylamide gel and run at 120V for 2 h. Protein was transferred from the gel onto a polyvinylidene difluoride membrane (Millipore) and incubated in either sheep polyclonal antibody against CA II (Biogenesis) or mouse monoclonal antibody against β-actin at 4°C overnight. The membrane was washed with PBS, incubated for 1 h at room temperature with a horseradish peroxidase (HRP)-linked secondary antibody, and rewashed in PBS. The blot was visualized with Immobilon Western Chemiluminescent HRP substrate (Millipore) and autoradiography.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
General properties and confirmation of mitochondria-deficient status in {rho}0 MAH cells. As expected, the selection procedure for mitochondria-deficient {rho}0 MAH cells produced cell populations that grew more slowly than WT MAH cells. The majority of {rho}0 MAH cells appeared healthy when viewed under phase contrast microscopy (Fig. 1B). However, {rho}0 MAH cell size appeared slightly smaller than that of WT MAH (Fig. 1A), and this was confirmed by measurements of whole cell capacitance, which is proportional to surface area. The mean input capacitance of {rho}0 MAH cells was 5.8 ± 0.7 pF (n = 16), compared with 7.1 ± 0.5 pF (n = 15) for WT MAH cells (difference significant; P < 0.05). However, the mean input resistance of {rho}0 MAH cells (2.4 ± 0.11 G{Omega}; n = 15) was not significantly different from that of WT MAH cells (3.2 ± 0.7 G{Omega}; n = 16; P > 0.05). The expression of characteristic markers was also used to validate that, except for the loss of functional mitochondria, {rho}0 MAH cells were phenotypically similar to WT MAH cells. For example, {rho}0 MAH cells showed positive immunoreactivity against tyrosine hydroxylase, the rate-limiting enzyme in catecholamine biosynthesis, similar to WT MAH cells (Fig. 1, C and D). Furthermore, expression of several ion channel proteins was also retained in {rho}0 MAH cells, as will be discussed in K+ channel expression in {rho}0 MAH cells. Both WT MAH and {rho}0 MAH cells were also immunopositive for CA II (Fig. 1, E and F).


Figure 1
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 1. Expression of characteristic markers in wild-type (WT) and {rho}0 MAH cells. Phase contrast micrographs of WT (A) and {rho}0 (B) MAH cells are shown. Positive immunoreactivity against tyrosine hydroxylase (TH), was obtained in both WT (C) and {rho}0 (D) MAH cells with the aid of a FITC-conjugated secondary antibody. Similarly, both WT (E) and {rho}0 (F) MAH cells were immunopositive for carbonic anhydrase II (CA II), visualized with a FITC-conjugated secondary antibody. WT MAH cells showed significant uptake of the mitochondrial fluorescent probe rhodamine 123 (Rh 123; G), whereas {rho}0 MAH cells showed weak Rh 123 uptake (H), consistent with the absence of a functional electron transport chain (ETC). Confirmation of the {rho}0 status was obtained during PCR amplification of the mitochondria-encoded cytochrome oxidase I (COX I) gene, a subunit of complex IV. The COX I gene was absent in {rho}0 MAH cells but present in WT MAH cells (I). Both WT and {rho}0 MAH cells expressed the genome-encoded β-actin gene (I).

 
We used two independent assays to validate that mitochondrial function was impaired in {rho}0 MAH cells. First, we tested for uptake of the fluorescent dye rhodamine 123, which is known to accumulate in functional mitochondria (7). Accordingly, whereas WT MAH cells displayed significant rhodamine 123 fluorescence following a 10-min exposure to the dye (Fig. 1G), {rho}0 MAH cells showed little or no rhodamine 123 fluorescence (Fig. 1H). Second, we probed for the expression of a key subunit of the mitochondria-encoded cytochrome c oxidase gene (COX I) using PCR. As shown in Fig. 1I, WT MAH cells expressed COX I gene but {rho}0 MAH cells did not; note, however, that both WT and {rho}0 MAH cells expressed the β-actin gene (Fig. 1I). Taken together, these data confirm that the {rho}0 MAH cells used in the present study were deficient in functional mitochondria.

Are functional mitochondria required for O2 sensing in MAH cells? Previous studies in this laboratory have shown that the O2 sensitivity of MAH cells involves hypoxia-induced inhibition of outward K+ current and membrane depolarization, via closure of several K+ channel subtypes (4). With the use of perforated-patch recording, outward K+ currents from both WT MAH and {rho}0 MAH cells were monitored under voltage clamp. Exposure of WT MAH cells to acute hypoxia (PO2 ~15 mmHg), caused inhibition of outward K+ current at more positive potentials (Fig. 2, A and C). For a voltage step to +30 mV, from an initial holding potential of –60 mV, the mean outward current density decreased significantly from 46.1 ± 4.3 pA/pF under normoxia to 26.2 ± 5.2 pA/pF during hypoxia (n = 15, P < 0.05; Fig. 2C). In contrast, hypoxia had no effect on outward current in {rho}0 MAH cells; for a step to +30 mV, the normoxic outward current density was 38.7 ± 6.3 pA/pF versus 36.3 ± 4.1 pA/pF in hypoxia (n = 16; Fig. 2, B and D).


Figure 2
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 2. Whole cell recordings of the effects of hypoxia on outward K+ current and membrane potential in WT MAH vs. {rho}0 MAH cells. Hypoxia (Hox; PO2 ~15 mmHg) caused reversible inhibition of outward K+ current in WT MAH cells at positive potentials (n = 15; A and C). Sample recordings at a step potential of +30 mV are shown in A, and current density (I) vs. voltage (V) plot is shown in C for 15 cells. In A, control traces (C) before hypoxia and after washout (W) are also shown. Holding potential was –60 mV. In contrast, hypoxia had no effect on outward current in {rho}0 MAH cells as shown in sample traces (B), and in the I-V plot (D; n = 16). Under current clamp, hypoxia depolarized WT MAH cells (E; n = 11) but had no effect on membrane potential in {rho}0 MAH cells (F; n = 10).

 
We also compared the effects of hypoxia on membrane potential in WT and {rho}0 MAH cells under current clamp. As illustrated in Fig. 2E, acute hypoxia depolarized the membrane potential in WT MAH cells from a mean resting level of –57 ± 5.1 mV to –49 ± 4.7 mV (n = 11), corresponding to a receptor potential of ~8 mV. In contrast, hypoxia had no effect on the resting potential of {rho}0 MAH cells, as illustrated in Fig. 2F; the mean resting potential was –55 ± 4.3 mV before and during hypoxia (n = 10). Taken together, these data support the idea that hypoxia sensitivity of MAH cells requires functional mitochondria.

To validate further the important role of mitochondrial function in O2 sensing by MAH cells, we tested the effects of rotenone, a blocker of complex I of the ETC. We previously showed that rotenone mimicked and occluded the effects of hypoxia in primary neonatal adrenal chromaffin cells (22). In the present study, rotenone (1 µM) caused a reversible inhibition of outward current in WT MAH cells at more positive potentials (n = 10; Fig. 3A), similar to hypoxia (Fig. 2, A and B). In contrast, rotenone had no detectable effect on outward current in {rho}0 MAH cells (n = 12; Fig. 3B), consistent with the lack of complex I function in these mitochondria-deficient cells. These data also argue against a nonspecific effect of rotenone on K+ currents, of which several subtypes are expressed in both WT and {rho}0 MAH cells (see below).


Figure 3
View larger version (10K):
[in this window]
[in a new window]

 
Fig. 3. Effect of rotenone (Rot) on outward K+ current in WT vs. {rho}0 MAH cells. A: rotenone (1 µM), a blocker of complex I of the mitochondrial ETC, reversibly inhibited outward K+ currents in WT MAH cells at positive test potentials (n = 10). B: in the mitochondria-deficient {rho}0 MAH cells, rotenone had no effect on outward current (n = 12), suggesting that the drug's action required functional mitochondria. Insets, sample traces at a test potential of +30 mV (A and B).

 
K+ channel expression in {rho}0 MAH cells. Several K+ channel subtypes contribute to the O2-sensing properties of neonatal adrenal chromaffin and MAH cells including large (BK) and small (SK) conductance Ca2+ activated K+, and delayed-rectifier (Kv) K+ channels (4, 8, 23, 25). To confirm that the loss of O2 sensitivity in {rho}0 MAH cells was not due to the lack of expression of these O2- sensitive K+ channels, we used pharmacological blockers and immunocytochemistry. As shown in Fig. 4, outward K+ currents in both WT and {rho}0 MAH cells were inhibited by the selective SK and BK channel blockers apamin (100 nM; Fig. 4A1) and iberiotoxin (IbTx, 100 nM; Fig. 4A2), respectively, as well as by the general Ca2+ channel blocker cadmium, which indirectly blocks Ca2+-dependent K+ channels (Fig. 4A3). For a voltage step to +30 mV, inhibition by IbTx was 30 ± 6.3% (n = 7) in WT MAH cells (Fig. 4A2) and 25 ± 5.7% (n = 10) in {rho}0 cells (Fig. 4B2). In the case of apamin, the inhibition was 18 ± 7.2% (n = 8) for WT MAH cells (Fig. 4A1) and 19 ± 5.3% (n = 10) for {rho}0 MAH cells (Fig. 4B1). The percent inhibition by 50 µM Cd2+ was 28 ± 6.8% (n = 10) for WT MAH cells (Fig. 4A3) and 26 ± 8.3% (n = 10) for {rho}0 MAH cells (Fig. 4B3). These data indicate that {rho}0 MAH cells express functional Ca2+-dependent K+ channels previously shown to mediate at least part of the O2-sensing properties of chromaffin cells. In general, the percent inhibition due to the various K+ channel blockers was not significantly different between WT MAH and {rho}0 MAH cells. Further confirmation that WT and {rho}0 MAH cells expressed similar ion channel profiles was obtained from a comparison of the time to full activation of the outward K+ current at +30 mV; the mean time of 9.2 ± 1.1 ms for WT MAH cells was not significantly different (P > 0.05) from that of 8.7 ± 0.9 ms for {rho}0 MAH cells.


Figure 4
View larger version (16K):
[in this window]
[in a new window]

 
Fig. 4. K+ channel expression in WT and {rho}0 MAH cells. Mean (±SE) current vs. voltage plots are shown for WT MAH cells exposed to control (C) and either the small-conductance Ca2+-activated K+ (SK) channel blocker, apamin (Apa, 100 nM, A1; n = 8), the large-conductance Ca2+-activated K+ (BK) channel blocker, iberiotoxin (IbTx, 100 nM; A2; n = 7), or the nonspecific blocker of Ca2+ channels, cadmium (Cd2+, 50 µM; A3; n = 10), which indirectly blocks Ca2+-dependent K+ channels. Insets, sample recordings at +30 mV; holding potential was –60 mV. Corresponding data for {rho}0 MAH cells are shown in B1B3 (n = 10). Note that the {rho}0 MAH cells expressed similar Ca2+-dependent K+ currents as WT MAH cells. Error bars represent means ± SE. {rho}0 MAH cells also showed expression of Kv1.2, Kv1.5 subunits and the BK channel {alpha}-subunit, as determined by immunofluorescence (C). Staining was abolished in control experiments using blocking peptides (C, bottom).

 
Additional tests were used to probe for K+ channel expression in {rho}0 MAH cells. In particular, because delayed-rectifier K+ channels consisting of Kv1.2 and Kv1.5 subunits have also been implicated in O2 sensing by MAH cells (4), we used immunocytochemistry to test for possible expression of these channels in {rho}0 MAH cells. As shown in Fig. 4C, {rho}0 MAH cells showed positive immunoreactivity for both Kv1.2 and Kv1.5 subunits. In concert with our electrophysiological studies showing the presence of IbTx-sensitive BK currents in {rho}0 MAH cells (Fig. 4B2), positive immunoreactivity was also observed with antibodies against the BK channel (Fig. 4C). In control experiments, immunostaining was abolished in each case following preincubation with the corresponding blocking peptide or omission of the primary antiserum (Fig. 4C, bottom). These data further indicate that loss of mitochondrial function in these {rho}0 MAH cells did not result in an overt loss of expression of K+ channel proteins that mediate O2 sensitivity.

MAH cells as CO2 sensors: nonrequirement for functional mitochondria. Neonatal adrenal chromaffin cells also act as CO2 sensors, which elicit catecholamine secretion during elevated CO2 or hypercapnia (15). This property depends on intracellular CA activity and involves high CO2-induced inhibition of outward K+ current and membrane depolarization. Two CA isoforms, CA I and CA II, are expressed in neonatal adrenal chromaffin cells, but it is unclear whether one or both isoforms are required for CO2 sensing (15; see also Fig. 5A). Here, we tested for the first time whether MAH cells can act as a suitable surrogate model for CO2 sensing by adrenal chromaffin cells. Indeed, both WT MAH and {rho}0 MAH cells expressed mRNA for the CA II isoform (Fig. 5B), as well as the CA II protein (Fig. 1, E and F, and Fig. 5B). However, unlike neonatal chromaffin cells, they did not express mRNA for the CA I isoform (Fig. 5A). To test whether MAH cells are able to sense hypercapnia, whole cell recordings of ionic currents and membrane potential were obtained in bicarbonate-buffered medium. As illustrated in Fig. 6, AD, isohydric hypercapnia (10% CO2; pH 7.4) caused inhibition of outward K+ current in both WT MAH and {rho}0 MAH cells at more positive potentials, as previously reported for neonatal rat adrenal chromaffin cells (15). For a voltage step to +30 mV, hypercapnia caused a significant reduction in outward K+ current density from 52.3 ± 4.7 to 33.8 ± 5.1 pA/pF (n = 15; P < 0.05). Interestingly, the combined effects of hypoxia and hypercapnia on outward K+ current in WT MAH cells were additive (Fig. 6C). Under current clamp, hypercapnia also induced a mean depolarization of 11.2 ± 4.9 mV in WT MAH cells (Fig. 4E); the membrane potential depolarized reversibly from a mean resting level of –45 ± 5.6 to –33.8 ± 4.9 mV (n = 10), as exemplified in Fig. 6E. Taken together, these data indicate that MAH cells possess several of the CO2-sensing properties previously described for neonatal adrenal chromaffin cells.


Figure 5
View larger version (21K):
[in this window]
[in a new window]

 
Fig. 5. Expression of carbonic anhydrase I (CA I) and II (CA II) in chromaffin cells. A: RT-PCR was used to compare mRNA expression of CA I and CA II in WT MAH, {rho}0 MAH, and primary neonatal rat adrenomedullary chromaffin cells (neo AMC). Interestingly, only CA II was found to be expressed in WT and {rho}0 MAH cells (n = 4). However, both CA I and CA II were expressed in neonatal AMC. B: Western blot analysis showed similar expression levels of CA II protein in WT MAH and {rho}0 MAH cells, using β-actin as control.

 

Figure 6
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 6. Effects of isohydric hypercapnia and hypoxia on whole cell currents and membrane potential in WT vs. {rho}0 MAH cells. Isohydric hypercapnia (10% CO2; pH 7.4) caused reversible inhibition of outward K+ current in WT MAH cells, as shown in sample traces during steps to +30 mV (A) and in the current density (pA/pF) plot (C). As seen in HEPES-buffered medium (Fig. 2), hypoxia also inhibited outward K+ current in bicarbonate-buffered medium, and the combined application of hypoxia and hypercapnia (10% CO2) led to an additive response (C). Data represent means ± SE for step to +30 mV (n = 15); independent t-test. *P < 0.05, significantly different from normoxic control (Nox); **P < 0.05, significantly different from hypoxia. Traces for control (C) and recovery after washout (W) in A were obtained under normocapnia (5% CO2; pH 7.4). In {rho}0 MAH cells, isohydric hypercapnia still produced significant inhibition (t-test; *P < 0.001) of outward K+ current as shown in sample traces at +30 mV (B) and in the current density plot (D; n = 14). In contrast, hypoxia had no effect on outward K+ current in bicarbonate-buffered medium (D; n = 14), as was the case in HEPES-buffered medium (Fig. 2). Under current clamp, hypercapnia (10% CO2; pH 7.4) induced a depolarizing receptor potential in both WT (E) and {rho}0 (F) MAH cells.

 
The mechanism of CO2 sensing in adrenal chromaffin cells involves acidification of the intracellular pH catalyzed by CA activity (15). Since there is no evidence for mitochondrial involvement, we predicted that CO2 sensing should be preserved in {rho}0 MAH cells. This was indeed the case, further confirming that the {rho}0 status did not lead to a generalized loss of sensory functions. Similar to WT MAH cells, isohydric hypercapnia (10% CO2; pH 7.4) caused inhibition of outward K+ current at positive potentials in {rho}0 MAH cells (Fig. 6, B and D). During a voltage step to +30 mV, this stimulus evoked a significant reduction in outward K+ current density from 49.6 ± 4.7 to 23.4 ± 3.3 pA/pF (n = 20; P < 0.001) in {rho}0 MAH cells. Additionally, isohydric hypercapnia induced membrane depolarization in {rho}0 MAH cells, as exemplified in Fig. 6F; the membrane potential reversibly depolarized from a mean resting level of –52.1 ± 5.8 mV in 5% CO2 to –43.7 ± 4.4 mV (n = 10) in 10% CO2, at constant extracellular pH. These data indicate that MAH cells act as CO2 sensors and that, in contrast with O2 sensing, functional mitochondria are not required for CO2 sensing. These results also suggest that CA II expression may be sufficient for CO2 sensing in MAH cells and that CA I expression is not necessary for this function.

Intracellular Ca2+ responses in MAH cells. To learn more about the suitability of MAH cells as a surrogate model for O2 and CO2 sensing in neonatal adrenal chromaffin cells, we investigated Cai responses using ratiometric fura-2 spectrofluorimetry. Typically, elevations in Cai precede CAT secretion in adrenal chromaffin cells exposed to various secretagogues, e.g., hypoxia (13, 14). In WT MAH cells, both hypoxia (PO2 ~15 mmHg) and hypercapnia (10% CO2; pH 7.4) caused a significant increase in Cai (Fig. 7A). Robust increases in Cai were also induced by the depolarizing stimulus high K+ (30 mM) and by 10 µM nicotine (Fig. 7A), which presumably acts via binding to nicotinic acetylcholine receptors expressed in these cells (unpublished observations). Consistent with our electrophysiological studies demonstrating the failure of hypoxia to modulate outward currents and membrane potential in mitochondria-deficient {rho}0 MAH cells (Fig. 2), hypoxia failed to evoke increases in Cai in {rho}0 MAH cells (Fig. 7B). The fact that the depolarizing stimulus high K+, and other chemostimuli including hypercapnia (10% CO2) and 10 µM nicotine, did elicit rises in Cai in these cells (Fig. 7B) suggested that the {rho}0 phenotype did not cause any major perturbations in Ca2+ entry pathways.


Figure 7
View larger version (10K):
[in this window]
[in a new window]

 
Fig. 7. Fura-2 spectrofluorimetric determination of intracellular calcium (Cai) levels in WT vs. {rho}0 MAH cells exposed to various stimuli. A: in WT MAH cells, significant increases in Cai relative to normoxic control (ANOVA; *P < 0.001) occurred during exposure to hypoxia (PO2 ~15 mmHg), isohydric hypercapnia (10% CO2; pH 7.4), nicotine (Nic; 10 µM), and the depolarizing stimulus, high extracellular K+ (30 mM) as exemplified in upper traces. Mean (±SE) data for a group of WT MAH cells (n = 10 dishes; 98 cells studied) are summarized in lower histogram. B: comparative data for {rho}0 MAH cells (n = 10 dishes; 115 cells studied). Note lack of effect of hypoxia on Cai levels in {rho}0 MAH cells, although the remaining stimuli were effective in increasing Cai (ANOVA; *P < 0.001).

 
Effects of hypoxia and hypercapnia on secretion in WT MAH and {rho}0 MAH cells. Using carbon fiber amperometry, we monitored CAT secretion from both WT and {rho}0 MAH cells to examine further the role of mitochondria in O2 and CO2 sensing. As illustrated in Fig. 8, AD, acute hypoxia and isohydric hypercapnia stimulated quantal CAT secretion from WT MAH cells. These findings are reminiscent of those previously reported in neonatal AMC (13–15, 24). Additionally, exposure of WT MAH cells to high K+ (30 mM) also stimulated CAT secretion (Fig. 8, A and C). In contrast, hypoxia failed to induce CAT secretion from mitochondria-deficient {rho}0 MAH cells (Fig. 8, B and D), in agreement with the studies reported above indicating loss of O2 sensitivity in these cells. However, both hypercapnia and high K+ stimulated CAT secretion from {rho}0 MAH cells (Fig. 8, B and D), indicating that the secretory machinery was intact and confirming that CO2 sensing was independent of functional mitochondria. Additionally, basal secretion in WT MAH cells was significantly higher than that in {rho}0 MAH cells. When the data for stimulus-evoked CAT secretion were analyzed relative to basal secretion ({Delta}CAT), hypoxia induced a significant increase in CAT secretion in WT MAH cells ({Delta}CAT = 7.33 ± 2.1 events/min); in contrast, in {rho}0 MAH cells {Delta}CAT (0.4 ± 0.09 events/min) was not significantly altered, indicating the lack of a hypoxic response.


Figure 8
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 8. Effects of hypoxia, hypercapnia, and high extracellular K+ on secretion from WT vs. {rho}0 MAH cells. Carbon fiber amperometry was used to detect stimulus-evoked release of catecholamines (CAT) from both WT MAH cells (A and C) and {rho}0 MAH cells (B and D). Hypoxia, hypercapnia (10% CO2), and high K+ (30 mM) stimulated CAT release from WT MAH cells, as exemplified in A; trace of cumulative charge (femtocoulombs; fC) from the integrated area under the CAT spikes is plotted above the sample recording. Event frequency, determined from records similar to A and B, is plotted for 20 cells under the various conditions shown in C. In contrast, hypoxia failed to stimulate CAT secretion from mitochondria-deficient {rho}0 MAH cells, although both hypercapnia (10% CO2) and high K+ were effective in stimulating CAT release (B and D; n = 15). (*P < 0.01, significantly different from normoxic control).

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
A major goal of the present study was to explore further the hypothesis that hypoxia-sensing by perinatal AMCs is critically dependent on functional mitochondria, the presumed site of the O2 sensor (8, 14, 22). This mechanism is biologically and clinically important since CAT secretion from these cells in response to hypoxia, one of several stressors associated with birth, is critical for the proper transition to extrauterine life (11, 20, 21). One key function of this hypoxia-induced CAT surge at birth is to stimulate pulmonary fluid reabsorption and surfactant secretion, thereby preparing the lung for air-breathing. To avoid overreliance on the use of mitochondrial blockers, whose lack of specificity has been a source of major concern, we adopted a genetic strategy where impairment of mitochondrial function was the result of defective mitochondrial DNA induced by the ethidium bromide technique (18). Generation of this defect was facilitated with the use of an immortalized adrenal chromaffin cell line derived from embryonic (day 14.5) rat sympathoadrenal progenitors (i.e., MAH cells; 1), which, importantly, are known to express several hypoxia-sensing properties characteristic of neonatal AMCs (4). Interestingly, we found that mitochondria-deficient ({rho}0) MAH cells, which lacked expression of the mitochondrial DNA-encoded COX I subunit gene and showed deficient uptake of the mitochondrial fluorescent probe rhodamine 123, failed to respond to hypoxia, in contrast with WT MAH cells. Moreover, we found for the first time that MAH cells were also CO2 sensors, another recently characterized property of neonatal AMCs (15), although this property was independent of functional mitochondria. Indeed, the ability of mitochondria-deficient {rho}0 MAH cells to sense CO2 was of interest since it ruled out the possibility of a generalized loss in sensory functions due to the mutation. Additionally, these mutant cells appeared healthy under phase contrast microscopy, with well-defined nuclei and nucleoli, and they expressed several phenotypic markers characteristic of WT cells including tyrosine hydroxylase and CA II.

Preservation of downstream targets of the O2-sensing pathway in {rho}0 MAH cells. Although the mutant {rho}0 MAH cells appeared healthy, they grew more slowly than their WT counterparts, as expected, and were slightly smaller in size as revealed by whole cell capacitance measurements. It was conceivable, however, that the mutation affected the cells in more subtle ways such that downstream targets in the O2-sensing pathway, rather than the O2 sensor per se, were absent or poorly expressed. Several tests suggested that this possibility was unlikely. In particular, we found that several of the K+ channel subtypes known to be downstream targets for hypoxic modulation in WT MAH cells as well as in primary AMCs were functionally expressed in the mutant {rho}0 cells. These included both the iberiotoxin-sensitive large (BK) and apamin-sensitive small (SK) conductance Ca2+-dependent K+ channels, whose inhibition by hypoxia are thought to facilitate membrane depolarization, voltage-gated Ca2+ entry, and CAT secretion in chromaffin cells (2, 4, 8, 13, 24, 25). Because the hypoxia-induced depolarization in chromaffin cells may involve different K+ channels than those mediating the inhibition of outward current, these two measures were used as separate or distinct indices of hypoxia sensitivity in MAH cells in the present study. At least four different types of K+ currents (i.e., BK, SK, Kv, and ATP-sensitive K+) are known to be regulated by hypoxia in chromaffin cells (3, 4, 8, 9, 25), and of these, inhibition of the SK current appears to be important near the resting potential where these channels are active (8, 9). Because MAH cells also express T-type Ca2+ currents (3; unpublished observations), which are also known to be active at more negative potentials near rest, it is likely that they are the source of Ca2+ entry, leading to CAT secretion during hypoxia-induced depolarization in WT MAH cells.

We also demonstrated the presence of Kv1.2 and Kv1.5 K+ channel subunits in mutant {rho}0 MAH cells using immunocytochemistry. These subunits were proposed to contribute to a heteromeric Kv1.2/Kv1.5 delayed-rectifier-type K+ channel that also appears to be inhibited by hypoxia in WT MAH cells (4). Thus, several of the normal O2-sensitive K+ channel subtypes were expressed in {rho}0 MAH cells, suggesting that the lack of O2 sensitivity in these cells was not due to the absence of these key downstream targets. Although it was not possible in the present study to test for all the possible changes that could have been induced in {rho}0 MAH cells, it was clear that subsequent downstream steps in the hypoxia response pathway, i.e., those mediating voltage-gated Ca2+ entry and secretion, were also preserved in the mutant cells. Accordingly, application of high K+ depolarizing stimuli, or stimulation of nicotinic acetylcholine receptors with bath-applied nicotine, led to increases in Cai signals and/or CAT secretion in {rho}0 MAH cells. Taken together, these data suggest that the defect in the mutant cells leading to the loss of O2 sensitivity occurs at an early upstream step that is critically dependent on a functional mitochondrial ETC.

Mitochondrial O2 sensor in adrenal chromaffin cells. The present study provides strong support for the hypothesis that the O2 sensor in adrenal chromaffin cells is located within the mitochondrial ETC or at an upstream site. It therefore substantiates, via a genetic approach, a similar conclusion reached in previous studies that used pharmacological ETC blockers (8, 14, 22). The ability of rotenone, a mitochondrial complex I blocker, to mimic and occlude the effects of hypoxia in perinatal adrenal chromaffin cells has been used to support the idea that complex I is, or is closely associated with, the O2 sensor (8, 22). In the present study, we found that rotenone did mimic hypoxia in inhibiting outward K+ current in WT MAH cells, and, consistent with mitochondria being the target for the drug's action, rotenone had no effect in mutant {rho}0 MAH cells. These data therefore do not support the thesis of a rotenone-sensitive, extra-mitochondrial O2 sensor in adrenal chromaffin cells, as has been proposed for rat carotid body O2 chemoreceptors (17). The signaling pathway that links the O2 sensor to K+ channel inhibition has been a source of controversy in a variety of O2-sensing cells including carotid body type I cells, neuroepithelial body cells, and pulmonary smooth muscle cells (26). Nevertheless, the more popular theories consider PO2-induced changes in redox status or in the ADP/ATP ratio acting as the main intermediary signal. In the case of perinatal adrenal chromaffin cells, the link appears to be associated at least with a change in redox state, particularly a decrease in mitochondria-derived reactive oxygen species (8, 22). However, the question as to whether cellular reactive oxygen species levels increase or decrease during acute hypoxia remains a controversial one in the O2-sensing field (26). In {rho}0 MAH cells, the production of reactive oxygen species appears to be significantly impaired (unpublished observations), and this may play a role in the lack of a hypoxic response in these cells.

MAH cells as CO2 sensors. A novel finding in the present study was that MAH cells also functioned as CO2 sensors, indicating that this cell line expressed yet another property recently characterized in native chromaffin cells of the neonatal rat adrenal medulla (15). Because CO2 sensing was preserved in mutant {rho}0 MAH cells, functional mitochondria were not required for its expression. This finding was not surprising since enzymatic activity of cytosolic CA was shown to mediate CO2 sensing in chromaffin cells of the adrenal medulla (15) and the developmentally related carotid body receptors (5, 16). In both organs, increased CO2 sensing is inhibited by membrane-permeable CA inhibitors and involves acidification of the intracellular pH (pHi) as a consequence of CA-catalyzed hydration of CO2. The acidic pHi in turn leads to inhibition of K+ conductance and may also cause activation of a resting cation conductance, at least in neonatal rat adrenal chromaffin cells (15). The net result of these acidic pHi-induced changes is enhanced membrane depolarization, leading to voltage-gated Ca2+ entry and CAT secretion. In the present study, isohydric hypercapnia (10% CO2; extracellular pH 7.4) caused inhibition of outward K+ current and a depolarizing receptor potential in both WT and {rho}0 MAH cells. Moreover, this stimulus induced a rise in Cai and CAT secretion as determined by ratiometric fura-2 measurements and carbon fiber amperometry, respectively. Interestingly, although neonatal rat adrenal chromaffin cells expressed two CA isoforms, i.e., CA I and CA II (15), we found that only the CA II isoform was expressed in WT and {rho}0 MAH cells using a combination of RT-PCR, Western blot, and immunofluorescence techniques. These data suggest that of the two isoforms, CA II may be the more important isoform, and certainly sufficient for CO2 sensing in MAH cells.

In summary, these studies provide strong support for the idea that a functional mitochondrial ETC is essential for O2 sensing by perinatal adrenal chromaffin cells. Additionally, these studies further highlight the immortalized MAH cell line as an attractive model for perinatal adrenal chromaffin cells because they respond in similar ways as their native counterparts to two key stressors associated with birth, i.e., hypoxia and hypercapnia. This cell line should allow detailed molecular analyses of the regulatory mechanisms involved in these processes, which are critical during adaptation to extrauterine life.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by operating and equipment grants from the Heart and Stroke Foundation (HSF) of Ontario (T-5819) and the Natural Sciences and Engineering Research Council of Canada (to C. A. Nurse). The calcium imaging rig was purchased with a grant from the Canadian Foundation for Innovation. J. Buttigieg and S. T. Brown were supported by Focus on Stroke awards from HSF of Canada.


    ACKNOWLEDGMENTS
 
The authors thank Cathy Vollmer for exceptional technical assistance.


    FOOTNOTES
 

Address for reprint requests and other correspondence: C. A. Nurse, Dept. of Biology, McMaster Univ., 1280 Main St. W, Hamilton, ON, Canada, L8S 4K1 (e-mail: nursec{at}mcmaster.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Birren SJ, Anderson DJ. A v-myc-immortalized sympathoadrenal progenitor cell line in which neuronal differentiation is initiated by FGF but not NGF. Neuron 4: 189–201, 1990.[CrossRef][Web of Science][Medline]

2. Bournaud R, Hidalgo J, Yu H, Girard E, Shimahara T. Catecholamine secretion from rat foetal adrenal chromaffin cells and hypoxia sensitivity. Pflügers Arch 454: 83–92, 2007.[CrossRef][Web of Science][Medline]

3. Brown ST, Johnson RP, Senaratne R, Fearon IM. Amyloid beta peptides mediate physiological remodelling of the acute O2 sensitivity of adrenomedullary chromaffin cells following chronic hypoxia. Cardiovasc Res 64: 536–543, 2004.[Abstract/Free Full Text]

4. Fearon IM, Thompson RJ, Samjoo I, Vollmer C, Doering LC, Nurse CA. O2-sensitive K+ channels in immortalised rat chromaffin-cell-derived MAH cells. J Physiol 545: 807–818, 2002.[Abstract/Free Full Text]

5. Gonzalez C, Almaraz L, Obeso A, Rigual R. Carotid body chemoreceptors: from natural stimuli to sensory discharges. Physiol Rev 74: 829–898, 1994.[Free Full Text]

6. Grynkiewicz G, Poenie M, Tsien RY. A new generation of Ca2+ indicators with greatly improved fluorescence properties. J Biol Chem 260: 3440–3450, 1985.[Abstract/Free Full Text]

7. Hu Y, Moraes CT, Savaraj N, Priebe W, Lampidis TJ. Rho(0) tumor cells: a model for studying whether mitochondria are targets for rhodamine 123, doxorubicin, and other drugs. Biochem Pharmacol 60: 1897–1905, 2000.[CrossRef][Web of Science][Medline]

8. Keating DJ, Rychkov GY, Giacomin P, Roberts ML. Oxygen-sensing pathway for SK channels in the ovine adrenal medulla. Clin Exp Pharmacol Physiol 32: 882–887, 2005.[CrossRef][Web of Science][Medline]

9. Keating DJ, Rychkov GY, Roberts ML. Oxygen sensitivity in the sheep adrenal medulla: role of SK channels. Am J Physiol Cell Physiol 281: C1434–C1441, 2001.[Abstract/Free Full Text]

10. Kemp PJ. Detecting acute changes in oxygen: will the real sensor please stand up? Exp Physiol 91: 829–834, 2006.[Abstract/Free Full Text]

11. Lagercrantz H, Slotkin T. The "stress" of being born. Sci Am 254: 100–107, 1986.[Web of Science][Medline]

12. Lopez-Barneo J, Del Toro R, Levitsky KL, Chiara MD, Ortega-Saenz P. Regulation of oxygen sensing by ion channels. J Appl Physiol 96: 1187–1195, 2004.[Abstract/Free Full Text]

13. Mochizuki-Oda N, Takeuchi Y, Matsumura K, Oosawa Y, Watanabe Y. Hypoxia-induced catecholamine release and intracellular Ca2+ increase via suppression of K+ channels in cultured rat adrenal chromaffin cells. J Neurochem 69: 377–387, 1997.[Web of Science][Medline]

14. Mojet MH, Mills E, Duchen MR. Hypoxia-induced catecholamine secretion in isolated newborn rat adrenal chromaffin cells is mimicked by inhibition of mitochondrial respiration. J Physiol 504: 175–189, 1997.[Abstract/Free Full Text]

15. Munoz-Cabello AM, Toledo-Aral JJ, Lopez-Barneo J, Echevarria M. Rat adrenal chromaffin cells are neonatal CO2 sensors. J Neurosci 25: 6631–6640, 2005.[Abstract/Free Full Text]

16. Nurse CA. Carbonic anhydrase and neuronal enzymes in cultured glomus cells of the carotid body of the rat. Cell Tissue Res 261: 65–71, 1990.[CrossRef][Web of Science][Medline]

17. Ortega-Saenz P, Pardal R, Garcia-Fernandez M, Lopez-Barneo J. Rotenone selectively occludes sensitivity to hypoxia in rat carotid body glomus cells. J Physiol 548: 789–800, 2003.[Abstract/Free Full Text]

18. Park KS, Nam KJ, Kim JW, Lee YB, Han CY, Jeong JK, Lee HK, Pak YK. Depletion of mitochondrial DNA alters glucose metabolism in SK-Hep1 cells. Am J Physiol Endocrinol Metab 280: E1007–E1014, 2001.[Abstract/Free Full Text]

19. Rico AJ, Prieto-Lloret J, Gonzalez C, Rigual R. Hypoxia and acidosis increase the secretion of catecholamines in the neonatal rat adrenal medulla: an in vitro study. Am J Physiol Cell Physiol 289: C1417–C1425, 2005.[Abstract/Free Full Text]

20. Seidler FJ, Slotkin TA. Adrenomedullary function in the neonatal rat: responses to acute hypoxia. J Physiol 358: 1–16, 1985.[Abstract/Free Full Text]

21. Slotkin TA, Seidler FJ. Adrenomedullary catecholamine release in the fetus and newborn: secretory mechanisms and their role in stress and survival. J Dev Physiol 10: 1–16, 1988.[Web of Science][Medline]

22. Thompson RJ, Buttigieg J, Zhang M, Nurse CA. A rotenone-sensitive site and H2O2 are key components of hypoxia-sensing in neonatal rat adrenomedullary chromaffin cells. Neuroscience 145: 130–141, 2007.[CrossRef][Web of Science][Medline]

23. Thompson RJ, Farragher SM, Cutz E, Nurse CA. Developmental regulation of O2 sensing in neonatal adrenal chromaffin cells from wild-type and NADPH-oxidase-deficient mice. Pflügers Arch 444: 539–548, 2002.[CrossRef][Web of Science][Medline]

24. Thompson RJ, Jackson A, Nurse CA. Developmental loss of hypoxic chemosensitivity in rat adrenomedullary chromaffin cells. J Physiol 498: 503–510, 1997.[Abstract/Free Full Text]

25. Thompson RJ, Nurse CA. Anoxia differentially modulates multiple K+ currents and depolarizes neonatal rat adrenal chromaffin cells. J Physiol 512: 421–434, 1998.[Abstract/Free Full Text]

26. Weir EK, Lopez-Barneo J, Buckler KJ, Archer SL. Acute oxygen-sensing mechanisms. N Engl J Med 353: 2042–2055, 2005.[Free Full Text]




This article has been cited by other articles:


Home page
J. Neurosci.Home page
J. Buttigieg, S. Brown, A. C. Holloway, and C. A. Nurse
Chronic Nicotine Blunts Hypoxic Sensitivity in Perinatal Rat Adrenal Chromaffin Cells via Upregulation of KATP Channels: Role of {alpha}7 Nicotinic Acetylcholine Receptor and Hypoxia-Inducible Factor-2{alpha}
J. Neurosci., June 3, 2009; 29(22): 7137 - 7147.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. T. Brown and C. A. Nurse
Induction of HIF-2{alpha} is dependent on mitochondrial O2 consumption in an O2-sensitive adrenomedullary chromaffin cell line
Am J Physiol Cell Physiol, June 1, 2008; 294(6): C1305 - C1312.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/4/C945    most recent
00495.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Buttigieg, J.
Right arrow Articles by Nurse, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Buttigieg, J.
Right arrow Articles by Nurse, C. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.