|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MUSCLE CELL BIOLOGY AND CELL MOTILITY
Department of Medicine, Baylor College of Medicine, Houston, Texas
Submitted 25 June 2007 ; accepted in final form 4 February 2008
| ABSTRACT |
|---|
|
|
|---|
respiratory muscle; mechanical stretch; mechanotransduction; diaphragm
The phophatidylinositol-3-OH kinase (PI3K)-Akt signaling pathway is one of the most recognized mechanosensitive signaling pathways in skeletal muscles. Several reports have shown rather convincingly the activation of Akt by increased skeletal muscle contraction or passive muscle stretch (23, 40, 42, 43, 51). Akt signaling contributes to muscle mass growth and maintenance by two independent mechanisms: one involves stimulation of protein synthesis, and the other includes inhibition of protein degradation. The first mechanism occurs by activation of the rapamycin-mammalian target of rapamycin pathway, which stimulates protein synthesis by activation of the p70/S6 kinase and phosphorylation of translation factors (36, 38, 41). Recently, the age-related loss of induced mass growth in fast-twitch muscles has been correlated with an increase in AMP-activated protein kinase signaling, which downregulates the rapamycin-mammalian target of rapamycin pathway and, consequently, protein synthesis (48). The second mechanism acts through downregulation of the family of forkhead homeobox type O (FOXO) transcription factors, which are responsible for expression of the muscle atrophy-induced ubiquitin ligases muscle ring finger 1 (MuRF1) and muscle atrophy F box (MAFbx), also called atrogin (44, 46).
Regulation of FOXO factor activity is mainly controlled by a shuttling system that modulates its cellular localization by phosphorylation sites located in the COOH-terminal domain. Phosphorylation of these sites by Akt provokes their nuclear export (52). Four members of the FOXO subfamily of forkhead transcription factors have been identified in the mouse. Three of these, Foxo1, Foxo3a, and Foxo4, have the same tissue distribution pattern as their human counterparts: Foxo1 is highly expressed in ovaries, Foxo4 is highly expressed in muscle, and Foxo3a is widely expressed in a variety of tissues. The fourth member found in mice, Foxo6, appeared restricted to the brain (4, 46) and is regulated in a different manner by Akt, which controls its activity but does not affect its nuclear localization (53). Foxo1 has been reported to contribute to myotube fusion during myoblast differentiation by an Akt-independent mechanism (6, 24), and its overexpression in mice has a detrimental effect on muscle mass and upregulates type I slow-twitch fibers (27). In C2C12 myotubes, the expression of constitutively active Foxo3a is enough to induce atrophy, with a concomitant activation of MAFbx expression (44).
Changes in RNA levels of Foxo1, Foxo3a, and Foxo4 have been reported in aged rats that are affected by calorie restriction (18). However, the regulation of the Akt signaling pathway and its effect on FOXO transcriptional activity in aging skeletal muscles have not been explored, despite a clear relevance of FOXO transcription factors to skeletal muscle formation. We postulated that FOXO transcriptional activity is sensitive to mechanical stretch and that stretch-induced regulation of FOXO in the aging respiratory pump is distinct from that in the young respiratory pump. Our data support the novel hypothesis that aging of the respiratory pump is associated with aberrant regulation of the mechanical stretch-induced signaling pathways that control FOXO activity.
| MATERIALS AND METHODS |
|---|
|
|
|---|
and IKKβ, and IKK
and IKKβ antibodies from Cell Signaling; JNK1, JNK2, phosphospecific (Thr183 and Tyr185) JNK1/2, FKHR (Foxo1), and AFX (Foxo4) antibodies and secondary antibodies from Santa Cruz Biotechnology; and oligonucleotides from Invitrogen. The sequences of the oligonucleotides used in EMSAs were as follows: CTATAAGTAAACAACTGTGACTAGT for total FOXO activity, GGGATAAATACTGTGCTCGGGCAG for Foxo1, and CTAGCAAGCAAACAAACTTATTTTGAACACGGG for Foxo3a. A mutated version of the Foxo1 oligonucleotide (GGGATCACTACTGTGCTCGGGCAG) was used as cold noncompetitor.
Mice and tissue preparation.
Pathogen- and tumor-free mice from the C57BL6 strain (National Institute on Aging) were maintained in the animal facility at Baylor College of Medicine. The animals were housed and fed in stainless steel cages under a 12:12-h light-dark schedule. All animal studies were approved by the Baylor College of Medicine Institutional Animal Care and Use Committee and conformed to the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Three groups of mice were used for mechanics and biochemical experiments: the first group (n = 42) consisted of young (2-mo-old) mice (63.33 ± 20.14 days old, 22.47 ± 3.35 g body wt), the second group (n = 17) was
1 yr old (382.71 ± 21.28 days old, 30.53 ± 3.22 g body wt), and the third group (n = 22) was
2 yr old (692.09 ± 79.63 days old, 29.87 ± 3.55 g body wt). The mice were deeply anesthetized with an injection (0.5–0.7 ml/kg ip) of rodent III combination anesthetic [ketamine (37.6 mg/ml), xylazine (1.92 mg/ml), and acepromazine (0.38 mg/ml)]. The entire diaphragm muscle and its rib attachments were quickly excised and immersed in a muscle bath containing a modified Krebs-Ringer solution [in mM: 137 NaCl, 5 KCl, 1 NaH2PO4, 24 NaHCO3, 2 CaCl2, and 1 MgSO4 (pH 7.4)] bubbled with 95% O2-5% CO2. The solution was maintained at 25°C throughout the preparation and experimental phases of the study.
Muscle mechanical testing. After excision, the hemidiaphragms were quickly attached to force carriages by alligator clamps in an in vitro biaxial muscle-testing apparatus, as previously described (33). This apparatus has two perpendicular axes, each driven by a micrometer. Two small identical alligator clamps (0.9 cm for the y-axis and 1 mm for the x-axis) were used to stretch the muscle. To secure the diaphragm muscle sheet, one clamp was fixed on the central tendon and the opposing clamp on the myotendinous junction at the chest wall insertion, with the rib cage intact. A force transducer attached to the force carriage (model LQB, Cooper Instruments; 150 ± 50 g, differential bridge type) was used to measure applied mechanical loading. Forces were then amplified, conditioned with a low-pass-frequency filter (CD19A carrier demodulator, Validyne, Northridge, CA), and recorded with a data acquisition board (PCI-6229 DAQm series, National Instruments).
Passive length-tension relationships.
The length-tension relationship was obtained by placement of four silk suture markers (7-0 or 8-0 Surgilene) on the abdominal membrane surface of the left costal hemidiaphragm before the muscle was clamped in the biaxial apparatus. The muscle was mounted so that the position of markers during passive stretch could be viewed with a black-and-white CCTV-type camera and recorded on a VHS tape. All four markers were placed in the central region of the muscle to minimize the boundary effects. The markers were placed in a
1-mm2 configuration on adjacent myofibers. Lengthening and shortening stretch cycles were initiated from an unstressed state to assess length-tension relationships. Left costal diaphragms were stretched to peak tensions of 1.11, 2.22, and 4.44 g/cm passive tension in directions along and transverse to muscle fibers. Taped images of the markers during stretch cycles were converted digitally with a video capture card. A custom-made marker-tracking program was used to select marker positions on an x-y Cartesian plane, with the assumption that all markers lie within the same plane. Peak strains were than aligned, and a custom-made Matlab script was used to match peak strains with recorded force data.
Computation of two-dimensional strains.
Mechanical strains were calculated on the basis of methods established in our previous work. The strains in the plane of the muscle were computed by the following procedure. The marked region is divided into triangles, with markers forming the apices. The coordinates of these points in that unstressed plane of the diaphragm are denoted xi and yi (i = 1, 2). The displacement, ui, from the unstressed state to the deformed state is assumed to be a linear function of position and is computed as follows
![]() | (1) |
![]() | (2) |
![]() | (3) |
![]() | (4) |
u and
v denote the marker's displacement in the directions of the muscle fibers (x), as well as the direction transverse to the fibers (y). These displacements were used to compute mechanical strains. The strains,
x and
y, were computed for each triangle.
xy is defined as shear strain and is essentially negligible. Therefore,
x is aligned with the muscle fiber direction, whereas
y is in aligned in the transverse direction to the fibers
![]() | (5) |
is defined as the extension ratio and
as mechanical strain.
Measurements and modeling of viscoelastic properties.
We measured stress-relaxation curves for the diaphragm muscles from the same mice, as previously described (33). Diaphragms were stretched to peak tensions of 1.11 g/cm. The muscle was then kept at a constant length and allowed to relax asymptotically until it reached a plateau at 300 s. Acquired force data were filtered utilizing the Matlab smooth tool and normalized to peak force. A Matlab nonlinear least-squares routine was used to fit the normalized data to the standard linear solid model of viscoelasticity (7). This simple model of viscoelasticity describes the muscle as a parallel combination of a dashpot with coefficient of viscosity
1 and a linear spring of spring constant µ1 with a second linear spring of spring constant µ0 that is in parallel with the first spring and the dashpot. The relaxation function based on this model has the form
![]() | (6) |

is relaxation time for constant strain, and 
is the relaxation time for constant stress. After the data were fit to the standard viscoelastic model, ER was obtained and averaged across each age group. ER can be interpreted graphically as the steady-state fraction of peak force achieved after 300 s. Ex vivo mechanical stretch protocol for biochemical experiments. This experimental protocol was performed essentially as described in our previous work (31). The left hemidiaphragms were quickly excised and placed into the biaxial apparatus with oxygenated Krebs-Ringer solution. A single stretch to 2.22 g/cm was applied to the left hemidiaphragm and held under constant mechanical stretch for 0, 15, 30, or 60 min, depending on the experiment. The right hemidiaphragm from the same mouse was used as a nonstretched control and remained in the same bath for the same amount of time as the stretched left hemidiaphragm.
Pharmacological inhibitors were added to Krebs-Ringer solution, and diaphragms were allowed to incubate for 30 min before mechanical stretching. The inhibitors were as follows: Akt inhibitor II (20 µM; Calbiochem); SC-514, a specific inhibitor for IKKβ (2 µM) (28); SP-60025, a specific inhibitor for JNK1 and JNK2 (10 µM) (29); and wortmannin (1 µM) (37).
Nuclear and whole cell extract preparation.
Nuclear extracts were prepared at the end of each stretch protocol as follows. Muscles were immediately suspended in 300–400 µl (15 µl/g body wt) of low-salt lysis buffer [10 mM HEPES (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 0.1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 2.0 µg/ml leupeptin, 2.0 µg/ml aprotinin, and 0.5 µg/ml benzamidine] and subjected to mechanical grinding. The disrupted tissue was allowed to swell on ice for 5 min, subjected to two cycles of freeze-thaw lysis, and vortexed vigorously for 10 s. The lysates were centrifuged at 14,000 rpm for 30 s at 4°C, and the supernatants (cytoplasmic extracts) were kept at –70°C. Nuclear pellets were washed in low-salt buffer, resuspended in
100 µl (5 µl/g body wt) of high-salt buffer [20 mM HEPES (pH 7.9), 420 mM NaCl, 1 mM EDTA, 1 mM EGTA, 25% glycerol, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 2.0 µg/ml leupeptin, 2.0 µg/ml aprotinin, and 0.5 µg/ml benzamidine], and incubated on ice for 30 min with intermittent vortexing. The nuclear lysates were then centrifuged at 14,000 rpm for 5 min at 4°C, and the supernatant (nuclear extracts) was assayed immediately or kept at –70°C for further analysis. Whole cell extracts were prepared as follows. After the stretch protocol, muscles were washed in PBS containing 0.5 mM phenylmethylsulfonyl fluoride and homogenized by mechanical grinding in 20 mM HEPES (pH 7.5), 2 mM EDTA, 250 mM NaCl, 0.3% Nonidet P-40, 1x protease inhibitor cocktail (Pierce), and 1x phosphatase inhibitor cocktail (Pierce). Samples were kept on ice for 15 min and centrifuged at 14,000 rpm for 2 min. Appropriate aliquots were used to determine the protein concentration of the samples by measurement of its absorbance at 595 nm in the presence of Bio-Rad protein assay reagent, and BSA was used as protein standard.
EMSA. Hemidiaphragms were stretched in the direction of the muscle fibers for 15 min or as indicated, and nuclear extracts were prepared as previously described. 32P-labeled FOXO or Foxo1- and Foxo3a-specific consensus oligonucleotides were incubated with 10–15 µg of nuclear extract for 20 min at room temperature in binding buffer [25 mM HEPES (pH 7.9), 0.5 mM EDTA, 0.5 mM dithiothreitol, 1% Nonidet P-40, 5% glycerol, and 50 mM NaCl]. DNA-protein complexes were separated in a 5% native polyacrylamide gel that had been prerun for 30 min. Radioactive bands were visualized and quantitated after overnight exposure in a PhosphorImager (Molecular Dynamics, Sunnyvale, CA) using Image Quant software. The specificity of the DNA binding was assessed by completion of the reaction with a fivefold excess of the corresponding specific oligonucleotide and the same excess of a mutated version lacking the sequence recognized by FOXO. DNA-binding activity was calculated by establishing that 1 arbitrary unit was equal to the measurement obtained for the specific 32P-labeled band corresponding to the young nonstretched diaphragm.
Western blots. Protein samples were subjected to 10% SDS-PAGE and transferred to nitrocellulose membranes with a semidry transfer cell (Bio-Rad) for 30 min at 10 V. Membranes were stained with Ponceau S (Sigma) to assess equal loading, blocked in 5% nonfat dry milk (blotting-grade blocker, Bio-Rad) in 1% Tween in PBS, and exposed to proper dilutions of primary antibody in 5% milk-1% Tween in PBS for 3 h at room temperature or overnight at 4°C. Immunoreactive bands were detected with horseradish peroxidase-conjugated secondary antibodies and a bioluminescent assay for peroxidase (ECL, Amersham).
Statistical analysis. All experiments were repeated three times unless otherwise indicated. Values are means ± SD. For statistical analysis, Student's t-test or ANOVA was used to compare quantitative data populations with normal distribution and equal variance. P < 0.05 was considered statistically significant. Linear regression analysis was used for JNK activation with age.
| RESULTS |
|---|
|
|
|---|
|
52% of its initial peak compared with the diaphragm from the 2-yr-old animal, which relaxed to
63% of its peak tension. The mean steady-state ER is shown in Fig. 2B. Although ER of the diaphragms from 2-mo-old mice was smaller than that from 1- or 2-yr-old animals, the differences were not significant: 0.52705 ± 0.0649 for 2-mo-old (n = 2), 0.620 ± 0.034 for 1-yr-old (n = 3), and 0.639 ± 0.0175 for 2-yr-old (n = 4) mice (P = 0.19). These data are consistent with data in Fig. 1A showing that muscle passive stiffness is higher in 2-yr-old than 2-mo-old mice.
|
|
40-kDa band in cytoplasmic fractions that peaks at 30 min of stretch (not shown), which suggests that the phosphorylated forms of FOXO are promptly degraded. The effect of 15 min of stretch on Akt and IKK activation was assessed by determination of the content of its phosphorylated forms. The content of phosphorylated Akt and IKKs changes dramatically in response to mechanical stretch, but the content of total Akt and IKKs does not (Fig. 4C).
|
|
|
(16). To evaluate the effect of JNK activity on FOXO, we explored the impact of JNK inhibition on total FOXO activity and the nuclear content of Foxo4 in diaphragms from young and old mice and in response to mechanical stretch. Inhibition of JNK activity had no effect on FOXO activity in young mice but altered the DNA-binding activity of FOXO in diaphragms of 2-yr-old animals independently of stretch (Fig. 7, A and B). It also affects the nuclear content of Foxo4 in diaphragms from old mice (Fig. 7D); the detection of bands of smaller molecules by the Foxo4 antibody suggests that Foxo4 is proteolyzed in the nuclei when JNK is inhibited. To assess JNK activation in response to mechanical stress in diaphragms from mice at different ages, we measured the content of the activated phosphorylated forms of JNK1 (p46) and JNK2 (p54). As shown in Fig. 7, C, E, and F, age and JNK1 activity are strongly correlated. In response to stretch, significant changes in JNK activation were observed only for JNK2 in the diaphragms of younger mice.
|
| DISCUSSION |
|---|
|
|
|---|
The FOXO transcription factors are well-known targets of Akt signaling (for review see Refs. 5, 9, 10). Other investigators have established that the PI3K-Akt pathway is a mechanosensitive signaling pathway in several cell types, including the diaphragm muscle (13, 19, 23, 49), but the response of FOXO to mechanical stimuli has been barely explored and only reported in cardiomyocytes (45) and gingival fibroblasts (14). We previously reported that IKKs are activated in response to mechanical stimuli in the diaphragm muscle (32). Data from the present study reveal that mechanically induced IKK also contributes to the downregulation of FOXO by stretch. Interestingly, the mechanosensitivity of these two kinases is affected in a similar way with aging. Akt and IKKs lose the ability to be activated in response to mechanical stretch. More precisely, our data show a clear stretch-dependent activation in the diaphragm from young mice that is essentially lost in muscles from 1-yr-old mice. Akt can be localized to the nuclei, and IKK is basically cytoplasmic; these findings imply that Akt-phosphorylated FOXO is translocated to the cytoplasm, where it is phosphorylated by IKK. In this case, the stretch-dependent translocation of FOXO from the nuclei could be easily reversed in the absence of IKK activity, as inhibition of IKK is sufficient to completely restore FOXO basal activity. Although we were unable to detect the phosphorylated species of FOXO in the cytoplasm, phosphorylation-specific antibodies recognized lower-molecular-weight bands (not shown), suggesting that they are promptly degraded in this compartment. Whether Akt and IKK are acting sequentially, our results clearly established that Akt and IKK are necessary for the stretch-dependent inactivation of the FOXO factors, as the inhibition of Akt or IKK resulted in a lack of regulation of the FOXO transcription factors in response to mechanical stretch.
Altered mechanical properties of the aging diaphragm have been reported by others in rats and correlated with changes in the extracellular matrix components with increased cross-linking and higher content of intramuscular collagen (12, 20). Our results demonstrated clearly that aging of the mouse diaphragm caused loss of muscle compliance and reduction in stress relaxation in the direction of the muscle fibers. These observations correlated with changes in mechanoresponsiveness of the Akt and IKK signaling pathways with aging. Therefore, we speculate that the increase in muscle stiffness associated with aging could be responsible for the lack of response of the Akt and IKK pathways to mechanical stimuli. In addition, the increase in basal activation of Akt and IKKs and, consequently, lower nuclear content of Foxo1 and Foxo3a observed in diaphragms from the old animals may be consistent with continued in vivo mechanical loading of the diaphragm. The observation that Foxo1 and Foxo3a nuclear levels were not altered by aging in a less active muscle, such as the soleus (unpublished data), supports this idea. However, it is important to recognize that other physiological changes occurring with skeletal muscle aging may play a role in modulating these signaling pathways.
Another interesting observation is the distinct behavior of the FOXO isoforms in response to mechanical stretch and aging. In both conditions, activation of Akt is responsible for Foxo1 and Foxo3a exclusion from the nuclei, whereas Foxo4 nuclear content remains unaffected. Foxo4 has been reported to be modulated by Akt in other tissues by cytoplasmic translocation of the phosphorylated species (30, 47). In contrast, phosphorylation by JNK determines Foxo4 nuclear localization and activation (39). We were unable to detect the Akt-phosphorylated form of Foxo4 (data not shown); therefore, it is probable that Foxo4 is not controlled by Akt in the mouse diaphragm. Another possible explanation is that activation of JNK2 by mechanical stretch in young diaphragms opposes the effect of Akt activation on Foxo4 localization. However, inhibition of JNK caused a nonsignificant decrease in the nuclear content of Foxo4 in response to mechanical stretch in young mice.
As summarized in Fig. 8, in the young mouse, Akt activation by mechanical stress promotes Foxo1 and Foxo3a exclusion from the nuclei, which correlates with the observed downregulation of the FOXO transcriptional activity. In the cytoplasm, Foxo1 and Foxo3a are phosphorylated by IKK and further degraded. Foxo4 nuclear content remains unchanged, possibly as the result of the counteractive effect of JNK activation by mechanical stimuli. On the other hand, in the older animal, the mechanosensitivity of all the pathways controlling FOXO is lost at an early age. Compared with young diaphragms, there is an increase in basal activities of Akt and IKK, which results in lower nuclear content and activity of Foxo1 and Foxo3a. However, FOXO transcriptional activity remained at levels comparable to those of the young mice because of activation of JNK activity, which maintained Foxo4 nuclear content by protecting it from degradation.
|
In summary, our study supports the hypothesis that aging alters the mechanical properties of the respiratory pump. This hypothesis is associated with altered regulation of the signaling pathways controlling FOXO activities. Our study provides the first experimental evidence that two distinct signaling mechanisms are responsible for the mechanical regulation of the FOXO transcription factors in the young and old respiratory pump, with different effects on the three members of the FOXO family.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Bennet BL, Sasaki DT, Murray BW, O' Leary EC, Sakata ST, Xu W, Leisten JC, Motiwala A, Pierce S, Satoh Y, Bhagwat SS, Manning AM, Anderson DW. SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci USA 98: 13681–13686, 2001.
3. Biggs WH 3rd, Cavenee WK, Arden KA. Identification and characterization of members of the FKHR (FOX O) subclass of winged-helix transcription factors in the mouse. Mamm Genome 12: 416–425, 2001.[CrossRef][Web of Science][Medline]
4. Biggs WH, Meisenhelder J, Hunter T, Cavenee WK, Arden KC. Protein kinase B/Akt-mediated phosphorylation promotes nuclear exclusion of the winged helix transcription factor FKHR1. Proc Natl Acad Sci USA 96: 7421–7426, 1999.
5. Birkenkamp KU, Coffer PJ. Regulation of cell survival and proliferation by the FOXO (forkhead box, class O) subfamily of forkhead transcription factors. Biochem Soc Trans 31: 292–297, 2003.[Web of Science][Medline]
6. Bois PR, Grosveld GC. FKHR (FOXO1a) is required for myotube fusion of primary mouse myoblasts. EMBO J 22: 1147–1157, 2003.[CrossRef][Web of Science][Medline]
7. Boriek AM, Capetanaki Y, Hwang W, Officer T, Badshah M, Rodarte J, Tidball JG. Desmin integrates the three-dimensional mechanical properties of muscles. Am J Physiol Cell Physiol 280: C46–C52, 2001.
8. Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, Anderson MJ, Arden KC, Blenis J, Greenberg ME. Akt promotes cell survival by phosphorylating and inhibiting a forkhead transcription factor. Cell 96: 857–868, 1999.[CrossRef][Web of Science][Medline]
9. Burgering BM, Cops GJ. Cell cycle and death control: long live forkheads. Trends Biochem Sci 27: 352–360, 2002.[CrossRef][Web of Science][Medline]
10. Burgering BM, Medema RH. Decisions on life and death: FOXO forkhead transcription factors are in command when PKB/Akt is off duty. J Leukoc Biol 73: 689–671, 2003.
11. Clavel S, Coldefy AS, Kurkdjian E, Salles J, Margaritis I, Derijard B. Atrophy-related ubiquitin ligases, atrogin-1, and MuRF1 are up-regulated in aged rat tibialis anterior muscle. Mech Aging Dev 127: 794–801, 2006.[CrossRef][Medline]
12. Criswell DS, Powers SK, Herb RA, Dodd SL. Mechanism of specific force deficit in the senescent rat diaphragm. Respir Physiol 107: 149–155, 1997.[CrossRef][Web of Science][Medline]
13. Danciu TE, Adam RM, Naruse K, Freeman MR, Hauschka PV. Calcium regulates the PI3K-Akt pathway in stretched osteoblasts. FEBS Lett 536: 193–197, 2003.[CrossRef][Web of Science][Medline]
14. Danciu TE, Gagari E, Adam RM, Damoulis PD, Freeman MR. Mechanical strain delivers anti-apoptotic and proliferative signals to gingival fibroblasts. J Dent Res 83: 596–601, 2004.
15. Edstrom E, Altun M, Hagglund M, Ulfhake B. Atrogin-1/MAFbx and MuRF1 are downregulated in aging-related loss of skeletal muscle. J Gerontol A Biol Sci Med Sci 61A: 663–674, 2006.
16. Essers MA, Weijzen S, de Vries-Smits AM, Saarloos I, de Ruiter ND, Bos JL, Burgering BM. FOXO transcription factor activation by oxidative stress mediated by the small GTPase Ral and JNK. EMBO J 23: 4802–48012, 2004.[CrossRef][Web of Science][Medline]
17. Fung YC. Biomechanics: Mechanical Properties of Living Tissues. New York: Springer-Verlag, 1993.
18. Furuyama T, Yamashita H, Kitayama K, Higami Y, Shimokawa I, Mori N. Effects of aging and caloric restriction on the gene expression of Foxo1, 3, and 4 (FKHR, FKHRL1, and AFX) in the rat skeletal muscles. Microsc Res Tech 59: 331–334, 2002.[CrossRef][Web of Science][Medline]
19. Garcia-Cardena G, Anderson KR, Mauri L, Gimbrone M Jr. Distinct mechanical stimuli differentially regulate the PI3K/Akt survival pathway in endothelial cells. Ann NY Acad Sci 902: 294–297, 2000.[Web of Science][Medline]
20. Gosselin LE, Martinez DA, Vailas AC, Sieck GC. Passive length-force properties of senescent diaphragm: relationship with collagen characteristics. J Appl Physiol 76: 2680–2685, 1994.
21. Greer EL, Brunet A. FOXO transcription factors at the interface between longevity and tumor suppression. Oncogene 24: 7410–7425, 2005.[CrossRef][Web of Science][Medline]
22. Guo S, Rena G, Cichy S, He X, Cohen P, Unterman T. Phosphorylation of serine 256 by protein kinase B disrupts transactivation by FKHR and mediates effects of insulin on insulin-like growth factor-binding protein-1 promoter activity through a conserved insulin response sequence. J Biol Chem 274: 17184–17192, 1999.
23. Hornberger TA, Stuppard R, Conley KE, Fedele MJ, Fiorotto ML, Chin ER, Esser KA. Mechanical stimuli regulate rapamycin-sensitive signalling by a phosphoinositide 3-kinase-, protein kinase B- and growth factor-independent mechanism. Biochem J 380: 795–804, 2004.[CrossRef][Web of Science][Medline]
24. Hribal ML, Nakae J, Kitamura T, Shuttler JR, Accili D. Regulation of insulin-like growth factor-dependent myoblast differentiation by Foxo forkhead transcription factors. J Cell Biol 162: 533–541, 2003.
25. Hu MC, Lee DF, Xia W, Golfman LS, Ou-Yang F, Yang JY, Zou Y, Bao S, Hanada N, Saso H, Kobayashi R, Hung MC. I
B kinase promotes tumorigenesis through inhibition of forkhead FOXO3a. Cell 117: 225–237, 2004.[CrossRef][Web of Science][Medline]
26. Jacobs FM, van der Heide LP, Wijchers PJ, Burbach JP, Hoekman MF, Smidt MP. Foxo6, a novel member of the Foxo class of transcription factors with distinct shuttling dynamics. J Biol Chem 278: 35959–35967, 2003.
27. Kamei Y, Miura S, Susuki M, Kay Y, Mizukami J, Taniguchi T, Mochida K, Hata T, Matsuda J, Aburatani H, Nishino I, Ezaki O. Skeletal muscle FOXO1 (FKHR) transgenic mice have less skeletal muscle mass, down-regulated type I (slow twitch/red muscle) fiber genes, and impaired glycemic control. J Biol Chem 279: 41114–41123, 2004.
28. Kau TR, Schroeder F, Ramaswamy S, Wojciechowski CL, Zhao JJ, Roberts TM, Clardy J, Sellers WR. A chemical genetic screen identifies inhibitors of regulated nuclear export of a forkhead transcription factor in PTEN-deficient tumor cells. Cancer Cell 4: 463–476, 2003.[CrossRef][Web of Science][Medline]
29. Kishore N, Sommers C, Mathialagna S, Guzova J, Yao M, Hauser S, Hynh K, Bonar S, Mielke C, Albee L, Weier R, Graneto M, Hanau C, Perry T, Tripp CS. A selective IKK-2 inhibitor blocks NF-
B-dependent gene expression in interleukin-1β-stimulated synovial fibroblasts. J Biol Chem 278: 32861–32871, 2003.
30. Kops GJP, de Ruiter ND, DeVries-Smits AM, Powell DR, Bos JL, Burgering BM. Direct control of the forkhead transcription factor AFX by protein kinase B. Nature 398: 630–634, 1999.[CrossRef][Medline]
31. Kumar A, Boriek AM. Mechanical stress activates the nuclear factor-
B pathway in skeletal muscle fibers: a possible role in Duchenne muscular dystrophy. FASEB J 17: 386–396, 2003.
32. Latress E, Amini AR, Amini AA, Griffiths J, Martin AJ, Wei Y, Lin HC, Yancopoulus GD, Glass DJ. Insulin-like growth factor-1 (IGF-1) inversely regulates atrophy-induced genes via the phosphatidylinositol 3-kinase/Akt/mammalian target of rapamycin (PI3K/Akt/mTOR) pathway. J Biol Chem 280: 2737–2744, 2005.
33. Lopez MA, Mayer U, Hwang W, Taylor T, Hashmi MA, Jannapureddy SR, Boriek AM. Force transmission, compliance, and viscoelasticity are altered in the
7-integrin-null mouse diaphragm. Am J Physiol Cell Physiol 288: C282–C289, 2005.
34. Morris BJ. A forkhead in the road to longevity: the molecular basis of lifespan becomes clearer. J Hypertens 23: 1285–1309, 2005.[Web of Science][Medline]
35. Murakami S. Stress resistance in long-lived mouse models. Exp Gerontol 41: 1014–1019, 2006.[CrossRef][Web of Science][Medline]
36. Nave BT, Owens M, Withers DJ, Alesse DR, Shepherd PR. Mammalian target of rapamycin is a direct target for protein kinase B: identification of a convergence point for opposing effects of insulin and amino-acid deficiency on protein translation. Biochem J 344: 427–431, 1999.[CrossRef][Web of Science][Medline]
37. Okada T, Kawano Y, Sakakibara T, Hazeki O, Ui M. Blockage of chemotactic peptide-induced stimulation of neutrophils by wortmannin as a result of selective inhibition of phosphatidylinositol 3-kinase. J Biol Chem 269: 3568–3573, 1994.
38. Pallafacchina G, Calabria E, Serrano AL, Kalhovde JM, Schiaffino S. A protein kinase B-dependent and rapamycin-sensitive pathway controls skeletal muscle growth but not fiber type specification. Proc Natl Acad Sci USA 99: 9213–9218, 2002.
39. Pierrou S, Hellqvist M, Samuelsson L, Enerback S, Carlsson P. Cloning and characterization of seven human forkhead proteins: binding site specificity and DNA bending. EMBO J 13: 5002–5012, 1994.[Web of Science][Medline]
40. Reynolds TH 4th, Bodine SC, Laurence JC Jr. Control of Ser2448 phosphorylation in the mammalian target of rapamycin by insulin and skeletal muscle load. J Biol Chem 277: 17657–17662, 2002.
41. Rommel C, Bodine SC, Clarke BA, Rossman R, Nunez L, Stitt TN, Yancopouos GD, Glass DJ. Mediation of IGF-1-induced skeletal myotube hypertrophy by PI3K/Akt/mTOR and PI3K/Akt/GSK3 pathways. Nat Cell Biol 3: 1009–1013, 2001.[CrossRef][Web of Science][Medline]
42. Sakamoto K, Aschenbach WG, Hirschman MF, Goodyear LJ. Akt signaling in skeletal muscle: regulation by exercise and passive stretch. Am J Physiol Endocrinol Metab 285: E1081–E1088, 2003.
43. Sakamoto K, Aschenbach WG, Hirschman MF, Goodyear LJ. Contraction regulation of Akt in rat skeletal muscle. J Biol Chem 277: 11910–11917, 2002.
44. Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, Piccard A, Walsh K, Schiaffino S, Lecker SH, Goldberg A. Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell 117: 399–412, 2004.[CrossRef][Web of Science][Medline]
45. Skurk C, Yasuhiro I, Henrike M, Razegui P, Ichiro S, Sandri M, Sato K, Zeng L, Schiekofer S, Pimentel D, Lecker S, Taegtmeyer H, Goldberg AL, Walsh K. The Foxo3a transcription factor regulates myocyte size downstream of Akt signaling. J Biol Chem 280: 20814–20823, 2005.
46. Stitt TN, Drujan D, Clarke Ba Panaro F, Timofeyva Y, Kline WO, Gonzalez M, Yancoupoulos GD, Glas DJ. The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors. Mol Cell 14: 395–403, 2004.[CrossRef][Web of Science][Medline]
47. Takaishi H, Konishi H, Matsuzaki H, Ono Y, Shirai Y, Saito N, Kitamura T, Ogawa W, Kasuga M, Kikkawa U, Nishizuka Y. Regulation of nuclear translocation of forkhead transcription factor AFX by protein kinase B. Proc Natl Acad Sci USA 96: 11836–11841, 1999.
48. Thomson DM, Gordon SE. Impaired overload-induced muscle growth is associated with diminished translational signalling in aged rat fast-twitch skeletal muscle. J Physiol 574: 291–305, 2006.
49. Tian B, Lessan K, Kahm J, Kleidon J, Henke C. β1-Integrin regulates fibroblast viability during collagen matrix contraction through a phosphatidylinositol 3-kinase/Akt/protein kinase B signaling pathway. J Biol Chem 277: 24667–24675, 2002.
50. Tidball JG. Mechanical signal transduction in skeletal muscle growth and adaptation. J Appl Physiol 98: 1900–1908, 2005.
51. Turinsky J, Damran-Abney A. Akt kinases and 2-deoxyglucose uptake in rat skeletal muscles in vivo: study with insulin and exercise. Am J Physiol Regul Integr Comp Physiol 276: R277–R282, 1999.
52. Van der Heide LP, Hoekman MF, Smidt MP. The ins and outs of Foxo shuttling: mechanisms of Foxo translocation and transcriptional regulation. Biochem J 380: 297–309, 2004.[CrossRef][Web of Science][Medline]
53. Van der Heide LP, Jacobs FM, Burbach JP, Hoekman MF, Smidt MP. Foxo6 transcriptional activity is regulated by Thr26 and Ser184, independent of nucleo-cytoplasmic shuttling. Biochem J 391: 623–629, 2005.[CrossRef][Web of Science][Medline]
54. Whitman SA, Wacker MJ, Richmond SR, Godard MP. Contributions of the ubiquitin-proteasome pathway and apoptosis to human skeletal muscle wasting with age. Pflügers Arch 450: 437–446, 2005.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
E. Ochi, T. Hirose, K. Hiranuma, S.-K. Min, N. Ishii, and K. Nakazato Elevation of myostatin and FOXOs in prolonged muscular impairment induced by eccentric contractions in rat medial gastrocnemius muscle J Appl Physiol, February 1, 2010; 108(2): 306 - 313. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Cho, M. Fournier, X. Da, and M. I. Lewis Time course expression of Foxo transcription factors in skeletal muscle following corticosteroid administration J Appl Physiol, January 1, 2010; 108(1): 137 - 145. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |