|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS
1Cell Biophysics Group, 2Department of Pathology, and 3Department of Pharmacology and Toxicology, Boonshoft School of Medicine, Wright State University, Dayton, Ohio
Submitted 22 August 2007 ; accepted in final form 3 January 2008
| ABSTRACT |
|---|
|
|
|---|
90% of the total Rb influx occurred through the Na-K pump and NKCC and
10% through KCC and a residual leak. Hyposmotic media (150 mosM) decreased Kc by a 16-fold higher K permeability and cell water, but failed to inactivate NKCC and activate KCC. Sucrose replacement or extracellular K to >57 mM, but not Rb or Cs, in hyposmotic media prevented Kc and water loss. Rb influx equaled Kc loss, both blocked by clotrimazole (IC50
25 µM) and partially by 1-[(2-chlorophenyl) diphenylmethyl]-1H-pyrazole (TRAM-34) inhibitors of the IK channel KCa3.1 but not by other K channel or connexin hemichannel blockers. Of several anion channel blockers (dihydro-indenyl)oxy]alkanoic acid (DIOA), 4-2(butyl-6,7-dichloro-2-cyclopentylindan-1-on-5-yl)oxybutyric acid (DCPIB), and phloretin totally or partially inhibited Kc loss and Rb influx, respectively. RT-PCR and immunochemistry confirmed the presence of KCa3.1 channels, aside of the KCC1, KCC2, KCC3 and KCC4 isoforms. Apparently, IK channels, possibly in parallel with volume-sensitive outwardly rectifying Cl channels, effect regulatory volume decrease in LECs. K-Rb fluxes; KCa3.1 channels; volume regulation; Na-K-2Cl and K-Cl cotransport isoforms; reverse transcriptase polymerase chain reaction; immunochemistry
Hyposmotic swelling-induced RVD, studied foremost in red blood cells (30, 35), Ehrlich ascites tumor cells (25), human embryonic kidney (HEK) 293 cells (22), and a variety of other model systems, is due to activation of electrogenic and electroneutral K exit mechanisms such as K and Cl channels (24), K/H exchange (6, 8), K-Cl cotransport (KCC) (1), and organic solute transport (20) while RVI-mediating electroneutral Na-transporters, such as Na/H exchange (42) and Na-K-2Cl cotransport (NKCC) are silenced. Conversely, during RVI, the NKCC, Na/H exchange, amiloride-sensitive channels related to epithelial Na channels (ENaC), and unrelated amiloride-insensitive hypertonicity-induced cation channels (HICCs) (62), and organic solute transporters (20) are activated to restore ionic and solute homeostasis (31). The cell's volume set point (VSP) is defined thermodynamically as a state between RVD and RVI where conservatory and dissipating ion and solute transport activities balance each other and are at their lowest activity to maintain cellular steady state (35, 42).
Under isosmotic conditions, cultured rabbit and human LECs share a rather significant NKCC activity due to the secretory NKCC1 isoform associated with above-equilibrium Cl levels (4), whereas KCC can be only detected after chemical activation using the thiol reagent N-ethylmaleimide (NEM), which simultaneously inactivates NKCC (34). These findings lead to our hypothesis that the VSP in LECs may be shifted to higher osmolalities explaining a relatively increased NKCC and an attenuated KCC activity, a shift that should be remedied by hyposmotic swelling causing activation of KCC and inactivation of NKCC. To approach this question, it was necessary to first functionally and molecularly characterize the hitherto unknown ion transport mechanism underlying RVD in cultured human LECs.
Results show hyposmotic challenge of human LECs activated K loss and Rb entry through apparently intermediate conductance Ca-activated K channels (IK, KCa3.1), detected by reverse transcriptase polymerase chain reaction (RT-PCR), Western blot analyses, and immunohistochemistry. Accordingly, K loss was prevented by replacing external Na with K ions by clotrimazole (CTZ) and partially by 1-[(2-chlorophenyl) diphenylmethyl]-1H-pyrazole (TAM-34). Blockage by (dihydro-indenyl)oxy]alkanoic acid (DIOA), and phloretin and partial inhibition by high concentrations of 4-2(butyl-6,7-dichloro-2-cyclopentylindan-1-on-5-yl)oxybutyric acid (DCPIB), niflumic acid (NA), and 5-nitro-2-(3-phenyl-propylamino) benzoic acid (NPPB) suggest involvement of commensurate anion fluxes, possibly via volume-sensitive outward rectifying (VSOR) Cl channels.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Inhibitors. Ouabain, bumetanide, gadolinium-Cl (GdCl3), quinine, quinidine, DIDS, glibenclamide (Glb), 4-aminopyridine (4-AP), triethylammonium (TEA), apamin (AP), tamoxifen (TX), anthracene-9-carboxylate (9AC), 18β-glycerrethinic acid (GA), flufenamic acid (FA), NPPB, mibefradil (MF), octanol, DIOA, phloretin, DCIPB, 1-[(2-chlorophenyl) diphenylmethyl]-1H-pyrazole (TRAM-34), and clotrimazole (CTZ) were procured from Sigma Chemicals, furosemide was from Hoechst Roussel Pharmaceuticals (Somerville, NJ), niflumic acid (NA) was from Calbiochem, and Ba was from J. T. Baker (Phillipsburg, NJ).
Molecular and immunological tools. RNAgents Total RNA Isolation System was purchased from Promega (Madison, WI), ThermoScript RT-PCR System plus Platinum Taq DNA polymerase was from Invitrogen (Carlsbad, CA), and human primers were from Integrated DNA Technologies (Coralville, IA).
The Mem-PER protein extraction kit, Halt protease inhibitors cocktail, and PAGEprep protein clean up kit were from Pierce Biotechnology (Rockford, IL). A horseradish peroxidase (HRP)-coupled donkey anti-rb IgG (H+L) for Western blot analysis and a Cy3-labeled donkey anti-rb IgG for immunofluorescence were procured as secondary antibodies from Jackson Immunoresearch Laboratories (West Grove, PA), and fluorescein-labeled donkey anti-rb IgG secondary antibody was from Vector Laboratories (Burlingame, CA). Lumi-Light Western Blotting substrate was obtained from Roche Diagnostics (Indianapolis, IN), and Fujifilm Super RX autoradiography film was from Fisher Scientific (Fair Lawn, NJ).
Solutions and Media Balanced salt solution (BSS-NaCl) consisted of 20 mM HEPES-Tris buffer (pH 7.4) containing (in mM): 132 NaCl, 5 KCl, 2 CaCl2, 1 MgCl2, and 10 glucose. In BSS-NaNO3 and BSS-Na-Sf (sulfamate) media, NO3 or methyl-Sf, respectively, was substituted for Cl in K, Rb, and Na salts and gluconate in the Ca and Mg salts. BSS-NMDG-Cl or sulfamate contained NMDG-Cl or Sf substituting for Na on an equiosmolal basis. Stock solutions (in M) of 1 NEM, 2 x 10–1 ouabain, and 2 x 10–3 bumetanide were made in DMSO or ethanol, and all other chemical reagents were dissolved in deionized water. The 300 mosM washing solution contained 112 mM MgCl2 and 10 mM Tris-MOPS (pH 7.4) at 4°C. In general, in the experiments with lower osmolalities, sucrose was used as filler solute while keeping the ionic strength constant. Osmolalities were determined with an Advanced Micro-Osmometer, model 330 (Advanced Instruments, Norwood, MA). For convenience, throughout the text, but not in the figures, osmolality (osmol/kg H2O) was abbreviated as mosM, the term for milliosmolarity (mosM/l H2O) as the density of water is close to one.
Human Lens Epithelial Cell Cultures Primary human lens epithelial FHL124 cells were kindly donated by Professor John Reddan (Oakland University, MI). Their nature and relatedness to fresh human epithelial cells is emphasized in the first paragraph of RESULTS. Culture flasks were coated with liquefied 0.1–0.2 mg gelatin (G1393)/cm2 and subsequently dried for at least 2 h. Cells from passages 16–25 were grown on gelatin in a humidified atmosphere with 5% CO2 at 37°C in a 1:4 mixture of KGM (CC-3001) from Clonetics-BioWhittaker and medium 199 (M199, M5017) from Sigma, in the presence of antibiotics (50 µg gentamicin/ml M199; KGM comes complete with antibiotics) and 10% of a 1:1 mixture of heat-inactivated horse serum (Sigma H1138) and FBS (F4135), or 10% FBS. Cells were split after being rinsed with Ca-Mg-free phosphate-buffered saline (PBS, Sigma D8537). After being warmed to 37°C and addition of 1 ml trypsin-EDTA solution (T3924), cells were incubated at 37°C for 10 min, neutralized with 3–5 ml complete growth serum containing medium, and centrifuged for 3 min. The supernatants were discarded, and the cell pellets were resuspended to known volume for cell counting and seeded in gelatin-coated 12-well culture plates at required densities.
Ion Fluxes The general strategy, adapted from previous publications (2, 34), was to remove the culture media from the 12-well plates, wash the confluent LEC cultures with BSS-NaCl at 37°C, and equilibrate them with BSS-NaCl-BSA for 10 min at 37°C to permit manipulations needed to alter the transport rates such as replacing Cl with Sf or NO3, adding inhibitor or activator drugs like NEM, or preexposing the cells to BSS-NACl-BSA with different osmolalities. Thereafter, cells were exposed to the actual flux media, usually BSS-Rb/NaCl-BSA, BSS-Rb/NaSf-BSA, or BSS-Rb/NaNO3-BSA before commencement of Rb uptake and K loss usually during a period of 5–15 min. BSA (0.1%) was included to stabilize cells during washings. The contaminating presence of 184 µM Na did not affect the outcome of the experiments. Details deviating from these procedures will be addressed in the description of the experiments and are also noted in the figures. The K congener 85Rb has been shown in many publications to accurately substitute for K in these uptake measurements. In the basal studies, 10 mM Rb was used to maximize the signal and maintain a concentration close to the Km values for KCC as in previous studies (34), and Rb uptake and Kc loss were stopped by washing the cells with the ice-cold washing solution (see Solutions and Media). Ions were extracted with 5% perchloric acid and protein determined after being solubilized in 1 N NaOH using the bicinchonic acid (BCA) method. K was measured with a Na-K lamp and Rb by flame emission using a Perkin Elmer 5000 atomic absorption spectrophotometer (Norwalk, CT).
Operationally, as shown in earlier kinetic studies, Kc loss was measured from the cis (inside) to the trans side (outside), whereas Rb uptake was measured from the trans to the cis side in the absence of external K. Rb uptake or Kc loss are determined as nanomoles of ions per milligram protein as function of time (flux). The flux components are defined as follows: Total flux (1) is without any inhibitor, Na/K pump flux (2) = (1) minus flux in presence of 0.1 mM ouabain (3), NKCC (4) = (3) minus flux in presence of 10 µM bumetanide (5), KCC (6) = (4) in Cl minus (4) in Sf or NO3 media. K channel-mediated fluxes were measured in Cl or Sf/NO3 always in the presence of 0.1 mM ouabain and 10 µM bumetanide.
Cell Water Four 35-mm diameter gelatin-coated culture plates per condition were dried at 80°C until tare weight (TAW) constancy. FHL124 cells were then seeded onto these plates and grown to confluence, the growth medium was removed, the cells were washed with isosmotic BSS-NaCl-BSA and exposed for 15 min to BSS-Rb/NaCl-BSA or BSS-Rb/KCl-BSA flux media of different osmolalities (150 to 300 mosM, with sucrose filling the difference between the two values). Supernatants were quantitatively removed with a micropipette. Plates were immediately weighed for total weight (TOW) and then dried at 80°C for 48 h until weight constancy to obtain the wet weight (WWT = TOW – TAW). NaOH (1 ml, 1N/well) was added and the protein determined by the BCA method. The water content in microliter per milligram protein was calculated from the ratio of WWT per milligram protein per well.
Molecular Biology (RT-PCR) cDNA synthesis was performed with the Thermoscript RT-PCR system. Total RNA was isolated from FHL124 cells using RNAgents Total RNA extraction kit, as recommended by the manufacturer. After 5 µg of DNase digested RNA to random hexamer primers was annealed, cDNA was prepared using ThermoScript reverse transcriptase enzyme following the manufacturer's instructions. Briefly, RNA and primers were denatured by incubating at 65°C for 5 min and placed on ice. To the sample tube containing denatured RNA and primers, the following were added: 4 µl of 5x cDNA synthesis buffer, 1 µl 0.1 M dithiothreitol (DTT), 1 µl RNaseOUT (40 U/µl), 1 µl DEPC-treated water, and 1 µl ThermoScript RT (15 U/µl). The mixture was transferred to a thermal cycler preheated to the appropriate cDNA synthesis temperatures and conditions.
To verify the presence of calcium-activated K channels at the mRNA level, oligonucleotide primers were chosen against the human sequences of KCa3.1 (IK) channels: sense and anti-sense primers were TCTCAATCAAGTCCGCTTCC and AGCATGAGACTCCTTCCTGC, respectively, predicting a product of 457 bp. Human β-actin served as control. Two sets of primers were used to identify the presence of KCC isoforms as listed in Table 1. Products were then verified with ethidium bromide after 2% agarose gel electrophoresis.
|
Immunofluorescence Staining and Microscopy FHL-124 cells were plated on a Lab-Tek Chamber-Slide Culture Chambers (NUNC) at a density of 6 x 104 cells/well as previously described (40), simultaneously permeabilized and fixed in a freshly prepared 4% paraformaldehyde and 0.01% saponin solution for 30 min at 4°C, washed three times with PBS (0.5 ml/well) for 5 min each, incubated at 4°C for 1 h with a nonspecific blocking agent (3% normal goat serum in PBS), and then incubated overnight at 4°C with a 1:100-fold diluted primary antibody followed by the secondary antibody, a Cy3-conjugated donkey anti-rb IgG (1:250). Images were obtained with a Nikon Labophot epifluorescence microscope (Nikon) under a x10 objective using SPOT digital color camera (Diagnostic Instruments, Sterling Heights, MI) and analyzed using SPOT Advanced image analysis software (Diagnostic Instruments).
Statistical Analysis Unpaired or paired Student's t-tests and one-way ANOVA tests for multiple intergroup differences were calculated with STATISTIX 7 (Analytical Software, Talahasse, FL) and Origin (Originlab, Northampton, MA). P values are indicated in the figure legends, and P < 0.05 was considered statistically significant.
| RESULTS |
|---|
|
|
|---|
Basic K Influx Components The K uptake kinetics in FHL124 cells are unknown and were first established using Rb as K congener (32). Figure 1A shows the time course of Rb uptake in uninhibited (total), and in 0.1 mM ouabain, and ±5 µM bumetanide-treated LECs. Because Rb uptake was nonlinear, with a 5-min point closest to initial rates without compromising the Rb signal, Rb uptake was stopped at 5 min in most experiments, and Rb influx data were calculated in terms of nanomoles Rb per [milligram protein x 5 min].
|
Response of Major K in Flux Pathways to Hyposmotic Stress After equilibration of LECs for a total of 10 min in BSS-NaCl-BSA with osmolalities ranging from 300 to 150 mosM, total Rb influx, measured during subsequent 5 min in BSS-RbCl-NaCl-BSA media, increased significantly at 200 and 150 mosM (P < 0.05) as shown in Fig. 2A. This increase appeared to be due to a small but significant increase (P < 0.05) of the Na-K pump but even more to a doubling (P < 0.05) of the "leak" Rb influx in Cl media probably mediated by ion channels since the low activity of KCC was practically unaltered. Whereas KCC was not stimulated by hyposmotic swelling, NKCC activity, rather than being silenced as expected, increased significantly at 250 and 200 mosM, whereas at 150 mosM it fell to near the starting values at 300 mosM. To gain further insight into the time dependence of the response of NKCC to hyposmotic stress, Fig. 2B shows the bumetanide-sensitive (filled circles and squares) and Cl-dependent (open symbols) Rb influx through NKCC as well as KCC after 10- versus 30-min preincubation at decreasing extracellular osmolalities. The Cl-dependent NKCC activity (open symbols) was significantly higher than the bumetanide-sensitive NKCC (closed symbols) due to inclusion of the osmolality-independent Cl-dependent KCC seen at the bottom of Fig. 2B. It is readily apparent that significantly higher NKCC activities were obtained at 150 mosM after 30 min rather than after 10 min incubation. Since cell swelling in hyposmotic media should have inactivated NKCC and activated KCC, the data suggest these LECs already had completed RVD with ion loss and cell shrinkage greater after 30 min than after 10 min preequilibration, the apparent cause of the seemingly paradoxical activation of NKCC and lack of KCC response.
|
|
45%, and, as expected, was independent of Na-K pump and NKCC inhibitors present. By definition, the Kc loss in Sf minus that in Cl constitutes KCC activity (Fig. 4B, inset C), which was insignificantly small and osmolality independent. To decide whether osmolality or ionic strength or both were responsible for the K loss, Kc was measured after 15 min equilibration in 300 mosM full ionic strength and half ionic strength (sucrose replacement). Figure 5 shows that Kc was identical in isosmotic ± sucrose Cl flux media and was lowered by
43% only in 150 mosM hyposmotic media without sucrose, indicating that indeed, the Kc loss was due only to osmotic and not to low ionic stress. Results were similar in Sf, although Kc was somewhat, but not statistically significant, lower than in Cl.
|
|
10% as the osmolality and external K concentrations (numbers in parentheses are in mM) decreased (Fig. 6B, closed squares). Hence, the RVD was significantly attenuated (P < 0.005) in high K media, commensurate with involvement of a K channel.
|
) equals 1/ckK, the calculated
was 323 min, i.e., >5 h, for cells in isosmotic and only
20 min in hyposmotic solutions. Hence, swollen cells exchanged K at least 16 times faster than isosmotically suspended cells.
|
= 1/ki equal to 17 min, which is similar to that measured for Kc loss.
|
|
|
25 µM, in the presence of 0.1 mM ouabain ± 5 µM bumetanide in 150 mosM media but had no effect on the K loss in 300 mosM media (open symbols). Figure 10B shows that CTZ had no effect in 300 mosM media (open symbols), whereas it inhibited with high significance the swelling-induced Rb influx as a function of concentration, almost completely at 50 µM CTZ. Figure 11 shows that TRAM-34, a more recently recognized selective inhibitor of IK channels (63), reduced the loss of cell K in 150 mosM Cl or NO3 media (P < 0.005) at concentrations of 50 µM and higher while exerting weak, but significant, effects on Rb influx above 30 µM consistent with a partial and perhaps asymmetrical inhibition of the hyposmotically induced K/Rb flux.
|
|
Role of Anion Channels in Hyposmotically Induced K Loss by Putative IK Channels Several anion channel inhibitors such as DIDS, furosemide, TX, 9AC, and MF failed to block Kc loss (Table 2, experiments 5–10), although DIDS inhibited Rb influx in 150 mosM media by 32% (P < 0.005), an effect most likely due to inhibition of KCC-mediated influx (data not shown). However, DIOA abolished Kc loss (Fig. 12A) better in NO3 than in Cl media and highly significant (P < 0.005) at concentrations higher than 100 µM. This clearly means that DIOA did not inhibit a Cl-dependent K loss through KCC as recently shown in corneal epithelial cells (10). DIOA reduced Rb influx in hyposmotic Cl but appeared to stimulate in NO3, as shown in Fig. 12B, producing negative values as indicated by dCl (filled circles), again consistent with absence of an effect on the KCC mechanism.
|
13 and 25%, respectively, which is not much different from the nonsignificant 7 and 17%, respectively, in the earlier experiments 5 and 10. The observation that NA, NPPB, and furosemide enhanced Kc retention (experiment 79) in cells maintained in isosmotic media awaits further elucidation. In contrast, DCPIB reduced hyposmotic Kc loss by 61% at 50 µM (experiment 70).
|
|
75- and 50- and 37-kDa protein bands in the FHL124 cells (lanes 1 and 2) compared with the positive control of rat brain extract (lane 3). The sizes of the protein bands suggest that the larger molecular weight protein is commensurate with the approximate molecular weight of the IK channel based on the number of amino acids present in the native or cloned proteins (63), whereas the smaller peptides most likely constitute breakdown products.
|
| DISCUSSION |
|---|
|
|
|---|
Our study presents novel evidence for the presence of swelling-activated K channels mediating cell water loss and hence RVD (Figs. 4–8) not yet reported for human LECs. This increase in K membrane permeability was solely due to osmotic differences (Fig. 5) and was associated with commensurate cellular water loss (Fig. 6A), which at 150 mosM was about 30%, and hence somewhat smaller than the Kc loss seen in Fig. 4, probably due to the robust NKCC inward flux activity. The aggregate mean rates of Kc loss (ckK) (Fig. 7, A and B), indicated a >16-fold stimulation in hyposmotically challenged FHL124 cells compared with isosmotic controls, translating into apparent K permeability coefficients of about 4 x 10–5 and 5 x 10–4 cm/s, for 300 and 150 mosM, respectively. The estimated K permeability in isosmotic media is about one order of magnitude higher than that reported for bovine lenses (3 x 10–6 cm/s) using tracer K efflux measurements (11), which may be explained by the uncertainty in cell volume and surface area estimates as well as by species differences. The hyposmotically activated Rb influx and K loss as a function of time were quite similar (Fig. 8), which can be interpreted as due to the same process, namely K channel-mediated RVD. Whereas these flux studies do not assess opening and closing kinetics of individual channels, they constitute a macroscopic measure of various K channels, most likely IK channels, as well as of the process of RVD inactivation due to gradient dissipation and activation of NKCC inward flux by a variety of shrinkage-induced biochemical processes.
Voltage-gated (Kv) as well as Ca-activated (KCa) K channels have been studied by electrophysiological methods in human and animal LECs, especially BK channels (49), outward and inward rectifying K channels (46, 47), and electrically silent Kv channels (48, 51). To the best of our knowledge, there is no report yet available on the presence of RVD-mediating KCa3.1 (IK) channels in human LECs. However, there are several recent electrophysiological studies on the role of KCa3.1 channels in RVD of other mammalian cells such as in human T lymphocytes (29), human parotid gland cells (5, 55), human intestinal epithelial cells (60), human embryonic kidney (HEK293) cells (28), and mouse erythroleukemic cells (59).
Optical or Coulter counter-type volume measurements were used to study RVD, for example, in Ehrlich ascites cells (24), or in human corneal epithelial cells (10) and K fluxes to show NEM- and swelling-activated KCC in SV40-transformed mouse LECs (12). Our results suggest the quick onset of the K-channel-mediated RVD overrides the KCC activity in FHL124 cells. Only external K, but not Na, Rb nor Cs ions, reduced the ckK values in hyposmotic media (Fig. 9), which means that the flux of K through the RVD-mediating K channels obeyed the Ussing flux ratio equation (see RESULTS). Thus swelling of human lens epithelial cells activated K-selective channels but not nonselective cation channels as reported for other model systems (31, 62).
Neither typical inhibitors of Big conductance (BK), other voltage-gated K channels, Small conductance (SK) channels, nor known blockers of the connexin family were effective (Table 2) (15). Only CTZ with an approximate IC50 of 25 µM and completely at 50 µM prevented Kc loss (Fig. 10). This concentration range is comparable to published CTZ doses in other epithelial cell systems, with intermediate conductance KCa3.1 (IK) channels involved in RVD (29, 60). TRAM-34, an inhibitor of IK channels not involving the P450 protein like CTZ (56, 66), also reduced Kc loss by
50% and less Rb influx suggesting that the two inhibitors act through different mechanism either at the channel or regulatory level.
Like SK channels, IK channels are regulated by intracellular Ca ions (63). However, our preliminary studies addressing the external Ca dependence using media chelators such as EDTA were inconclusive suggesting intracellular Ca ions maybe at play during RVD, a commonly held notion. However, preliminary experiments with high (mM) concentrations of external Ni, an inhibitor of Ca-dependent RVD in renal epithelial cells (54), significantly reduced K loss (data not shown). It should also be noted that KCa channels may be strech activated and less by a detectable increase in intracellular Ca (21, 28). The possibility of external ATP activation of the RVD-mediating K channels, shown in other epithelial cells (23), was ruled out since no K loss occurred under isosmotic conditions in the presence of high (mM) ATP concentrations (data not shown).
The data presented in Figs. 4 and 8 show that the Cl permeability accompanying K efflux or Rb influx apparently was not rate limiting, as Cl replacement with Sf was without major macroscopic effect, in contrast to findings in other cell types (31). This finding may be attributed to the fact that, to maintain electroneutrality, Cl channels are also activated by cell swelling, in particular volume-sensitive outwardly rectifying (VSOR) Cl channels (41). Involvement of these VSOR Cl channels cannot be excluded since several blockers of VSOR either completely (DIOA), partially (phloretin, DCIPB), or barely (NA and NPPB) inhibited. The complexity of the use of DIOA can be appreciated in the fact that it inhibited hyposmotically activated Kc loss in LECs at similar concentrations blocking KCC in primary cultures of rat vascular smooth muscle cells (3), yet at some 10-fold greater concentrations than used for inhibition of human erythrocyte K-Cl cotransport (19). Phloretin, known to inhibit volume-sensitive and cAMP-activated but not Ca-activated Cl channels (17) on the other hand, inhibited >50% of Rb influx, reduced K loss by 30% in NO3, and stimulated K loss at highest concentrations in isosmotic media (Fig. 13). Phloretin is known to inhibit other cation and anion exchangers (14) as well as K channels (53) and hence cannot be considered a diagnostically specific drug. Thus, in comparison, the overall asymmetric inhibition by DIOA and phloretin and partial inhibition by DCIPB, NA, and NPPB suggest indirectly electroneutrality is maintained by swelling activation of presumably VSOR anion channels accompanying K fluxes through IK channels. Other Cl channels inhibited by DIDS, furosemide, TX, 9AC, and MF (see Table 2) are excluded since none of these drugs retarded Kc. loss. Clearly, a more detailed study of the biophysical, pharmacological, and molecular nature of the anion channel accompanying the apparent IK-channel-mediated RVD is warranted in future studies on LECs.
The RT-PCR, Western blot, and immunochemistry data in Figs. 14 and 15 show unequivocally that FHL124 cells possess KCa3.1 (IK) channels, accompanied by Cl fluxes perhaps through VSOR Cl channels (47, 49). Clearly identified by molecularly and immunological studies (data not shown), a functional role during RVD of other Ca-activated K channels, such as BK and SK1,2, and 3 channels, previously reported in human LECs, was excluded pharmacologically (Table 2).
In summary, the studies reported here shed light on basic mechanisms involved in the maintenance of human LEC VC. Understandably, these mechanisms may play crucial roles also in the LEC to LFC trans-differentiation, involving obliteration of intracellular organelles, reduction of cytoplasm, and maintenance of the plasma membrane with apparently altered passive K permeabilities not yet fully understood in terms of VC (43). In FHL124 cells, hyposmotically induced RVD was mediated primarily by IK channels putatively coupled to VSOR channels, a powerful mechanism to respond to osmotic challenge. RVD-mediated activation of NKCC1, the predominant isoform in LECs (4), most likely will offset swelling-triggered K loss through IK channels, and thus preserve VC by RVI if these cells would be returned to isosmotic media, a mechanism at play in volume recovery of hypertonically stressed corneal epithelial cells (10). The clinical significance of VC is underscored by an increased apamin-sensitive KCa2.3 (SK3) channel expression in human LECs from patients with myotonic dystrophy type 1 where osmotic perturbation could explain the associated higher occurrence of cataract in these patients (50). Another example of unexplored mechanisms is the observation that dehydration due to intestinal illnesses also correlates with a greater incidence of cataract (39).
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Adragna NC, Ferrell CM, Zhang J, Di Fulvio M, Temprana CF, Sharma A, Fyffe RE, Cool DR, Lauf PK. Signal transduction mechanisms of K+-Cl– cotransport regulation and relationship to disease. Acta Physiol (Oxf) 187: 125–139, 2006.[CrossRef][Medline]
3. Adragna NC, Zhang J, Di Fulvio M, Lincoln TM, Lauf PK. KCl cotransport regulation and protein kinase G in cultured vascular smooth muscle cells. J Membr Biol 187: 157–165, 2002.[CrossRef][Web of Science][Medline]
4. Alvarez L, Candia O, Turner H, Polikoff L. Localization of a Na(+)-K(+)-2Cl(-) cotransporter in the rabbit lens. Exp Eye Res 73: 669–680, 2001.[CrossRef][Web of Science][Medline]
5. Begenisich T, Nakamoto T, Ovitt CE, Nehrke K, Brugnara C, Alper SL, Melvin JE. Physiological roles of the intermediate conductance, Ca2+-activated potassium channel Kcnn4. J Biol Chem 279: 47681–47687, 2004.
6. Bonanno JA. Regulation of corneal epithelial intracellular pH. Optom Vis Sci 68: 682–686, 1991.[CrossRef][Web of Science][Medline]
7. Brugnara C, de Franceschi L, Alper SL. Inhibition of Ca(2+)-dependent K+ transport and cell dehydration in sickle erythrocytes by clotrimazole and other imidazole derivatives. J Clin Invest 92: 520–526, 1993.[Web of Science][Medline]
8. Cala PM. Volume regulation by Amphiuma red blood cells: characteristics of volume-sensitive K+/H+ and Na+/H+ exchange. Mol Physiol 8: 199–214, 1985.
9. Candia O. Electrolyte and fluid transport across corneal, conjunctival and lens epithelial cells. Exp Eye Res 78: 527–535, 2004.[CrossRef][Web of Science][Medline]
10. Capó-Aponte JE, Iserovich P, Reinach PS. Characterization of regulatory volume behavior by flourescence quenching in human corneal epithelial cells. J Membr Biol 207: 11–22, 2006.[Web of Science]
11. Delamere NA, Duncan G. A comparison of ion concentrations, potentials and conductances of amphibian, bovine, and cephalopod lenses. J Physiol 272: 167–186, 1977.
12. Diecke FPJ, Beyer M, A. A mechanism for regulatory volume decrease in cultured lens epithelial cells. Curr Eye Res 16: 279–288, 1997.[CrossRef][Web of Science][Medline]
13. Eldred JA, Sanderson J, Wormstone M, Reddan JR, Duncan G. Stress-induced ATP release from and growth modulation of human lens and retinal pigment epithelial cells. Biochem Soc Trans 31: 1213–1215, 2003.[Web of Science][Medline]
14. Elmariah S, Gunn RB. Kinetic evidence that the Na-PO4 cotransporter is the molecular mechanism for Na/Li exchange in human red blood cells. Am J Physiol Cell Physiol 285: C446–C456, 2003.
15. Eskandari S, Zampighi GA, Leung DW, Wright EM, Loo DDF. Inhibition of gap junction hemichannels by chloride channel blockers. J Membr Biol 185: 93–102, 2002.[CrossRef][Web of Science][Medline]
16. Eveloff JL, Warnock DG. Activation of ion transport systems during cell volume regulation. Am J Physiol Renal Fluid Electrolyte Physiol 252: F1–F10, 1987.
17. Fan HT, Morishima S, Kida H, Okada Y. Phloretin differntially inhibits volume-sensitive and cyclic AMP-activated, but not Ca-activated, Cl– channels. Br J Pharmacol 133: 1096–1106, 2001.[CrossRef][Web of Science][Medline]
18. Fischbarg J, Diecke F, Kuang K, Yu B, Kang F, Iserovich P, Li Y, Rosskothen H, Koniarek J. Transport of fluid by lens epithelium. Am J Physiol Cell Physiol 276: C548–C557, 1999.
19. Garay RP, Nazaret C, Hannaert PA, Cragoe EJ Jr. Demonstration of a [K+, Cl-]-cotransport system in human red cells by its sensitivity to [(dihydroindenyl)oxy] alkanoic acids: regulation of cell swelling and distinction from the bumetanide-sensitive [Na+, K+, Cl-]-cotransport system. Mol Pharmacol 33: 696–701, 1988.[Abstract]
20. Garcia-Perez A, Burg MB. Role of organic osmolytes in adaptation of renal cells to high osmolality. J Membr Biol 119: 1–136, 1991.[CrossRef][Web of Science][Medline]
21. Gasull X, Ferrer E, Llobet A, Castellano A, Nicolas JM, Pales J, Gual A. Cell membrane stretch modulates the high-conductance Ca2+-activated K+ channel in bovine trabecular meshwork cells. Invest Ophthalmol Vis Sci 44: 706–714, 2003.
22. Gillen CM, Forbush BI. Functional interaction of the K-Cl cotransporter (KCC1) with the Na-K-Cl cotransporter in HEK-293 cells. Am J Physiol Cell Physiol 276: C328–C336, 1999.
23. Hara N, Ichinose M, Sawada M, Imai K, Maeno T. Activation of single Ca2+-dependent K+ channel by external ATP in mouse macrophages. FEBS Lett 267: 281–284, 1990.[CrossRef][Web of Science][Medline]
24. Hoffmann EK, Simonsen LO, Lambert IH. Volume-induced increase of K+ and Cl– permeabilities in Ehrlich ascites tumor cells. Role of internal Ca2+. J Membr Biol 18: 211–222, 1984.
25. Hoffmann EK, Ussing HH. Membrane mechanisms in volume regulation in vertebrate cells and epithelia. In: Membrane Transport in Biology, edited by Giebisch GH, Schaefer J, Ussing HH, and Kristensen P, 2004, p. 317–399.
26. James C, Collison DJ, Duncan G. Characterization and functional activity of thrombin receptors in the human lens. Invest Ophthalmol Vis Sci 46: 925–932, 2005.
27. Jennings M, Al-Rohil N. Kinetics of activation and inactivation of swelling-induced K+/Cl– cotransport volume sensitive parameter is the rate constant for inactivation. J Gen Physiol 95: 1021–1040, 1990.
28. Jorgensen NK, Pedersen SF, Rasmussen HB, Grunnet M, Klaerke DA, Oleson SP. Cell swelling activates cloned Ca2+-activated K+ channels: a role for the F-actin cytoskeleton. Biochim Biophys Acta 1615: 115–125, 2003.[Medline]
29. Khanna R, Chang MC, Joiner WJ, Kaczmarek LK, Schlichter LC. hSK4/hIK1, a calmodulin-binding Kca channel in human T lymphocytes: roles in proliferation and volume regulation. J Biol Chem 274: 14838–14849, 1999.
30. Kregenow FM. Osmoregulatory salt transporting mechanisms: control of cell volume in anistonic media. Annu Rev Physiol 43: 493–505, 1981.[CrossRef][Web of Science][Medline]
31. Lang F, Busch GL, Ritter M, Volki H, Waldegger S, Gulbins E, Haussinger D. Functional significance of cell volume regulatory mechanisms. Physiol Rev 78: 247–306, 1998.
32. Lauf PK. Thiol stimulated passive K/Cl transport in sheep red cells. I. Dependence on chloride and external K+ (Rb+) ions. J Membr Biol 73: 237–246, 1983.[CrossRef][Web of Science][Medline]
33. Lauf PK, Adragna NC. K-Cl cotransport: properties and molecular mechanism. Cell Physiol Biochem 10: 341–354, 2000.[CrossRef][Web of Science][Medline]
34. Lauf PK, Warwar R, Brown TL, Adragna NC. Regulation of potassium transport in human lens epithelial cells. Exp Eye Res 82: 55–64, 2006.[CrossRef][Web of Science][Medline]
35. Lytle C, McManus T. Coordinate modulation of Na-K-2Cl cotransport and K-Cl cotransport by cell volume and chloride. Am J Physiol Cell Physiol 283: C1422–C1431, 2002.
36. Maher AD, Kuchel PW. The Gárdos Channel: a Review of the Ca2+-activated K+ channel in human erythrocytes. Int J Biochem Cell Biol 35: 1182–1197, 2003.[CrossRef][Web of Science][Medline]
37. Marcantonio J, Reddan J. TGFb2 influences alpha5-beta 1 integrin distribution in human lens cells. Exp Eye Res 79: 437–442, 2004.[CrossRef][Web of Science][Medline]
38. Mathias R, Rae J. The lens: local transport and global transparency. Exp Eye Res 78: 689–698, 2004.[CrossRef][Web of Science][Medline]
39. Minassian DC, Mehra V, Jones BR. Dehydrational crises from severe diarrhoea or heatstroke and risk of cataract. Lancet 1: 751–753, 1984.[Web of Science][Medline]
40. Misri S, Chimote A, Adragna NC, Warwar R, Brown T, Lauf PK. KCC isoforms in a human lens epithelial cell line (B3) and lens tissue extracts. Exp Eye Res 83: 1287–1294, 2006.[CrossRef][Web of Science][Medline]
41. Okada Y. Cell volume-sensitive chloride channels: phenotypic properties and molecular identity. In: Mechanisms and Signifigance of Cell Volume Regulation (1st ed), edited by Lang F. Basel: Karger, 2006, p. 9–24.
42. Parker JC. Volume-activated cation transport in dog red cells: detection and transduction of the volume stimulus. Comp Biochem Physiol A 102: 615–618, 1992.[Medline]
43. Parmelee JT, Beebe DC. Decreased membrane permeability to potassium is responsible for the cell volume increases that drives lens fiber cell elongation. J Cell Physiol 134: 491–496, 1988.[CrossRef][Web of Science][Medline]
44. Paterson C, Delamere N. ATPases and lens ion balance. Exp Eye Res 78: 699–703, 2004.[CrossRef][Web of Science][Medline]
45. Payne JA, Stevenson TJ, Donaldson LF. Molecular characterization of a putative K-Cl cotransporter in rat brain. J Biol Chem 271: 16245–16252, 1996.
46. Rae JL. Outwardly rectifying potassium currents in lens epithelial cell membranes. Curr Eye Res 13: 679–686, 1994.[Web of Science][Medline]
47. Rae JL, Shepard AR. Inwardly rectifying potassium channels in lens epithelium are from the IRK1 (Kir 2.1) family. Exp Eye Res 66: 347–359, 1998.[CrossRef][Web of Science][Medline]
48. Rae JL, Shepard AR. Kv33 potassium channels in lens epithelial and corneal endothelium. Exp Eye Res 70: 339–348, 2000.[CrossRef][Web of Science][Medline]
49. Rae JL, Shepard AR. Molecular biology and electrophysiology of calcium-activated potassium channels from lens epithelium. Curr Eye Res 17: 264–275, 1998.[CrossRef][Web of Science][Medline]
50. Rhodes JD, Monckton DG, McAbney JP, Prescott AR, Duncan G. Increased SK3 expression in DM1 lens cells leads to impaired growth through a greater calcium-induced fragility. Hum Mol Genet 15: 3559–3568, 2006.
51. Shepard AR, Rae JL. Electrically silent potassium channel subunits form human lens epithelium. Am J Physiol Cell Physiol 277: C412–C424, 1999.
52. Simard CF, Bergeron MJ, Frenette-Cotton R, Carpentier GA, Pelchat ME, Caron L, Isenring P. Homooligomeric and heterooligomeric associations between K+-Cl- cotransporter isoforms and between K+-Cl- and Na+-K+-Cl- cotransporters. J Biol Chem 282: 18083–18093, 2007.
53. Spires S, Begenisich T. Pharmacological and kinetic analysis of K channel gating currents. J Gen Physiol 93: 263–283, 1989.
54. Terreros DA, Knight JA, Ashwood ER. Nickel inhibition of the osmotic-sensitive ionic cellular channels. Ann Clin Lab Sci 18: 444–450, 1988.[Abstract]
55. Thompson J, Begenisich T. Membrane-delimited inhibition of maxi-K channel activity by the intermediate conductance Ca2+-activated K channel. J Gen Physiol 127: 159–169, 2006.
56. Turan VK, Mishin VM, Thomas PE. Clotrimazole is a selective and potent inhibitor of rat cytochrome P450 3A subfamily-related testosterone metabolism. Drug Metab Dispos 29: 837–842, 2001.
57. Ussing HH. Interpretation of tracer fluxes. In: Membrane Transport in Biology: Concepts and Models, edited by Tosteson DC. New York: Springer Verlag, 1978, p. 537.
58. Uvarov P, Ludwig A, Markkanen M, Pruunsild P, Kaila K, Delpire E, Timmusk T, Rivera C, Airaksinen MS. A novel N-terminal isoform of the neuron-specific K-Cl cotransporter KCC2. J Biol Chem 282: 30570–30576, 2007.
59. Vandorpe DH, Shmukler BE, Jiang L, Lim B, Maylie J, Adelman JP, de Franceschi L, Cappellini MD, Brugnara C, Alper SL. cDNA cloning and functional characterization of the mouse Ca2+-gated K+ channel, mIK1. Roles in regulatory volume decrease and erythroid differentiation. J Biol Chem 273: 21542–21553, 1998.
60. Wang J, Morishima S, Okada Y. IK channels are involved in the regulatory volume decrease in human epithelial cells. Am J Physiol Cell Physiol 284: C77–C84, 2003.
61. Wang L, Wormstone I, Reddan J, Duncan G. Growth factor receptor signalling in human lens cells: role of the calcium store. Exp Eye Res 80: 885–895, 2005.[CrossRef][Web of Science][Medline]
62. Wehner F. Cell volume-regulated cation channels. In: Mechanisms and Significance of Cell Volume Regulation, edited by Lang F. Basel: Karger, 2006, p. 25–53.
63. Wei AD, Gutman GA, Aldrich R, Chandy KG, Grissmer S, Wulffe H. International Union of Pharmacology. LII: Nomenclature and molecular relationships of calcium-activated potassium channels. Pharmacol Rev 57: 463–472, 2005.
64. Wormstone IM, Tamiya S, Eldred JA, Lazaridis K, Chantry A, Reddan JR, Anderson I, Duncan G. Characterization of TGF-b2 signaling and function in a human lens cell line. Exp Eye Res 78: 705–714, 2004.[CrossRef][Web of Science][Medline]
65. Wormstone M, Tamiya S, Marcantonio JM, Reddan JR. Hepatocyte growth factor function and c-Met expression in human lens epithelial cells. Invest Ophthalmol Vis Sci 41: 4216–4222, 2000.
66. Xiao YF, Huang L, Morgan JP. Cytochrome P450: a novel system modulating Ca2+ channels and contraction in mammalian heart cells. J Physiol 508: 777–792, 1998.
This article has been cited by other articles:
![]() |
K. F. Webb and P. J. Donaldson Whole-Cell Patch Clamping of Isolated Fiber Cells Confirms that Spatially Distinct Cl- Influx and Efflux Pathways Exist in the Cortex of the Rat Lens Invest. Ophthalmol. Vis. Sci., August 1, 2009; 50(8): 3808 - 3818. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K. Hoffmann, I. H. Lambert, and S. F. Pedersen Physiology of Cell Volume Regulation in Vertebrates Physiol Rev, January 1, 2009; 89(1): 193 - 277. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |