Am J Physiol Cell Physiol Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 293: C1753-C1767, 2007. First published October 3, 2007; doi:10.1152/ajpcell.00253.2007 Free Article
0363-6143/07 $8.00
This Article
Free upon publication Free Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/6/C1753    most recent
00253.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Holloway, Z. G.
Right arrow Articles by Sztul, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Holloway, Z. G.
Right arrow Articles by Sztul, E.

CALL FOR PAPERS
Protein and Vesicle Trafficking, Cytoskeleton

Activation of ADP-ribosylation factor regulates biogenesis of the ATP7A-containing trans-Golgi network compartment and its Cu-induced trafficking

Zoe G. Holloway,2 Robert Grabski,1 Tomasz Szul,1 Melanie L. Styers,1 Julie A. Coventry,2 Anthony P. Monaco,2 and Elizabeth Sztul1

1Department of Cell Biology, University of Alabama at Birmingham, Birmingham, Alabama; and 2Wellcome Trust Centre for Human Genetics; University of Oxford, Headington, Oxford, United Kingdom

Submitted 13 June 2007 ; accepted in final form 28 September 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
ATP7A (MNK) regulates copper homeostasis by translocating from a compartment localized within the trans-Golgi network to the plasma membrane (PM) in response to increased copper load. The mechanisms that regulate the biogenesis of the MNK compartment and the trafficking of MNK are unclear. Here we show that the architecture of the MNK compartment is linked to the structure of the Golgi ribbon. Depletion of p115 tethering factor, which causes fragmentation of the Golgi ribbon, also disrupts the MNK compartment. In p115-depleted cells, MNK localizes to punctate structures that pattern on Golgi ministacks dispersed throughout the cell. Despite altered localization MNK trafficking still occurs, and MNK relocates from and returns to the fragmented compartment in response to copper. We further show that the biogenesis of the MNK compartment requires activation of ADP-ribosylation factor (Arf)1 GTPase, shown previously to facilitate the biogenesis of the Golgi ribbon. Activation of cellular Arf1 is prevented by 1) expressing an inactive "empty" form of Arf (Arf1/N126I), 2) expressing an inactive form of GBF1 (GBF1/E794K), guanine nucleotide exchange factor for Arf1, or 3) treating cells with brefeldin A, an inhibitor of GBF1 that disrupts MNK into a diffuse pattern. Importantly, preventing Arf activation inhibits copper-responsive trafficking of MNK to the PM. Our findings support a model in which active Arf is essential for the generation of the MNK compartment and for copper-responsive trafficking of MNK from there to the PM. Our findings provide an exciting foundation for identifying Arf1 effectors that facilitate the biogenesis of the MNK compartment and MNK traffic.

copper homeostasis; Menkes disease; regulated exocytosis; P-type adenosinetriphosphatase


THE HOMEOSTASIS OF COPPER within the body needs to be tightly regulated because deficiency prevents the proper functioning of proteins reliant on copper as a cofactor, while excess levels of copper are toxic to cells. Copper is an essential component of many metalloproteins, including superoxide dismutase (free radical protection), mitochondrial cytochrome-c oxidase (electron transport), tyrosinase (pigmentation), and lysyl oxidase (collagen processing), to name but a few (reviewed in Refs. 3, 42). Intracellular levels of copper are in part controlled by the actions of two copper-transporting P-type ATPases, ATP7A (Menkes disease protein, MNK) and ATP7B (Wilson disease protein, WND). Both transporters hydrolyze ATP to translocate ions across cell membranes (32). Even though both ATPases regulate copper efflux, their influences on copper levels in the body differ because of distinct expression profiles. Apart from the liver, MNK expression is ubiquitous, and the transporter is predominantly involved in copper absorption in the intestine and the kidney. On the other hand, WND's major localization is the liver (although also in the kidney and placenta), where it regulates copper clearance by excreting it into bile (41).

The importance of copper transport in human development is underscored by studies linking mutations in genes encoding ATP7A and ATP7B with the clinical pathologies observed in Menkes and Wilson diseases, respectively. Inactivating mutations in ATP7B, observed in Wilson disease, prevent biliary excretion of the metal and cause copper accumulation (and subsequent damage) in the liver (12, 40). Mutations in ATP7A cause Menkes disease, a fatal X-linked disorder that leads to death in early childhood, caused in part by neurological degeneration. Menkes disease results from systemic copper deficiency caused by the failure of ATP7A to translocate copper from the small intestine into the circulation for delivery to the rest of the body (28, 48).

A critical part of MNK's physiological response is its ability to change intracellular localization in response to copper levels, relocating to sites where copper transport is required (reviewed in Ref. 35). Under basal physiological copper levels, MNK concentrates within the trans-Golgi network (TGN) region, where it is postulated to pump copper into the TGN lumen for incorporation into newly synthesized cuproenzymes (17, 64, 65, 86). TGN localization is dependent on a signal within the third transmembrane domain of the transporter (20). An increase in the intracellular copper concentration causes the relocation of MNK to the plasma membrane (PM) (2, 11, 26, 33, 34, 64, 66) or, as reported in some cell types, to vesicles close to the PM (50, 57). MNK trafficking is induced by copper binding, and this action is likely to either disrupt TGN retention or confer a conformational shift that exposes or creates targeting information within MNK. The requirement for copper binding is clearly shown by the inability of MNK to traffic when it lacks five of six of its functional copper-binding domains (26, 47, 83). MNK relocation from the TGN region to the PM requires the activity of protein kinase A (PKA), because PKA inhibitors cause MNK retention within the TGN (11). MNK relocation also requires intact microtubular and actin cytoskeletons, since mutant Cdc42, a Rho GTPase involved in regulating the dynamics of the assembly and disassembly of the actin cytoskeleton, inhibits the exocytosis of MNK (11).

The PM localization of MNK is maintained under high copper concentrations. When copper levels are reduced, MNK returns via an endocytic route to the TGN in an internalization event that requires a dileucine motif in the COOH terminus of MNK (19, 62, 63). The exact regulatory pathway for this endocytic route is unclear (10, 38).

Despite significant progress, our understanding of the molecular mechanisms that confer MNK localization within the TGN and that regulate its trafficking to and from that compartment is limited. Extensive evidence suggests that membrane compartments along the secretory and endocytic pathways are formed by dynamic membrane flow that is dependent on the function of activated ADP-ribosylation factors (Arfs). Arfs are small GTPases belonging to the RAS superfamily. Five Arf isoforms (Arf1, Arf3–6) have been identified in humans. Arf function is modulated by their guanine nucleotide status, and Arfs cycle between an inactive form, when they are bound to GDP or lack a guanine nucleotide, and an active GTP-bound form. Activated Arfs regulate compartmental architecture and membrane trafficking within the secretory and endocytic pathways by facilitating the recruitment of coat proteins that mediate membrane remodeling, cargo selection, and vesicular traffic and by modulating lipid composition of membranes by activating phospholipase D and phosphatidylinositol 4-phosphate 5-kinase (13, 18). Arf activation occurs by GDP/GTP exchange that is mediated by a family of guanine nucleotide exchange factors (GEFs) characterized by a conserved Sec7 domain (reviewed in Ref. 13). The Sec7 domain alone contains the catalytic domain and can displace GDP from an Arf. Structural studies have defined the critical residues within the Sec7 domain required for GDP/GTP exchange (8, 25, 52, 53). Mutations of a key glutamic acid residue within the active site generated an inactive dominant-negative form of the GEF. The activity of GEFs implicated in the regulation of the secretory and endosomal pathways can be inhibited by the fungal metabolite brefeldin A (BFA) (43, 67). Three GEFs are reported to be BFA sensitive: GBF1, BIG1, and BIG2 (51, 56, 85). The inhibitory effect of BFA is understood at the molecular level: BFA inserts within the catalytic interface of Arf and a GEF and prevents the expulsion of GDP that is required for GTP binding and activation (52, 72, 73).

Here we explored the function of Arf in the biogenesis of the MNK compartment and MNK trafficking. We report that the biogenesis of the MNK compartment is regulated through a GEF-mediated activation of Arf. Three experimental conditions that reduce cellular levels of activated Arf lead to the complete dispersion of the MNK compartment. We further show that MNK trafficking in response to copper load is also regulated through an Arf-mediated mechanism. Preventing Arf activation or reducing cellular levels of active Arf1 leads to loss of copper-induced translocation of MNK to the PM. Our findings provide the basis for future studies to define a full complement of proteins that are regulated by Arf to facilitate the formation of the MNK compartment and the trafficking of the MNK protein.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Antibodies and plasmids. Rabbit polyclonal anti-p115 antibodies and anti-GBF1 were described previously (21, 54). Sheep polyclonal anti-TGN46, anti-p115, and anti-GM130 were a kind gift from Dr. Vas Ponnambalam (Leeds University, Leeds, UK). Monoclonal anti-ERGIC53 and rabbit polyclonal anti-Giantin antibodies were a kind gift from Dr. Martin Lowe (Manchester University, Manchester, UK). Monoclonal anti-GPP130 antibody (A1/118) was a kind gift from Prof. Hans Peter Hauri (University of Basel, Basel, Switzerland) and has been previously described (78). Monoclonal anti-actin (AC-40), anti-adaptin-{gamma} (110/3), anti-myc (9E10), and anti-Ha and rabbit polyclonal anti-HA antibodies were from Sigma-Aldrich (St. Louis, MO). Rabbit polyclonal anti-β-COP was from Affinity Bioreagents (Golden, CO). All other antibodies were from BD Biosciences (Oxford, UK).

The plasmids encoding green fluorescent protein (GFP)-tagged GBF1 and GBF1-E794K were described previously (84). Constructs encoding hemagglutinin (HA)-tagged Arf1 and Arf1-N126I were a kind gift from Dr. Julie Donaldson (National Heart, Lung, and Blood Institute, Bethesda, MD). The construct encoding MNK myc was described previously (20).

All following reagents were from Sigma-Aldrich, unless otherwise specified.

Cell culture and transfection. HeLa cells were grown in culture medium: Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 2 mM glutamine, 100 U/ml penicillin, and 100 mg/ml streptomycin (Sigma-Aldrich). Cells were grown at 37°C in a 5% CO2 atmosphere incubator. For immunofluorescence, cells were seeded onto 13-mm round coverslips within 24-well tissue culture plates. For transfection of plasmids, cells were grown to 70% confluence, and ExGen500 reagent (Fermentas, York, UK) was used according to the manufacturer's instructions. Cells were processed 6 or 12 h after transfection.

Immunofluorescence. For immunofluorescence, cells were fixed in 3% paraformaldehyde (PFA) in Dulbecco's PBS for 15 min at room temperature, followed by washing with Tris-buffered saline (TBS). Background fluorescence was quenched with 50 mM ammonium chloride, and cells were permeabilized and blocked in 10% goat serum, 1% fish skin gelatin, and 0.1% Triton X-100 in TBS. After overnight incubation at 4°C with primary antibody diluted in blocking buffer, cells were washed with TBS and incubated with Alexa Fluor-labeled secondary antibodies (Molecular Probes-Invitrogen, Paisley, UK) diluted in blocking buffer for 45 min. Cells were counterstained with 10 µg/ml DAPI in TBS. Coverslips were washed as described above and mounted in Fluoromount G (SouthernBiotech, Birmingham, AL).

Fluorescence patterns were examined with a Zeiss Axiovert 200 inverted microscope with a x63 oil-immersion objective and captured with a Zeiss LSM510 META confocal. For three-color imaging, an argon laser line of 488 nm was used to excite Alexa Fluor 488, a helium-neon (HeNe) line of 543 nm was used to excite Alexa Fluor 594, and a blue-diode laser line of 405 nm was used to excite DAPI. To capture the emission, band-pass filters of 420–480, 505–530, and 560–615 nm were used. For four-color imaging, a HeNe 633-nm laser line was used to excite Alexa Fluor 633 as well as the laser lines described to excite Alexa Fluor 564, GFP, and DAPI. Alexa Fluor 633 emission was captured with a long-pass 650-nm filter, while other fluorochromes were captured with the filters described above. Zeiss LSM510 software (version 4.0) was used for image capturing and processing.

Trafficking assay. HeLa cells were treated with 200 µM CuCl2 in culture medium for 2 h at 37°C, for the final 30 min in the presence of 50 µg/ml cycloheximide. For the copper washout, cells were treated with CuCl2 as described above, washed once with culture medium, and incubated with culture medium containing 50 µg/ml cycloheximide and the copper-chelating agent bathocuproinedisulfonic acid at 200 µM for 4 h at 37°C. The medium was replaced twice during the course of the washout. Addition of the protein synthesis inhibitor cycloheximide ensures that only internalized MNK is observed after the copper washout, and not MNK synthesized during the time course of the experiment. Cells were then processed for immunofluorescence as described above.

BFA treatment. Cells were treated with 10 µg/ml BFA in culture medium for 30 min at 37°C. Cells were then processed for immunofluorescence or subjected to stimulation with CuCl2 for 2–12 h in the presence of BFA.

RNA interference. Small interfering RNA (siRNA) duplexes targeting the human p115 region 509–531 (GATTGATGGACTTACTAGCGGAT) were purchased from IDT (Coralville, IA).

HeLa cells were transfected in antibiotic-free culture medium with 100 nM duplex siRNA per well of a 24-well plate, using Oligofectamine transfection reagent (Invitrogen) according to the manufacturer's instructions. Approximately 48 h after transfection cells were split 1:3 and seeded into fresh 24-well plates for Western blotting or into wells containing coverslips for immunofluorescence. Cells were lysed or processed for immunofluorescence 72 h after transfection. In controls, p115 siRNA was substituted for nontargeting scrambled siRNA (Qiagen, Crawley, UK).

For Western blotting, cells were lysed in the wells at 4°C with cold RIPA buffer (50 mM Tris·HCl pH 7.4, 1% NP-40, 150 mM NaCl, 1 mM EDTA) containing Complete EDTA-free protease inhibitors (Roche, Burgess Hill, UK) and PMSF. Lysates were cleared of nuclei and debris by centrifugation (3,000 rpm at 4°C). Total protein was measured in the supernatant with the bicinchoninic acid assay (Pierce, Rockford, IL). Normalized samples were separated by SDS-PAGE with 7% Tris acetate gels (Invitrogen) and blotted onto polyvinylidene difluoride membrane with the XCell Surelock system (Invitrogen). Proteins were probed with specific antibodies followed by secondary antibodies conjugated to horseradish peroxidase, followed by detection with enhanced chemiluminescence. Band intensities were measured with a charge-coupled device camera (UVP, Upland, CA). The integrated optical density of each band was measured with LabWorks software 4.6 (UVP). For quantification, band intensities were normalized to actin levels in the same samples to ensure fair comparison between lanes. To demonstrate the percentage of knockdown, normalized p115 intensity was expressed relative to mock-transfected cells.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
p115 depletion disrupts the architecture of the Golgi ribbon, revealing MNK in a separate subcompartment from TGN46. Confirming our earlier observations (9, 11, 20), MNK localizes to the TGN based on its close relationship with TGN46, an accepted marker for defining the TGN region (Fig. 1A). MNK displays copper-dependent movement to the cell surface (Fig. 1B) and returns to the TGN on copper washout (Fig. 1C), while the localization of TGN46 is unaffected by copper load. Our previous results (9) suggest localization of MNK in a subcompartment different from TGN46. Figure 1, insets, shows colocalization analyses between these two proteins, and a non-fully overlapping pattern can be detected, supporting the hypothesis for residence in separate subdomains of the TGN.


Figure 1
View larger version (113K):
[in this window]
[in a new window]

 
Fig. 1. MNK resides in a subdomain of the trans-Golgi network (TGN) and traffics to the plasma membrane in response to elevated copper levels. Control HeLa cells (A), cells treated with 200 µM CuCl2 (B), or cells treated with CuCl2 followed by copper washout (w/o) (C) were processed for immunofluorescence with antibodies against MNK and TGN46. Nuclei were counterstained with DAPI (blue). Endogenous MNK and TGN46 show partial colocalization in tightly apposing but separate compartments. Insets show enlarged portions of boxed areas.

 
Previous studies have shown that agents that alter actin or microtubule dynamics and disrupt the architecture of the Golgi and the TGN also alter the structure of the MNK compartment and inhibit MNK translocation to the PM in response to copper (9). The lack of MNK translocation may be caused by the requirement for intact TGN structure or for intact actin microfilaments and microtubules. To dissect these possibilities, we aimed to disrupt TGN structure without disturbing the cytoskeletal systems.

We (1) and others (69, 70, 81) have shown that inactivating the p115 tethering factor (by injecting anti-p115 antibodies or by RNA interference-based translational silencing) results in fragmentation of the perinuclear Golgi into dispersed punctate structures. The TGN, which is closely apposed to the Golgi complex, also appears to be disrupted by p115 depletion, because cells silenced for p115 show dispersal of Golgin245/p230 (81). We posited that the MNK TGN compartment would also be disrupted by p115 depletion.

Specific siRNA directed against the human p115 sequence was used to deplete HeLa cells of p115 (Fig. 2A). A dose-response analysis indicated that a single transfection with 100 nM siRNA produces >90% silencing after 3 days. This protocol was used in all subsequent experiments. The p115 silencing is sequence specific, since nontargeting scrambled siRNA did not affect p115 levels. Moreover, in p115-silenced cells, normal levels of actin (Fig. 2A) and MNK, {gamma}-adaptin of the adaptor protein complex AP1, GBF1, and GM130 (Fig. 2B) are detected.


Figure 2
View larger version (41K):
[in this window]
[in a new window]

 
Fig. 2. Depletion of p115 disrupts the Golgi ribbon. A: HeLa cells were transfected with reagent alone (mock), with 100 nM scrambled small interfering RNA (siRNA; scrm) or with 25, 50, or 100 nM siRNA against p115 in a single or double transfection 24 h apart. Cell lysates were prepared 72 h later and Western blotted with anti-p115 and anti-actin antibodies. Bar graph shows p115 signal (normalized to actin) in each lysate, demonstrating significant depletion of p115 in the siRNA-transfected cells. B: cell lysates from mock-transfected and p115-depleted cells were Western blotted with indicated antibodies. The depletion is specific for p115 and does not influence the levels of other tested proteins. {gamma}-AP, {gamma}-adaptin of adaptor protein complex AP1. C–F: mock-transfected or p115-depleted cells were processed for immunofluorescence with indicated antibodies. Nuclei were counterstained with DAPI (blue). Depletion of p115 causes the dispersal of endoplasmic reticulum (ER)-Golgi intermediate compartment (ERGIC) shown by the relocation of the ERGIC53 marker (C) and the fragmentation of the Golgi shown by the relocation of the GM130 cis-Golgi marker (D), the GPP130 cis-medial marker (E), and the giantin medial Golgi marker (F).

 
Depletion of p115 causes disruption of the endoplasmic reticulum (ER)-Golgi intermediate compartment (ERGIC), as shown by the relocation of the ERGIC53 marker from a largely perinuclear region to a dispersed pattern (Fig. 2C). The Golgi complex is also disrupted, the evidence being the relocation of the cis-Golgi marker GM130 (Fig. 2D), the cis-medial Golgi marker GPP130 (Fig. 2E), and the medial Golgi marker giantin (Fig. 2F) from a tight perinuclear crescent to smaller punctate structures concentrated in the perinuclear region.

The depletion of cellular p115 also disrupts the architecture of the TGN (Fig. 3A). The normally perinuclear TGN (visualized by the TGN46 marker) is fragmented into punctate structures dispersed throughout the cell. Significantly, the MNK compartment is also dispersed into punctate structures in a similar way (Fig. 3B). Expression of a construct encoding the rat p115 cDNA in depleted cells rescues the phenotype of the Golgi and the TGN (data not shown), demonstrating the specificity of the p115 silencing response.


Figure 3
View larger version (59K):
[in this window]
[in a new window]

 
Fig. 3. Depletion of p115 disrupts the MNK compartment. Mock-transfected or p115-depleted HeLa cells were processed for immunofluorescence with indicated antibodies against the endogenous proteins. Nuclei were counterstained with DAPI (blue). Depletion of p115 causes fragmentation of the TGN46 compartment (A). Depletion of p115 also causes the dispersal of the MNK compartment (B). In p115-depleted cells, the fragmented MNK compartment remains separate from the cis-Golgi elements containing GM130 (C). Similarly, the fragmented MNK compartment shows only partial overlap with TGN46 elements (D). Inset shows an enlarged portion of the boxed area.

 
The relationship between the fragmented MNK compartment and the Golgi was explored in p115-depleted cells with the GM130 cis-Golgi marker. The MNK structures are adjacent to the GM130-containing Golgi elements but do not colocalize with them (Fig. 3C). This suggests that the MNK compartment positions adjacent to the Golgi but retains its structural integrity. Similarly, the disrupted MNK compartment is observed to be partially separated from the elements containing TGN46 (Fig. 3D). The limited colocalization suggests that MNK and TGN46 reside in adjacent but distinct TGN subdomains. It appears that p115 depletion results in architecturally fragmented TGN structures that retain their subdomain properties.

Disrupting the architecture of the MNK compartment does not affect MNK trafficking in response to copper. The disruption of the TGN in p115-depleted cells provides an experimental system to test the relationship between TGN integrity and MNK trafficking. Cells depleted of p115 and containing MNK in punctate fragments (Fig. 4A) were incubated with copper, and the localization of MNK was analyzed. As shown in Fig. 4B, MNK traffics to the PM. A pool of MNK remains within an intracellular pool, similar to the situation in control cells containing p115 (Fig. 4B, bottom).


Figure 4
View larger version (66K):
[in this window]
[in a new window]

 
Fig. 4. Disruption of the MNK compartment does not inhibit copper-responsive trafficking of MNK. HeLa cells transiently transfected with myc-tagged MNK were depleted of p115. Cells were then left untreated (A), incubated with 200 µM CuCl2 (B), or incubated with CuCl2 and then subjected to copper washout (C). Cells were processed for immunofluorescence with antibodies against p115 (to detect depleted cells) and anti-myc (to detect MNK). In p115-depleted cells under basal conditions, MNKmyc localizes in fragmented punctate elements (A). MNKmyc relocates from the fragmented elements to the plasma membrane (PM) in response to elevated copper (B). MNKmyc returns to the fragmented elements when copper levels decrease (C). Copper-dependent trafficking of MNKmyc in mock-transfected cells is shown at bottom (ctrl).

 
The recycling traffic of MNK from the PM to the TGN was explored in copper washout experiments. Cells depleted of p115 and treated with copper were incubated with copper-free medium, and the localization of MNK was analyzed. As shown in Fig. 4C, in p115-depleted cells MNK returned to the fragmented elements when copper was removed from the medium. This suggests that the trafficking of MNK out of the TGN to the PM and from the PM to the TGN is independent of the integrity of the TGN ribbon. These findings also suggest that the inhibition in MNK trafficking observed in cells with disrupted actin or microtubule cytoskeletons and disrupted TGN (9) is most likely due to a block in actin- and tubulin-dependent processes that mediate MNK traffic to the cell surface.

Integrity of the MNK compartment is regulated by an Arf-responsive mechanism. Activated Arfs have been shown to regulate compartment architecture and membrane traffic by differentiating membrane surfaces through the recruitment of coat proteins and the activation of lipid-modifying enzymes (13). Two dominant-negative inactive mutants of Arf1 (the Arf1/T31N mutant with low affinity for GTP and the Arf1/N126I mutant with low affinity for both GDP and GTP) have been used to show effects of Arf inactivation on Golgi architecture. Both are believed to exert their dominant-negative effect by binding to and sequestering cellular GEFs, thus preventing the activation of endogenous Arf. Expression of either mutant leads to Golgi collapse, with Golgi proteins relocating to the ER or to punctate structures dispersed throughout the cell (15, 61, 84). The disruption of Golgi architecture correlates with the dissociation of the COP-I coat (68). In agreement with previous reports, we show that expression of the Arf1/N126I mutant disrupts the architecture of the Golgi complex (as evidenced by the redistribution of the GM130 marker) and causes the dissociation of the β-COP subunit of the COP-I coat (Fig. 5A). The Golgi collapse occurs only in cells expressing the mutant Arf1, and expression of wild-type Arf1 does not cause the disruptive phenotype (Fig. 5A).


Figure 5
View larger version (77K):
[in this window]
[in a new window]

 
Fig. 5. Expression of inactive Arf1 mutant disrupts the MNK compartment. HeLa cells were transfected with hemagglutinin (HA)-tagged wild-type Arf1 or the dominant inactive Arf1/N126I. After 6 h, cells were processed for immunofluorescence with anti-HA antibodies (to detect the transfected cells) and the indicated antibodies. Expression of wild-type Arf1 has no effect on the architecture of the Golgi or membrane association of the β-COP component of the COP-I coat (A). In contrast, expression of Arf1/N126I causes dispersion of the Golgi (as shown by the redistribution of the GM130 marker) and dissociation of β-COP from membranes (A). Expression of Arf1/N126I also causes dispersion of the TGN (as shown by the redistribution of the TGN46 marker) and dissociation of the TGN coat adaptor complex AP1 and Golgi-associated {gamma}-adaptin homology Arf-binding protein 3 (GGA3) from membranes (B). Expression of Arf1/N126I leads to complete dispersion of the MNK compartment (C). The disruption is specific to the Arf mutant since expression of the wild-type Arf1 has no effect on MNK localization (C).

 
The effects of expressing Arf1/N126I on the architecture of the TGN, and specifically on the structure of the MNK compartment, have not previously been explored. Significantly, expression of Arf1/N126I causes complete fragmentation of the TGN, as assessed by the redistribution of the TGN46 marker into barely visible structures dispersed throughout the cell (Fig. 5B). To provide insight into the possible molecular underpinning of this disruption, we explored the localization of two TGN-specific coat proteins, the clathrin adaptor complex 1 (AP1) and the clathrin adaptor Golgi-associated {gamma}-adaptin homology Arf-binding protein 3 (GGA3) (reviewed in Refs. 22, 74). We show that the AP1 and the GGA3 adaptors dissociate from membranes in cells expressing Arf1/N126I (Fig. 5B).

Importantly, in cells expressing Arf1/N126I the MNK compartment is completely disrupted, with MNK localizing to barely detectable elements dispersed throughout the cell (Fig. 5C). The disruption is specific to the mutant Arf1, since expression of wild-type Arf1 has no effect on the architecture of the MNK compartment (Fig. 5C).

We stress that MNK localization was examined 6 h after transfections with Arf1/N126I. MNK is relatively stable, with a half-life >48 h (59), suggesting that the vast majority of detected MNK represents that present within the MNK compartment at the beginning of the Arf1/N126I transfection. Together, our data suggest that the MNK compartment is generated through events requiring activated Arf1.

To further explore the requirement for Arf activation in the biogenesis of the MNK compartment, we tested a dominant-negative mutant of GBF1, a GEF known to activate Arf1. We previously generated (21) a GBF1 mutant based on structural analyses of the Sec7 domain within the ARNO GEF that is homologous to the Sec7 domain of GBF1. In our GBF1 mutant, a key glutamic acid residue at position 794, which forms part of the catalytic interface, is changed to a positively charged lysine. The mutation generates the GBF1/E794K mutant that binds, but does not activate, Arf. GBF1/E794K acts as a dominant negative in cells by binding to and sequestering endogenous Arf1 and Arf4. In agreement with previous studies, we show that expression of GBF1/E794K causes Golgi disruption, with the GM130 Golgi marker relocating to punctate structures dispersed throughout the cells (Fig. 6A; Ref. 21). The disruption is specific to the mutant GBF1/E794K, since expression of wild-type GBF1 has no effect on the Golgi (Fig. 6A).


Figure 6
View larger version (62K):
[in this window]
[in a new window]

 
Fig. 6. Expression of inactive GBF1 mutant disrupts the MNK compartment. HeLa cells were transfected with GFP-tagged wild-type (wt) GBF1 or the GFP-tagged dominant-negative GBF1/E794K mutant. After 6 h, cells were processed for immunofluorescence with the indicated antibodies. Expression of wild-type GBF1 does not affect the architecture of the Golgi, while expression of GBF1/E794K causes Golgi dispersion (as shown by the redistribution of the GM130 marker) (A). Expression of GBF1/E794K, but not of wild-type GBF1, also causes dispersion of the TGN (as shown by the redistribution of the TGN46 marker) (B). Expression of GBF1/E794K, but not of wild-type GBF1, causes complete dispersion of the MNK compartment (C). The dispersed MNK structures and TGN46-containing elements localize to the same or closely apposed puncta (D). Inset shows an enlarged portion of the boxed area.

 
Expression of GBF1/E794K has the same effect as expression of Arf1/N126I by disrupting the TGN compartments (Fig. 6, B and C). In a number of GBF1/E794K-expressing cells, MNK and TGN46 localize to the same or closely apposed puncta (Fig. 6D). The disruption is specific to the mutant GBF1/E794K, since expression of wild-type GBF1 has no effect on the TGN (Fig. 6, B and C). These results support our hypothesis that Arf activation is required for MNK compartment biogenesis.

An additional approach to test the requirement for Arf activation is to use the fungal metabolite BFA, which inhibits the catalytic activity of GBF1 and other GEFs involved in membrane trafficking. BFA treatment of cells leads to the complete disassembly of the Golgi (71, 77) and extensive fragmentation of the TGN (71). In agreement, we show the collapse of the Golgi (the evidence being the relocation of GM130 to punctate elements dispersed throughout the cell) and the fragmentation of the TGN (shown by the relocation of TGN46 to small elements clustered in the perinuclear region) (Fig. 7A). Importantly, the MNK compartment is also disrupted by BFA, with MNK relocating to perinuclear tubules and small peripheral structures (Fig. 7A). The relationship between the disrupted elements was explored by colocalization. The punctate structures containing MNK remain distinct from the pattern of the GM130 Golgi marker (Fig. 7B). This confirms that even when fragmented, the MNK compartment remains separate from early secretory compartments. Previous data from our laboratory (11) showed that in BFA-treated cells MNK also remains separate from recycling endosomes containing the transferrin receptor. It appears therefore that the MNK compartment retains its identity even when severely fragmented. The level of colocalization between MNK and TGN46 appears higher. Our findings showing BFA disruption of the MNK compartment confirm that its formation requires activation of Arf.


Figure 7
View larger version (62K):
[in this window]
[in a new window]

 
Fig. 7. Brefeldin A (BFA) treatment disrupts the MNK TGN compartment. HeLa cells were untreated (–) or treated with 10 µg/ml BFA (+) for 30 min. Cells were then processed for immunofluorescence with the indicated antibodies. BFA treatment causes the fragmentation of the Golgi (as shown by the redistribution of the GM130 marker) and the TGN (as shown by the redistribution of the TGN46 marker) (A). The MNK compartment is also disrupted, with MNK relocating to punctate and tubular structures. The MNK elements remain separate from structures containing the cis-Golgi element GM130 but overlap with elements containing TGN46 (B).

 
MNK traffic to the PM in response to copper is regulated by an Arf-responsive mechanism. MNK trafficking out of the TGN during copper stimulation may involve Arf-mediated events. To explore this possibility, we analyzed relocation of MNK from the TGN to the PM in BFA-treated cells. Conspicuously, MNK does not relocate to the PM in BFA-treated cells challenged with copper (Fig. 8). Lack of PM localization is evident even after a prolonged (12 h) period of copper stimulation (data not shown). In BFA-treated cells, MNK remains in a dispersed punctate pattern that appears more peripherally distributed after copper stimulation.


Figure 8
View larger version (87K):
[in this window]
[in a new window]

 
Fig. 8. BFA treatment inhibits copper-responsive trafficking of MNK. HeLa cells were left untreated, treated with 200 µM CuCl2, or treated with 200 µM CuCl2 in the presence of 10 µg/ml BFA. Cells were then processed for immunofluorescence with the indicated antibodies. In cells lacking BFA, MNK relocates to the PM after copper treatment. BFA treatment inhibits MNK relocation to the PM.

 
We further addressed the involvement of Arf by expressing the dominant-inactive Arf1/N126I mutant and subjecting cells to copper stimulation. In cells expressing the mutant Arf1, MNK did not relocate to the PM in response to copper (Fig. 9B). The copper-induced translocation of MNK was evident in the control cells expressing wild-type Arf1 (Fig. 9A). Our results suggest that the trafficking of MNK out of the fragmented MNK compartment to the PM requires Arf-dependent events.


Figure 9
View larger version (58K):
[in this window]
[in a new window]

 
Fig. 9. Expression of inactive Arf1 mutant inhibits the copper responsive trafficking of MNK. HeLa cells were transfected with HA-tagged wild-type Arf1 or the dominant-negative Arf1/N126I mutant. Six hours after transfection cells were incubated in the absence or presence of 200 µM CuCl2 for 2 h and processed for immunofluorescence as in Fig. 5. In cells expressing the wild-type Arf1, endogenous MNK relocates to the PM after copper exposure (A). However, in cells expressing the Arf1/N126I mutant, the TGN localization of endogenous MNK is disrupted and MNK does not traffic to the PM in response to copper stimulation (B). Transfected cells are outlined or marked with asterisk.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The mechanisms generating the MNK compartment and the pathways utilized by MNK to exit that compartment in response to increased concentrations of copper are poorly understood. In this study we used molecular reagents and pharmacological treatments to characterize the molecular events required for both of these processes. We utilized endogenous MNK protein to demonstrate that MNK resides in a subdomain of the TGN that overlaps only partially with the classical TGN marker TGN46. We also show that the structure of the MNK subdomain is linked to the architecture of the Golgi, since it is disrupted by p115 depletion that disrupts the architecture of the Golgi complex. We document for the first time that the MNK compartment is generated through the function of activated Arf. We provide evidence that the trafficking of the MNK protein does not rely on the intactness of the TGN, because MNK still responds to elevated copper by trafficking from and returning to dispersed TGN fragments caused by p115 depletion. In contrast, copper-stimulated trafficking of MNK from the TGN to the PM is inhibited by inactivating Arf or by expressing a dominant-negative mutant of Arf1, indicating that Arf-dependent events mediate trafficking of the MNK protein.

MNK resides in a subdomain of the TGN. Our immunofluorescence localization of MNK and the TGN marker TGN46 in HeLa cells confirms our previously published results showing TGN localization of both proteins (11, 20) but also extends those studies by showing that MNK and TGN46 show regions of labeling that do not overlap. The separation of MNK and TGN46 is even more evident in fragmented Golgi stacks caused by the depletion of the p115 tethering factor. In the fragmented TGN MNK and TGN46 only partially colocalize, confirming that MNK and TGN46 reside in distinct subdomains of the TGN. The present observations support previous results from our laboratory (9) that show that separation of MNK and TGN46 was detected after treatment of cells with the pH-disrupting agent monensin. Likewise, the formation of clustered actin stress fibers through the expression of a constitutively active form of a Rho kinase leads to spatial separation of MNK from TGN46 (9).

It is becoming increasingly evident that the TGN is organized into distinct subcompartments marked by specific TGN proteins (23). Of the four mammalian golgins found at the TGN, GCC88 and GCC185 localize to a common domain that is separate from the domain containing p230/golgin-245 and golgin-97 (16). Furthermore, the domain containing GCC185 is also is enriched for the transmembrane protein {alpha}-2,6-sialyltransferase but excludes TGN46. The matrix protein GMx33 has also been proposed to mark a distinct TGN domain from TGN38, the murine homolog of TGN46 (80).

The MNK localization to a TGN region and its relocation to the PM in response to copper is similar to the itinerary of the glucose transporter Glut4 that redistributes from a TGN-localized compartment to the PM in response to insulin. Interestingly, immunofluorescence and subcellular fractionation studies have documented that in 3T3-L1 cells, Glut4 localizes to a subcompartment of the TGN that is adjacent to, but distinct from, that containing TGN38 (46, 79). Instead, the Glut4 compartment appears enriched in the t-SNAREs syntaxin 16 and 6.

Biogenesis of the MNK compartment. Ultrastructural, biochemical, and molecular studies have shown that the TGN is closely apposed to the trans-most Golgi cisterna, but remains biochemically and functionally distinct. For example, unlike Golgi proteins, TGN proteins do not relocate to the ER during BFA treatment. The TGN has been proposed to form by the maturation of proximal Golgi cisternae, but the exact relationship between the patterning of the Golgi and the TGN is unclear (36, 37, 44).

A link between the Golgi and the TGN is suggested by their parallel fragmentation in cells in which microtubules are disrupted by nocodazole (82, 87). However, microtubules might be required to position the Golgi and the TGN independently, and the coordinate fragmentation of both compartments does not prove causality between the Golgi and the TGN structure. We show that disruption of the Golgi ribbon by depletion of the p115 tethering factor causes a parallel restructuring of the TGN and the MNK compartment on the disrupted Golgi. p115 has been shown to localize to the ERGIC-cis-Golgi compartments of the secretory pathway and function therein (1, 76). p115 is not recruited to the TGN. Therefore, our findings in p115-depleted cells suggest a direct positional relationship between the Golgi complex and the MNK compartment. The molecular mechanisms that ensure the close apposition of the Golgi ribbon, the TGN, and the MNK compartment remain to be elucidated.

Previous studies have shown that the architecture of the secretory compartments is regulated by activated Arf GTPases (reviewed in Ref. 13). To test the role of Arf activation in the biogenesis of the MNK compartment we used multiple approaches: expression of a dominant-negative inactive Arf1, expression of a dominant-negative inactive GBF1 (a GEF known to activate Arf1), and treatment with BFA (a drug shown to inhibit GBF1 activity). We document that expressing Arf1/N126I or GBF1/E794K causes the dispersal of the MNK compartment from its tight perinuclear location into faint or barely detectable puncta. These phenotypes are highly penetrant, and complete dispersion of MNK is observed even in cells expressing moderate levels of the mutant Arf1 or GBF1. We do not know the precise localization of the MNK protein in the dispersed state: it can be in small vesicles below the detection level of a light microscope, or it may reflect the relocation of MNK into a large membrane compartment, such as the ER, with the concomitant dilution and loss of the fluorescence signal. Future work will address this issue.

Trafficking of MNK from the TGN. Our group investigates the cellular mechanisms that govern MNK translocation from the MNK compartment to the PM. We have previously documented the involvement of PKA signaling by showing that PKA inhibitors prevent relocation of MNK to the PM (11). We have also shown that intact actin and microtubule cytoskeletons are required, because drugs that inhibit the correct formation of these networks prevent efficient copper-regulated trafficking of MNK to the PM (9). In addition, a role for actin is supported by the observation that a mutant of Cdc42 and its downstream regulator WASP affect the trafficking of MNK out of the MNK compartment (11). Our published results may reflect the requirement for actin- and microtubule-mediated MNK traffic or may reflect a requirement for intact Golgi/TGN, since the disruption of actin and microtubule networks also disrupts the structure and positioning of the Golgi and the TGN. We explored this issue by fragmenting the Golgi/TGN by p115 depletion without influencing the actin and microtubular networks. Significantly, the MNK compartment was fragmented, but MNK still responded to increased copper by relocating to the cell surface. This indicates that the integrity of the Golgi/TGN ribbon is not important for MNK copper responsiveness.

We document for the first time that preventing Arf activation with BFA causes a dramatic inhibition in MNK relocation to the PM in response to copper. This suggests that Arf-mediated events are required for MNK to transit between the MNK compartment and the cell surface. Arf's involvement in this trafficking mechanism is reinforced by the observation that expression of the dominant-negative Arf1/N126I mutant prevents the copper-induced relocation of MNK to the cell surface. The behavior of MNK contrasts with the response of Glut4 to BFA. Although the Glut4 compartment in 3T3-L1 adipocytes treated with BFA is disrupted and tubulated, the insulin-stimulated trafficking of Glut4 is only slowed but not inhibited (6, 45). MNK functional studies will be essential to support the cell biology data presented in our investigation. It will be important to examine the effect of Arf inactivation on copper efflux, copper tolerance in cells, and the activity of cuproenzymes. These will be addressed in future work.

The exit of proteins from the TGN has been extensively studied. Initial static and live cell imaging has documented cargo sorting in the TGN by showing that the basolaterally destined glycoprotein of the vesicular stomatitis virus (VSV) segregates laterally from an apically destined GPI-anchored fluorescent protein before their segregation into post-Golgi transport carriers (29). Distinct post-Golgi carriers also operate to traffic the mannose-6-phosphate receptor (M6PR) between the TGN and late endosomes (reviewed in Ref. 14).

More recent electron microscopic (EM) tomography of the Golgi/TGN also hints that different subdomains may be responsible for exiting different molecules (37, 49). It appears that the TGN is composed of the final three cisternae within a Golgi stack, together with the tubules that emanate from them (37). Importantly, the distinct Golgi/TGN cisternae elaborate distinct budding profiles, with clathrin-coated buds exiting from the final cisterna of the stack (usually cisterna 7), while non-clathrin-coated buds and tubules emanate from the proximal two cisternae (cisternae 5 and 6). Since different cargo proteins traffic via clathrin and nonclathrin pathways, this suggests that different domains of the TGN are responsible for exiting different molecules. The trafficking of a subset of post-TGN secretory transport carriers, including clathrin-coated vesicles, has been shown to involve dynamin (7, 31). The finding that MNK exits the TGN in cells expressing mutant dynamin (11) suggests that MNK utilizes a clathrin-independent mechanism to exit the TGN. This raises the possibility that MNK localizes to and exits from the fifth and/or sixth TGN cisterna. The exact localization of MNK within the Golgi/TGN region remains to be defined by high-resolution EM colocalization with known TGN markers of different subdomains.

Role of Arf. Our findings suggest that Arf is involved in the biogenesis of the MNK compartment and regulates MNK trafficking out of that compartment in response to copper. How can Arf regulate these processes? Active Arfs modify membrane surfaces by recruiting coat and other proteins to membranes and by activating lipid-modifying enzymes (18). The disruption of the MNK compartment by Arf1 inactivation correlates with the dissociation of coats as evidenced by the diffuse staining of the β-COP component of the COP-I coat (Fig. 5A) and of the AP1 and GGA3 clathrin coat adaptor proteins (Fig. 5B). Whether either or both coats participate in the biogenesis of the MNK compartment is unknown. COP-I components have been detected at the TGN by immunolabeling techniques (27), but the functional significance of COP-I localization at the TGN is unclear. AP1 and GGA3 have been detected on TGN membranes and are known to generate transport vesicles at the TGN and at endosomal compartments. AP1 has been shown to mediate the trafficking of the M6PR (5, 30) and the basal cycling of the Glut4 transporter (45). Since MNK seems to utilize a clathrin-independent exocytic pathway, AP1 is unlikely to play a role in its trafficking. Interestingly, AP3 and AP4 adaptors have been linked to a nonclathrin mechanism of exit from the TGN (reviewed in Refs. 55, 60, 75).

Significantly, both adaptors are recruited to TGN membranes by activated Arf (4, 58). A possible role for either or both adaptors in generating the MNK compartment and MNK trafficking remains to be explored.

It is also possible that other proteins are recruited to the membranes of the MNK compartment via an Arf-requiring mechanism and facilitate its formation. Specifically, additional GGAs (GGA1-2), multiple golgins (e.g., Golgin-97 and Golgin-245), Gmx33, and spectrin also associate with membranes by an Arf-dependent mechanism (24, 39, 80, 88). Additionally, currently unknown proteins may also be recruited to the MNK compartment via activated Arf. The identification of the Arf-dependent proteins facilitating MNK localization in basal and elevated copper levels can commence now that we know that the mechanism involves an Arf cascade.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by funding from the Wellcome Trust.


    ACKNOWLEDGMENTS
 
We thank Drs. Vas Ponnambalam, Martin Lowe, Hans Peter Hauri, and Julie Donaldson for the kind gift of antibodies and constructs. We express much appreciation also to Dr. Antonio Velayos-Baeza for constructive comments on this work and to Dr. Andrew Jefferson for help with confocal microscopy.


    FOOTNOTES
 

Address for reprint requests and other correspondence: E. Sztul, Dept. of Cell Biology, Univ. of Alabama at Birmingham, 1918 University Blvd., Birmingham, AL 35294 (e-mail: esztul{at}uab.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Alvarez C, Fujita H, Hubbard A, Sztul E. ER to Golgi transport: requirement for p115 at a pre-Golgi VTC stage. J Cell Biol 147: 1205–1222, 1999.[Abstract/Free Full Text]

2. Ambrosini L, Mercer JF. Defective copper-induced trafficking and localization of the Menkes protein in patients with mild and copper-treated classical Menkes disease. Hum Mol Genet 8: 1547–1555, 1999.[Abstract/Free Full Text]

3. Balamurugan K, Schaffner W. Copper homeostasis in eukaryotes: teetering on a tightrope. Biochim Biophys Acta 1763: 737–746, 2006.[Medline]

4. Boehm M, Aguilar RC, Bonifacino JS. Functional and physical interactions of the adaptor protein complex AP-4 with ADP-ribosylation factors (ARFs). EMBO J 20: 6265–6276, 2001.[CrossRef][Web of Science][Medline]

5. Borgne RL, Hoflack B. Mannose 6-phosphate receptors regulate the formation of clathrin-coated vesicles in the TGN. J Cell Biol 137: 335–345, 1997.[Abstract/Free Full Text]

6. Bose A, Guilherme A, Huang S, Hubbard AC, Lane CR, Soriano NA, Czech MP. The v-SNARE Vti1a regulates insulin-stimulated glucose transport and Acrp30 secretion in 3T3-L1 adipocytes. J Biol Chem 280: 36946–36951, 2005.[Abstract/Free Full Text]

7. Cao H, Thompson HM, Krueger EW, McNiven MA. Disruption of Golgi structure and function in mammalian cells expressing a mutant dynamin. J Cell Sci 113: 1993–2002, 2000.[Abstract]

8. Cherfils J, Menetrey J, Mathieu M, Le Bras G, Robineau S, Beraud-Dufour S, Antonny B, Chardin P. Structure of the Sec7 domain of the Arf exchange factor ARNO. Nature 392: 101–105, 1998.[CrossRef][Medline]

9. Cobbold C, Coventry J, Ponnambalam S, Monaco AP. Actin and microtubule regulation of trans-Golgi network architecture, and copper-dependent protein transport to the cell surface. Mol Membr Biol 21: 59–66, 2004.[CrossRef][Web of Science][Medline]

10. Cobbold C, Coventry J, Ponnambalam S, Monaco AP. The Menkes disease ATPase (ATP7A) is internalized via a Rac1-regulated, clathrin- and caveolae-independent pathway. Hum Mol Genet 12: 1523–1533, 2003.[Abstract/Free Full Text]

11. Cobbold C, Ponnambalam S, Francis MJ, Monaco AP. Novel membrane traffic steps regulate the exocytosis of the Menkes disease ATPase. Hum Mol Genet 11: 2855–2866, 2002.[Abstract/Free Full Text]

12. Cox DW, Moore SD. Copper transporting P-type ATPases and human disease. J Bioenerg Biomembr 34: 333–338, 2002.[CrossRef][Web of Science][Medline]

13. D'Souza-Schorey C, Chavrier P. ARF proteins: roles in membrane traffic and beyond. Nat Rev Mol Cell Biol 7: 347–358, 2006.[CrossRef][Web of Science][Medline]

14. Dahms NM, Lobel P, Kornfeld S. Mannose 6-phosphate receptors and lysosomal enzyme targeting. J Biol Chem 264: 12115–12118, 1989.[Free Full Text]

15. Dascher C, Balch WE. Dominant inhibitory mutants of ARF1 block endoplasmic reticulum to Golgi transport and trigger disassembly of the Golgi apparatus. J Biol Chem 269: 1437–1448, 1994.[Abstract/Free Full Text]

16. Derby MC, van Vliet C, Brown D, Luke MR, Lu L, Hong W, Stow JL, Gleeson PA. Mammalian GRIP domain proteins differ in their membrane binding properties and are recruited to distinct domains of the TGN. J Cell Sci 117: 5865–5874, 2004.[Abstract/Free Full Text]

17. Dierick HA, Adam AN, Escara-Wilke JF, Glover TW. Immunocytochemical localization of the Menkes copper transport protein (ATP7A) to the trans-Golgi network. Hum Mol Genet 6: 409–416, 1997.[Abstract/Free Full Text]

18. Donaldson JG, Honda A. Localization and function of Arf family GTPases. Biochem Soc Trans 33: 639–642, 2005.[CrossRef][Web of Science][Medline]

19. Francis MJ, Jones EE, Levy ER, Martin RL, Ponnambalam S, Monaco AP. Identification of a di-leucine motif within the C terminus domain of the Menkes disease protein that mediates endocytosis from the plasma membrane. J Cell Sci 112: 1721–1732, 1999.[Abstract]

20. Francis MJ, Jones EE, Levy ER, Ponnambalam S, Chelly J, Monaco AP. A Golgi localization signal identified in the Menkes recombinant protein. Hum Mol Genet 7: 1245–1252, 1998.[Abstract/Free Full Text]

21. Garcia-Mata R, Szul T, Alvarez C, Sztul E. ADP-ribosylation factor/COPI-dependent events at the endoplasmic reticulum-Golgi interface are regulated by the guanine nucleotide exchange factor GBF1. Mol Biol Cell 14: 2250–2261, 2003.[Abstract/Free Full Text]

22. Ghosh P, Kornfeld S. The GGA proteins: key players in protein sorting at the trans-Golgi network. Eur J Cell Biol 83: 257–262, 2004.[CrossRef][Web of Science][Medline]

23. Gleeson PA, Lock JG, Luke MR, Stow JL. Domains of the TGN: coats, tethers and G proteins. Traffic 5: 315–326, 2004.[CrossRef][Web of Science][Medline]

24. Godi A, Santone I, Pertile P, Marra P, Di Tullio G, Luini A, Corda D, De Matteis MA. ADP-ribosylation factor regulates spectrin skeleton assembly on the Golgi complex by stimulating phosphatidylinositol 4,5-bisphosphate synthesis. Biochem Soc Trans 27: 638–642, 1999.[Web of Science][Medline]

25. Goldberg J. Structural basis for activation of ARF GTPase: mechanisms of guanine nucleotide exchange and GTP-myristoyl switching. Cell 95: 237–248, 1998.[CrossRef][Web of Science][Medline]

26. Goodyer ID, Jones EE, Monaco AP, Francis MJ. Characterization of the Menkes protein copper-binding domains and their role in copper-induced protein relocalization. Hum Mol Genet 8: 1473–1478, 1999.[Abstract/Free Full Text]

27. Griffiths G, Pepperkok R, Locker JK, Kreis TE. Immunocytochemical localization of beta-COP to the ER-Golgi boundary and the TGN. J Cell Sci 108: 2839–2856, 1995.[Abstract]

28. Kaler SG. Metabolic and molecular bases of Menkes disease and occipital horn syndrome. Pediatr Dev Pathol 1: 85–98, 1998.[CrossRef][Web of Science][Medline]

29. Keller P, Toomre D, Diaz E, White J, Simons K. Multicolour imaging of post-Golgi sorting and trafficking in live cells. Nat Cell Biol 3: 140–149, 2001.[CrossRef][Web of Science][Medline]

30. Klumperman J, Kuliawat R, Griffith JM, Geuze HJ, Arvan P. Mannose 6-phosphate receptors are sorted from immature secretory granules via adaptor protein AP-1, clathrin, and syntaxin 6-positive vesicles. J Cell Biol 141: 359–371, 1998.[Abstract/Free Full Text]

31. Kreitzer G, Marmorstein A, Okamoto P, Vallee R, Rodriguez-Boulan E. Kinesin and dynamin are required for post-Golgi transport of a plasma-membrane protein. Nat Cell Biol 2: 125–127, 2000.[CrossRef][Web of Science][Medline]

32. Kuhlbrandt W. Biology, structure and mechanism of P-type ATPases. Nat Rev Mol Cell Biol 5: 282–295, 2004.[CrossRef][Web of Science][Medline]

33. La Fontaine S, Firth SD, Lockhart PJ, Brooks H, Camakaris J, Mercer JF. Intracellular localization and loss of copper responsiveness of Mnk, the murine homologue of the Menkes protein, in cells from blotchy (Mo blo) and brindled (Mo br) mouse mutants. Hum Mol Genet 8: 1069–1075, 1999.[Abstract/Free Full Text]

34. La Fontaine S, Firth SD, Lockhart PJ, Brooks H, Parton RG, Camakaris J, Mercer JF. Functional analysis and intracellular localization of the human menkes protein (MNK) stably expressed from a cDNA construct in Chinese hamster ovary cells (CHO-K1). Hum Mol Genet 7: 1293–1300, 1998.[Abstract/Free Full Text]

35. La Fontaine S, Mercer JFB. Trafficking of the copper-ATPases, ATP7A and ATP7B: role in copper homeostasis. Arch Biochem Biophys 463: 149–167, 2007.[CrossRef][Web of Science][Medline]

36. Ladinsky MS, Mastronarde DN, McIntosh JR, Howell KE, Staehelin LA. Golgi structure in three dimensions: functional insights from the normal rat kidney cell. J Cell Biol 144: 1135–1149, 1999.[Abstract/Free Full Text]

37. Ladinsky MS, Wu CC, McIntosh S, McIntosh JR, Howell KE. Structure of the Golgi and distribution of reporter molecules at 20 degrees C reveals the complexity of the exit compartments. Mol Biol Cell 13: 2810–2825, 2002.[Abstract/Free Full Text]

38. Lane C, Petris MJ, Benmerah A, Greenough M, Camakaris J. Studies on endocytic mechanisms of the Menkes copper-translocating P-type ATPase (ATP7A; MNK). Endocytosis of the Menkes protein. Biometals 17: 87–98, 2004.[CrossRef][Web of Science][Medline]

39. Lu L, Tai G, Wu M, Song H, Hong W. Multilayer interactions determine the golgi localization of GRIP golgins. Traffic 7: 1399–1407, 2006.[CrossRef][Web of Science][Medline]

40. Lutsenko S, Efremov RG, Tsivkovskii R, Walker JM. Human copper-transporting ATPase ATP7B (the Wilson's disease protein): biochemical properties and regulation. J Bioenerg Biomembr 34: 351–362, 2002.[CrossRef][Web of Science][Medline]

41. Lutsenko S, Petris MJ. Function and regulation of the mammalian copper-transporting ATPases: insights from biochemical and cell biological approaches. J Membr Biol 191: 1–12, 2003.[CrossRef][Web of Science][Medline]

42. Madsen E, Gitlin JD. Copper deficiency. Curr Opin Gastroenterol 23: 187–192, 2007.[Web of Science][Medline]

43. Mansour SJ, Skaug J, Zhao XH, Giordano J, Scherer SW, Melancon P. p200 ARF-GEP1: a Golgi-localized guanine nucleotide exchange protein whose Sec7 domain is targeted by the drug brefeldin A. Proc Natl Acad Sci USA 96: 7968–7973, 1999.[Abstract/Free Full Text]

44. Marsh BJ, Mastronarde DN, Buttle KF, Howell KE, McIntosh JR. Organellar relationships in the Golgi region of the pancreatic beta cell line, HIT-T15, visualized by high resolution electron tomography. Proc Natl Acad Sci USA 98: 2399–2406, 2001.[Abstract/Free Full Text]

45. Martin S, Ramm G, Lyttle CT, Meerloo T, Stoorvogel W, James DE. Biogenesis of insulin-responsive GLUT4 vesicles is independent of brefeldin A-sensitive trafficking. Traffic 1: 652–660, 2000.[CrossRef][Web of Science][Medline]

46. Martin S, Reaves B, Banting G, Gould GW. Analysis of the co-localization of the insulin-responsive glucose transporter (GLUT4) and the trans Golgi network marker TGN38 within 3T3-L1 adipocytes. Biochem J 300: 743–749, 1994.[Web of Science][Medline]

47. Mercer JF, Barnes N, Stevenson J, Strausak D, Llanos RM. Copper-induced trafficking of the Cu-ATPases: a key mechanism for copper homeostasis. Biometals 16: 175–184, 2003.[CrossRef][Web of Science][Medline]

48. Mercer JFB, Llanos RM. Molecular and cellular aspects of copper transport in developing mammals. J Nutr 133: 1481S–1484, 2003.[Abstract/Free Full Text]

49. Mogelsvang S, Marsh BJ, Ladinsky MS, Howell KE. Predicting function from structure: 3D structure studies of the mammalian Golgi complex. Traffic 5: 338–345, 2004.[CrossRef][Web of Science][Medline]

50. Monty JF, Llanos RM, Mercer JF, Kramer DR. Copper exposure induces trafficking of the menkes protein in intestinal epithelium of ATP7A transgenic mice. J Nutr 135: 2762–2766, 2005.[Abstract/Free Full Text]

51. Morinaga N, Moss J, Vaughan M. Cloning and expression of a cDNA encoding a bovine brain brefeldin A-sensitive guanine nucleotide-exchange protein for ADP-ribosylation factor. Proc Natl Acad Sci USA 94: 12926–12931, 1997.[Abstract/Free Full Text]

52. Mossessova E, Corpina RA, Goldberg J. Crystal structure of ARF1*Sec7 complexed with Brefeldin A and its implications for the guanine nucleotide exchange mechanism. Mol Cell 12: 1403–1411, 2003.[CrossRef][Web of Science][Medline]

53. Mossessova E, Gulbis JM, Goldberg J. Structure of the guanine nucleotide exchange factor Sec7 domain of human arno and analysis of the interaction with ARF GTPase. Cell 92: 415–423, 1998.[CrossRef][Web of Science][Medline]

54. Nelson DS, Alvarez C, Gao YS, Garcia-Mata R, Fialkowski E, Sztul E. The membrane transport factor TAP/p115 cycles between the Golgi and earlier secretory compartments and contains distinct domains required for its localization and function. J Cell Biol 143: 319–331, 1998.[Abstract/Free Full Text]

55. Newell-Litwa K, Seong E, Burmeister M, Faundez V. Neuronal and non-neuronal functions of the AP-3 sorting machinery. J Cell Sci 120: 531–541, 2007.[Abstract/Free Full Text]

56. Niu TK, Pfeifer AC, Lippincott-Schwartz J, Jackson CL. Dynamics of GBF1, a brefeldin A-sensitive Arf1 exchange factor at the Golgi. Mol Biol Cell 16: 1213–1222, 2005.[Abstract/Free Full Text]

57. Nyasae L, Bustos R, Braiterman L, Eipper B, Hubbard A. Dynamics of endogenous ATP7A (Menkes protein) in intestinal epithelial cells: copper-dependent redistribution between two intracellular sites. Am J Physiol Gastrointest Liver Physiol 292: G1181–G1194, 2007.[Abstract/Free Full Text]

58. Ooi CE, Dell'Angelica EC, Bonifacino JS. ADP-Ribosylation factor 1 (ARF1) regulates recruitment of the AP-3 adaptor complex to membranes. J Cell Biol 142: 391–402, 1998.[Abstract/Free Full Text]

59. Pase L, Voskoboinik I, Greenough M, Camakaris J. Copper stimulates trafficking of a distinct pool of the Menkes copper ATPase (ATP7A) to the plasma membrane and diverts it into a rapid recycling pool. Biochem J 378: 1031–1037, 2004.[CrossRef][Web of Science][Medline]

60. Peden AA, Rudge RE, Lui WWY, Robinson MS. Assembly and function of AP-3 complexes in cells expressing mutant subunits. J Cell Biol 156: 327–336, 2002.[Abstract/Free Full Text]

61. Peters PJ, Hsu VW, Ooi CE, Finazzi D, Teal SB, Oorschot V, Donaldson JG, Klausner RD. Overexpression of wild-type and mutant ARF1 and ARF6: distinct perturbations of nonoverlapping membrane compartments. J Cell Biol 128: 1003–1017, 1995.[Abstract/Free Full Text]

62. Petris MJ, Camakaris J, Greenough M, LaFontaine S, Mercer JF. A C-terminal di-leucine is required for localization of the Menkes protein in the trans-Golgi network. Hum Mol Genet 7: 2063–2071, 1998.[Abstract/Free Full Text]

63. Petris MJ, Mercer JF. The Menkes protein (ATP7A; MNK) cycles via the plasma membrane both in basal and elevated extracellular copper using a C-terminal di-leucine endocytic signal. Hum Mol Genet 8: 2107–2115, 1999.[Abstract/Free Full Text]

64. Petris MJ, Mercer JF, Culvenor JG, Lockhart P, Gleeson PA, Camakaris J. Ligand-regulated transport of the Menkes copper P-type ATPase efflux pump from the Golgi apparatus to the plasma membrane: a novel mechanism of regulated trafficking. EMBO J 15: 6084–6095, 1996.[Web of Science][Medline]

65. Petris MJ, Strausak D, Mercer JF. The Menkes copper transporter is required for the activation of tyrosinase. Hum Mol Genet 9: 2845–2851, 2000.[Abstract/Free Full Text]

66. Petris MJ, Voskoboinik I, Cater M, Smith K, Kim BE, Llanos RM, Strausak D, Camakaris J, Mercer JF. Copper-regulated trafficking of the Menkes disease copper ATPase is associated with formation of a phosphorylated catalytic intermediate. J Biol Chem 277: 46736–46742, 2002.[Abstract/Free Full Text]

67. Peyroche A, Antonny B, Robineau S, Acker J, Cherfils J, Jackson CL. Brefeldin A acts to stabilize an abortive ARF-GDP-Sec7 domain protein complex: involvement of specific residues of the Sec7 domain. Mol Cell 3: 275–285, 1999.[CrossRef][Web of Science][Medline]

68. Presley JF, Ward TH, Pfeifer AC, Siggia ED, Phair RD, Lippincott-Schwartz J. Dissection of COPI and Arf1 dynamics in vivo and role in Golgi membrane transport. Nature 417: 187–193, 2002.[CrossRef][Medline]

69. Puthenveedu MA, Linstedt AD. Evidence that Golgi structure depends on a p115 activity that is independent of the vesicle tether components giantin and GM130. J Cell Biol 155: 227–238, 2001.[Abstract/Free Full Text]

70. Puthenveedu MA, Linstedt AD. Gene replacement reveals that p115/SNARE interactions are essential for Golgi biogenesis. Proc Natl Acad Sci USA 101: 1253–1256, 2004.[Abstract/Free Full Text]

71. Reaves B, Banting G. Perturbation of the morphology of the trans-Golgi network following Brefeldin A treatment: redistribution of a TGN-specific integral membrane protein, TGN38. J Cell Biol 116: 85–94, 1992.[Abstract/Free Full Text]

72. Renault L, Guibert B, Cherfils J. Structural snapshots of the mechanism and inhibition of a guanine nucleotide exchange factor. Nature 426: 525–530, 2003.[CrossRef][Medline]

73. Robineau S, Chabre M, Antonny B. Binding site of brefeldin A at the interface between the small G protein ADP-ribosylation factor 1 (ARF1) and the nucleotide-exchange factor Sec7 domain. Proc Natl Acad Sci USA 97: 9913–9918, 2000.[Abstract/Free Full Text]

74. Robinson MS. Adaptable adaptors for coated vesicles. Trends Cell Biol 14: 167–174, 2004.[CrossRef][Web of Science][Medline]

75. Rodriguez-Boulan E, Musch A. Protein sorting in the Golgi complex: shifting paradigms. Biochim Biophys Acta 1744: 455–464, 2005.[Medline]

76. Sapperstein SK, Walter DM, Grosvenor AR, Heuser JE, Waters MG. p115 is a general vesicular transport factor related to the yeast endoplasmic reticulum to Golgi transport factor Uso1p. Proc Natl Acad Sci USA 92: 522–526, 1995.[Abstract/Free Full Text]

77. Scheel J, Pepperkok R, Lowe M, Griffiths G, Kreis TE. Dissociation of Coatomer from membranes is required for brefeldin A-induced transfer of Golgi enzymes to the endoplasmic reticulum. J Cell Biol 137: 319–333, 1997.[Abstract/Free Full Text]

78. Schweizer A, Fransen JA, Bachi T, Ginsel L, Hauri HP. Identification, by a monoclonal antibody, of a 53-kD protein associated with a tubulo-vesicular compartment at the cis-side of the Golgi apparatus. J Cell Biol 107: 1643–1653, 1988.[Abstract/Free Full Text]

79. Shewan AM, van Dam EM, Martin S, Luen TB, Hong W, Bryant NJ, James DE. GLUT4 Recycles via a trans-Golgi network (TGN) subdomain enriched in syntaxins 6 and 16 but not TGN38: involvement of an acidic targeting motif. Mol Biol Cell 14: 973–986, 2003.[Abstract/Free Full Text]

80. Snyder CM, Mardones GA, Ladinsky MS, Howell KE. GMx33 associates with the trans-Golgi matrix in a dynamic manner and sorts within tubules exiting the Golgi. Mol Biol Cell 17: 511–524, 2006.[Abstract/Free Full Text]

81. Sohda M, Misumi Y, Yoshimura S, Nakamura N, Fusano T, Sakisaka S, Ogata S, Fujimoto J, Kiyokawa N, Ikehara Y. Depletion of vesicle-tethering factor p115 causes mini-stacked Golgi fragments with delayed protein transport. Biochem Biophys Res Commun 338: 1268–1274, 2005.[CrossRef][Web of Science][Medline]

82. Storrie B, White J, Rottger S, Stelzer EH, Suganuma T, Nilsson T. Recycling of Golgi-resident glycosyltransferases through the ER reveals a novel pathway and provides an explanation for nocodazole-induced Golgi scattering. J Cell Biol 143: 1505–1521, 1998.[Abstract/Free Full Text]

83. Strausak D, La Fontaine S, Hill J, Firth SD, Lockhart PJ, Mercer JF. The role of GMXCXXC metal binding sites in the copper-induced redistribution of the Menkes protein. J Biol Chem 274: 11170–11177, 1999.[Abstract/Free Full Text]

84. Szul T, Garcia-Mata R, Brandon E, Shestopal S, Alvarez C, Sztul E. Dissection of membrane dynamics of the ARF-guanine nucleotide exchange factor GBF1. Traffic 6: 374–385, 2005.[CrossRef][Web of Science][Medline]

85. Togawa A, Morinaga N, Ogasawara M, Moss J, Vaughan M. Purification and cloning of a brefeldin A-inhibited guanine nucleotide-exchange protein for ADP-ribosylation factors. J Biol Chem 274: 12308–12315, 1999.[Abstract/Free Full Text]

86. Yamaguchi Y, Heiny ME, Suzuki M, Gitlin JD. Biochemical characterization and intracellular localization of the Menkes disease protein. Proc Natl Acad Sci USA 93: 14030–14035, 1996.[Abstract/Free Full Text]

87. Yang W, Storrie B. Scattered Golgi elements during microtubule disruption are initially enriched in trans-Golgi proteins. Mol Biol Cell 9: 191–207, 1998.[Abstract/Free Full Text]

88. Zahn C, Hommel A, Lu L, Hong W, Walther DJ, Florian S, Joost HG, Schürmann A. Knockout of Arfrp1 leads to disruption of ARF-like1 (ARL1) targeting to the trans-Golgi in mouse embryos and HeLa cells. Mol Membr Biol 23: 475–485, 2006.[CrossRef][Web of Science][Medline]





This Article
Free upon publication Free Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/6/C1753    most recent
00253.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Holloway, Z. G.
Right arrow Articles by Sztul, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Holloway, Z. G.
Right arrow Articles by Sztul, E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.