|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MUSCLE CELL BIOLOGY AND CELL MOTILITY
1School of Kinesiology and Health Science, York University, Toronto, Ontario, Canada; 2Department of Biology, Colorado State University, Fort Collins, Colorado; 3Institute of Cell Biology, Department of Molecular Cell Biology, University of Bonn Ulrich-Haberland, Bonn, Germany; 4Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, Texas; and 5Department of Medicine-Lillehei Heart Institute, University of Minnesota, Minneapolis, Minnesota
Submitted 29 March 2007 ; accepted in final form 10 September 2007
| ABSTRACT |
|---|
|
|
|---|
muscle stem cell; cardiotoxin injury; myoblast; cmya1; muscular dystrophy
Xin (Cmya-1; cardiomyopathy-associated-1), an adapter protein containing novel actin-binding repeats, has been colocalized with N-cadherin, β-catenin, and filamin C at the cell-cell (adherens) junctions of striated muscles (17, 20, 23). The current literature suggests that Xin is involved in the remodeling of the actin cytoskeleton of striated muscles during sarcomere assembly and cardiac morphogenesis (11, 14, 20), though its exact role is not well understood. Support for a functional role of Xin in cytoskeletal remodeling is highlighted by the finding that silencing Xin expression in the developing chick heart resulted in abnormal cardiac morphogenesis and altered cardiac looping (23).
Our previous investigations into the molecular regulation of skeletal muscle regeneration (5) led to the finding that the expression CMYA1, the gene encoding Xin, was significantly upregulated during the early phases of skeletal muscle regeneration. In the current study, we investigated the expression pattern of Xin during different stages of skeletal muscle regeneration, elucidated key myogenic transcription factors that regulate the transcription of Xin, and define a functional role of Xin within the satellite cell population. The results of these studies demonstrate that: 1) Xin expression is negligible in resting adult skeletal muscle but is significantly elevated in response to muscle damage and is localized to the activated satellite cell population; 2) the myogenic transcription factors myogenic differentiation factor-D (MyoD), myogenic factor-5 (Myf-5), and myogenic enhancer factor-2 (MEF2) are capable of transactivating Xin transcriptional activity; and 3) decreasing endogenous Xin expression using adenoviral short hairpin (shRNA) within skeletal muscle myoblasts increases their proliferative and migratory capacity as well as increasing the protein expression of myosin heavy chain (MHC). Interestingly, the changes in MHC expression were not reflected in an overt change in differentiating cell morphology nor in the expression of myoglobin, a marker of muscle differentiation. These data further enhance our understanding of Xin within skeletal muscle and aid in the illumination of factors involved in the regulation of satellite cell progeny during skeletal muscle regeneration.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Tissue Ppreparations for In Situ Hybridization Acute injury was induced in the gastrocnemius muscles of adult (2–4 mo old) wild-type mice using a 100-µl intramuscular injection of 10 µM cardiotoxin (Naja nigricollis, Calbiochem, La Jolla, CA) (9). The gastrocnemius muscles of these mice were harvested at 6 and 12 h, and 1, 2, 5, 7, or 14 days postinjury. To determine the expression of Xin in tissues undergoing chronic degeneration-regeneration cycles, we harvested the heart and diaphragm from adult mdx mice. These striated muscle tissues are particularly damaged within this myopathy due to their constant activity. To assess the spatiotemporal expression of Xin during development, embryos were harvested from timed C57Bl/6 pregnant female mice at 8.5, 9.5, 11.5, 13.5, and 15.5 days postcoitum. Embryos and tissues were fixed overnight in 4% paraformaldehyde-diethyl pyrocarbonate-phosphate-buffered saline following avertin-induced anesthesia and transcardiac perfusion. Paraformaldehyde fixed tissue was paraffin embedded for rotary microtomy.
Riboprobe Synthesis
An I.M.A.G.E. Clone (456666) was sequence verified and prepared for in vitro transcription following restriction enzyme digestion and gel isolation. Linearized template (500 ng) was transcribed using either the T7 or SP6 RNA polymerase (Ambion, Austin, TX) with 7.0 µM [
-35S]UTP (1,000 Ci/mmol; Amersham, Piscaway, NJ) to produce the respective sense and antisense riboprobes that were purified with MicroSpin G-50 Columns (Amersham), analyzed for integrity, and stored at –80°C overnight. The Xin riboprobe was 231 bp in length, and the sequence corresponds to the 3' region of Xin mRNA (5532-5762; accession number XM_993589).
In Situ Hybridization In situ hybridization technique was performed as previously described (10, 16). Autoradiographic exposure was undertaken for a 21-day period. The sections were counterstained with hematoxylin and examined using bright and darkfield optics. In all cases, sections hybridized with the sense probe resulted in the absence of signal. Xin mRNA expression was visualized with a Leitz Laborlux-S microscope equipped with Plan-Apochromatic optics, standard brightfield condenser, and a Mears low-magnification darkfield condenser. Photomicrographs were obtained with an Optronics VI-470 CCD camera and Power Macintosh G3 with Scion Image 1.62 software.
Cell Culture
Proliferation.
C2C12 myoblasts (ATCC) were plated in 35-mm wells in growth media containing Dulbecco's modified Eagle's medium (DMEM), 1% penicillin-streptomycin, and 10% fetal bovine serum (FBS; 200,000 cells/well; n = 5 for each condition). To reduce endogenous Xin expression, myoblasts were infected with an adenovirus containing Xin shRNA, which also expressed GFP (Ad-CMV-Xin shRNA-GFP; Loop sequence: TTCAAGAGA; sense 5'-GATCCGGAAGAAAAGGGATATCAGTTCAAGAGACT GATATCCCTTTTCTTCCTTA-3'; antisense: 5'-AGCTTAAGGAAGAAAAGGGATATCAGT CTCTTGAACTGATATCCC TTTTCTTCCG-3'). Our preliminary studies demonstrated that this sequence resulted in a greater than 50% decrease in Xin mRNA expression compared with control, and Western analysis confirmed our PCR results demonstrating an
60% decrease in endogenous Xin expression at 4 days postinfection (see ![]()
![]()
![]()
Fig. 5C). Adenoviral infection efficiency, as demonstrated by green fluorescent protein (GFP) fluorescence was >85%. Control cells were infected with an adenoviral vector containing GFP alone (Ad-CMV-GFP; Vector Biolabs). After 1 day, cells were counted and replated at a density of 200,000 cells. DMEM growth medium was changed daily. Cells were counted and replated as described each day for 3 consecutive days.
|
|
|
|
|
Differentiation. C2C12 myoblasts were infected with Xin shRNA and control (GFP) adenoviruses, and 24 h later were replated on 1.5% gelatin-coated 35-mm plates at 100% confluence in differentiation media containing DMEM, 1% penicillin-streptomycin, 10 µg/ml insulin, 10 µg/ml transferrin, and 2% horse serum. Differentiation medium was changed every 2 days, and pictures were taken daily for 4 consecutive days.
Western analysis. Whole cell protein extracts, harvested using lysis buffer on day 4 of the differentiation assay, were tested for protein content using a Bradford assay. Equal concentrations of protein were size separated by gel electrophoresis on a 10% SDS-polyacrylamide gel. Proteins were transferred to a polyvinyldifluoride membrane and probed with antibodies for Xin (20) fast skeletal MHC (mouse monoclonal; Sigma Aldrich) or myoglobin (rabbit polyclonal; DAKO). Equal loading control was demonstrated by stripping the membrane and reprobing for GAPDH (mouse monoclonal; Abcam). Signals were visualized using Supersignal chemiluminescent reagent (Pierce Biotechnology) as per supplier instructions.
Semiquantitative RT-PCR Analyses Total RNA was isolated with Tripure Isolation Reagent (Roche, Basel Switzerland) and reverse transcribed with Superscript II (Invitrogen) to cDNA. RT-PCR (using 1:10 and 1:50 dilutions of cDNA) was performed under conditions in which the abundance of each amplified cDNA varied linearly with input RNA. RT-PCR was performed using cDNA (1 µl) as a template for the PCR reaction in a 25-µl reaction volume including 40 ng of each primer, 1.5 mM MgCl2, 0.2 mM dNTPs, 2.5 µl, 10x Taq buffer, and 2.5 units of Taq polymerase (Invitrogen). Thermocycler conditions were the following steps: 1) 96°C, 2 min; 2) 96°C, 15 s; 3) 62°C, 30 s; 4) 72°C, 30 s; and 5) 72°C, 10 min. Steps 2 to 4 were repeated for 22 (18S rRNA) or 27 (Xin) cycles. Primers for semiquantitative RT-PCR were the following: Xin For-5'tgttctgcaagcatccac tc3'; Xin Rev-5'ggggtttctttgttccaagc3'; 18S rRNA For-5'ggaccagagcgaaagcattta3'; 18S rRNA Rev-5'tgccagagtctcgttcgttat3'.
Construction of Xin Promoter/Reporter Plasmid A 1.1-kb 5' flanking region of the mouse Xin gene and a 5' deletion promoter fragment was generated by PCR from a BAC clone RP23-137A11. The 5' deletion of the 1.1-kb 5' flanking region generated a promoter fragment of 0.65 kb in length. The PCR products were ligated into the PCR2.1 vector using the TA cloning kit (Invitrogen, Carlsbad, CA), digested from the PCR2.1 vector using restriction enzymes BamHI and XhoI, and ligated to the luciferase gene in the linearized pGL3Basicvector (Promega, Madison, WI; XhoI and BglII).
Transient Transfection Assays For transient DNA transfection, 2 x 105 COS cells were added per well to six-well plates and allowed to adhere overnight. After 24 h, cells were transiently transfected with the Xin promoter/reporter vector and either empty vector (pCI-neo), overexpression vectors for MyoD (0.5 µg), Myf-5 (0.5 µg), or MEF2C (0.75 µg) (pEMSV-MyoD, pEMSV-Myf-5, pCDNAMEF2C) using Lipofectamine-plus lipid reagent and OPTIMEM serum-free medium (Invitrogen), according to the manufacturer's protocol. Twenty-four hours after transfection, cells were rinsed and harvested using lysis buffer (Promega). Luciferase activity was measured in cell lysates using a luciferase assay system (Promega) as per supplier instructions. Transfection efficiencies were normalized by cotransfection of cells with pCMV-lacZ (0.1 µg) and measuring β-galactosidase expression with each experiment performed in triplicate.
The promoter-reporter experiments were also performed in C2C12 myoblasts. However, a higher basal luciferase level and thus an overall reduction in response was observed. We attribute this finding to the presence of endogenous myogenic transcription factors within the C2C12 myoblast cell line. For this reason we chose a nonmyogenic cell line (COS cells) to test the efficacy of specific myogenic transcription factors in transactivating the Xin promoter.
Immunohistochemical Staining of Single Muscle Fibers Single muscle fibers were harvested from the extensor digitorum longus muscle of adult male mice as previously described (9). After isolation, fibers were fixed with ice-cold methanol and acetone and rinsed, and a serial immunohistochemical staining procedure was undertaken. Xin antibody (20) was detected using a Texas red-conjugated secondary and Syndecan-4 (courtesy of Dr. Bradley Olwin) was detected using a FITC-conjugated secondary. Nuclei were detected using 4,6-diamidino-2-phenylindole (DAPI). Imaging of stained single fibers was performed using a Nikon TE-2000U microscope at x40 magnification. Images were overlaid using Adobe Photoshop software. Negative control slides (no primary antibodies) were negative for Xin and Syndecan-4-positive regions.
Data Analysis Student's t-tests were performed to identify significant differences (P < 0.05) in data obtained from control and experimental samples. Data are presented as means ± SE.
| RESULTS |
|---|
|
|
|---|
Xin Expression is Increased in Response to Myotrauma In an effort to identify novel genes involved in regulation of skeletal muscle regeneration, we had previously undertaken microarray analysis of skeletal muscles harvested at various stages within the regenerative process (5). Xin was identified as a gene of interest based on its robust mRNA expression levels during the first 24 h following cardiotoxin injury (Fig. 2A). RT-PCR analysis confirmed the microarray expression pattern of Xin during regeneration (Fig. 2B). Of particular interest is the expression pattern of Xin within isolated skeletal muscle fibers and within various stem cell populations (Fig. 2C). Xin expression was observed within proliferating primary satellite cell cultures but was not detected in Side Population (SP) cells isolated from adult skeletal muscle, bone marrow, or cardiac tissue. Xin expression was most robustly observed from mRNA isolated from pooled individual skeletal muscle fibers. In this procedure, single skeletal muscle fibers were isolated using collagenase digest from adult mice (9) and hand-picked using a Pasteur pipette and pooled for RNA isolation. Each individual muscle fiber contains satellite cells residing under the basal lamina. When harvested in the presence of normal horse serum, this procedure will isolate single muscle fibers and quiescent, as well as activated, satellite cells and give us a better estimate of Xin expression within activated satellite cells than other, more rigorous isolation procedures.
In situ hybridization of skeletal muscle following cardiotoxin injury allowed us to ascertain the location of Xin expression (Fig. 3). As early as 6 h following injury, expression of Xin was observed in areas consistent with muscle satellite cells (Fig. 3, A and B). These focal regions of expression were not observed within neural or vascular tissue and were not consistent with inflammatory cells (Fig. 3, C and D). Interestingly, the expression of Xin during latter phases of regeneration (5 and 7 days) could be readily observed using in situ hybridization despite lower levels observed using microarray or RT-PCR. The expression of Xin at 5 and 7 days of skeletal muscle regeneration was also more robustly expressed in the area adjacent to areas containing high levels of inflammation (Fig. 3, E–H). This finding is consistent with that of other structural-related proteins, such as filamin C (6). As seen in Fig. 3, I–J, the dystrophic diaphragm displays regions of localized Xin expression consistent with that observed in cardiotoxin-injured skeletal muscle.
The mRNA expression of Xin in activated satellite cells was confirmed by staining isolated single muscle fibers with Xin and the satellite cell marker Syndecan-4. As seen in Fig. 4, Xin-positive areas at the periphery of the single fiber were also positive for Syndecan-4 and DAPI.
Myogenic Transcription Factors are Capable of Transactivating Xin Promoter Constructs Analysis of the 1.1-kb upstream region of Xin displays an abundance of muscle-specific transcription factor binding sites, including E-box (CANNTG) sites for myogenic regulatory factor (MRF) binding (e.g., MyoD and myf-5) and the MADS family member MEF-2 binding sites (Fig. 5A). In an effort to delineate the importance of MRF and MEF-2 transcription factor binding sites in the regulation of Xin expression, we undertook promoter reporter assays using a 1.1-kb and truncated promoter construct (0.65 kb). Overexpression of MyoD, Myf-5, or MEF-2 in the presence of the 1.1-kb Xin promoter construct significantly increased luciferase expression (Fig. 5B). Although overexpression of these transcription factors in the presence of the 0.65-kb construct did result in significant increases in luciferase expression above promoter construct alone, truncation of the Xin promoter to just 0.65 kb resulted in a significantly reduced response compared with that observed with the 1.1-kb promoter-reporter construct.
A Decrease in Endogenous Xin Expression Enhances Myoblast Proliferation, Migration, and MHC Expression Using adenoviral vectors containing Xin shRNA, we were able to assess the functional role of Xin within skeletal muscle myoblasts by reducing endogenous Xin expression. Reducing endogenous Xin mRNA resulted in a 26 ± 1.5% increase (P < 0.05) in cell number 2 days after infection compared with cells infected with GFP adenoviral vector alone (Fig. 6A). Furthermore, migratory capacity (as assessed by scratch assay) was increased 20 ± 2.5% relative to control with the reduction of endogenous Xin (Fig. 6B).
|
-MHC protein expression, an indicator of muscle differentiation status, there was a significant elevation in MHC expression with the repression of endogenous Xin compared with controls (Fig. 6, C and D). To determine whether this was a specific effect of Xin on MHC expression, we assessed the protein expression of another indicator of muscle differentiation, myoglobin. As seen in Fig. 6, C and D, myoglobin expression was unchanged with Xin shRNA relative to control infected cells. | DISCUSSION |
|---|
|
|
|---|
In the current study, we demonstrate the restriction of Xin to muscle lineages during embryonic development and its temporal expression profile during adult skeletal muscle regeneration. Furthermore, we have illustrated Xin protein expression within the muscle satellite cell population. Finally, we define the involvement of muscle-specific transcription factors in the transcriptional regulation of Xin and reveal the function of Xin within skeletal muscle myoblasts (C2C12 cell line) through the use of Xin shRNA. The present findings provide, for the first time, evidence for the expression of Xin within skeletal muscle satellite cells and provide insight into the role and regulation of Xin within skeletal muscle satellite cell progeny during muscle regeneration.
Xin was initially discovered using differential display analysis on chick embryos where it was shown to be critical for cardiac morphogenesis (22). Mouse and human homologues of Xin were later discovered (14, 23) and, of particular note, human Xin is mapped to the same gene locus (3p21.2-p21.3) as genes associated with various cardiomyopathies (11). Although the Xin protein is coded by a single large exon, it has recently been demonstrated to undergo intra-exonic splicing to generate three isoforms; A, B, and C (20). The probe set to detect Xin on the Affymetrix mouse array chip (MG-U74Av2) chip, our primers for RT-PCR, and our riboprobe for in situ hybridization are located at the 3'-UTR. Therefore, whereas we were capable of identifying all three Xin isoforms, we were unable to distinguish whether there was a differential expression of the Xin isoforms. Furthermore, the primary Xin antibody (20) and Xin shRNA adenovirus used to suppress endogenous Xin within our in vitro functional assays was capable of detecting or inhibiting both Xin A and B isoforms, respectively. Future studies will investigate the possibility of isoform-specific effects of Xin within skeletal muscle.
It has previously been demonstrated that Xin expression is under the transcriptional regulation of the MEF2C and the cardiac-specific transcription factor Nkx2.5 (11, 23). Based on the localization of Xin expression to the muscle lineages during development and skeletal muscle repair, we also investigated the capacity of other myogenic regulatory factors (MyoD and Myf-5) known to be important for skeletal muscle regeneration to regulate Xin transcriptional activity. MyoD and Myf-5 are members of the myogenic regulatory factors (MRFs; bind canonical E-box motifs) and are critical for muscle satellite cell regulation during muscle regeneration (15, 18). Although the importance of these transcription factors during the early stages of muscle regeneration, particularly satellite cell proliferation and determination, has been defined (12, 25), it is interesting to note that their expression profiles differ during skeletal muscle regeneration when assessed using microarray (5, 24). MyoD displays a temporal expression pattern that more closely parallels that of Xin, whereas Myf-5 is low during the early regenerative phase and is increased during the latter stages in which satellite cell progeny undergo fusion to regenerate the myofiber population. These data suggest that MyoD may be involved in the early regulation of Xin transcription in response to injury, whereas Myf-5 may aid in the transcription of Xin during the latter phases of muscle regeneration.
The transcriptional regulation of Xin by MEF2 supports previous findings (23) and further aids in illustrating the muscle-specific patterning of Xin expression. With respect to skeletal muscle regeneration, MEF2C has been identified as playing a key role, particularly with respect to satellite cell differentiation (13). Findings from our laboratory confirm a high level of MEF2 protein expression 5 to 10 days postinjury (T. J. Hawke and D. J. Garry, unpublished observations). Taken together, the elevated MEF2 protein during the latter stages of regeneration implies that MEF2 may be involved in the regulation of Xin expression during satellite cell differentiation.
In the present study, we generated promoter constructs of 1.1 and 0.65 kb in length; considerably shorter than the 1.85-kb construct generated by Wang et al. (23). Whereas both our 1.1- and 0.65-kb promoter-reporter constructs were capable of transactivating the Xin promoter in the presence of myogenic transcription factor overexpression, truncation of the 1.1-kb promoter resulted in a significant decrease in luciferase expression regardless of the myogenic transcription factor being overexpressed. Whereas this can be readily explained by the removal of E-box motifs with the truncation of the 1.1-kb construct, this does not appear to be the case for MEF2. It is possible that MEF2C may be binding to a less conserved MEF2 binding motif that we had not identified or, alternatively, the truncation of the 1.1-kb to generate the 0.65-kb promoter construct removed sites that enhanced MEF2C binding or were critical for the function of the promoter regardless of the overexpressed transcription factor.
Whereas mRNA expression of Xin within uninjured skeletal muscle is low, this expression is increased dramatically and is restricted to the periphery of adult myofibers at the early stages of regeneration (6–24 h postinjury); an area synonymous with the muscle satellite cell. Further support for Xin expression within satellite cells was demonstrated by the localization of Xin to Syndecan-4-positive cells at the periphery of the adult myofiber (Fig. 4). An increased Xin mRNA in regenerating skeletal muscle (present study) is consistent with other studies demonstrating an increase in Xin following eccentric exercise and within dystrophic ky/ky muscles (1, 2). Barash and colleagues (1) found that 48 h posteccentric exercise, Xin expression was significantly upregulated relative to the contralateral muscle or isometrically contracted muscles. Our finding of an increase in Xin within mdx dystrophic muscle is particularly interesting, as the expression appears to be localized to small, focal regions of expression within the mdx diaphragm. Within another dystrophic model, the ky/ky mouse, Xin protein is distributed in wide solid or irregular patches throughout the affected muscles (2). Based on the extensive remodeling of the actin cytoskeleton that must take place within the activated satellite cell and skeletal muscle fibers during regeneration, it is not surprising that the levels of Xin, an actin-binding protein, are dramatically altered. Recently, the aminoterminus of Xin has been shown to bind the EVH1 domains of Mena/vasodilator-stimulated phosphoprotein VASP, whereas its carboxyterminus binds filamin C (20). Mena/VASP are members of a protein family that associates with cell membrane proteins and is involved in signal transduction pathways regulating the actin cytoskeleton. Filamin C is a muscle-specific protein with several interacting partners within the myofibrillar Z-disk and at the sarcolemma, including F-actin, integrins, and the sarcoglycans (3, 4, 19, 21), and may be involved in myofibril assembly and signaling between the sarcolemma and myofibril (19). From a regenerative perspective, filamin C is tightly regulated during skeletal muscle regeneration, with the highest levels of expression localized to activated satellite cells and newly regenerated muscle fibers (6). The direct relationship of Xin and filamin C is consistent with their similar temporal expression patterns observed during skeletal muscle regeneration (6) and within dystrophic ky/ky muscles (2). Furthermore, Xin expression during regeneration, similar to filamin C, is observed adjacent to regions with persistent inflammatory cell infiltration (Fig. 3, E and F). Although we must concede that it is possible that the Xin-positive areas observed in the in situ hybridization analyses may not be muscle satellite cells, we would propose that: 1) the muscle-specific patterning of Xin during development, 2) the colocalization of Xin with the satellite cell marker Syndecan-4 on single muscle fibers, 3) the transactivation of Xin by known myogenic transcription factors involved in satellite cell regulation, 4) the absence of Xin expression within nonmuscle cells during regeneration, 5) the presence of Xin within newly regenerated muscle fibers, and 6) the direct relationship with filamin C, which has been demonstrated to be expressed within activated satellite cells and newly regenerated muscle fibers, strongly support this conclusion.
The heterogeneous expression of Xin within newly regenerated myofibers may be the result of a temporal limitation of this study where Xin is expressed in all regenerating fibers, but because of the asynchrony of regeneration and the limitation of harvesting at 5, 7, and 14 days, we may be only observing fibers that are expressing Xin at that time. It is also plausible that since Xin is most robustly localized to the myotendinous junctions within skeletal muscle, that our variations in Xin expression during these time points may be the result of transverse sectioning where only a select number of fibers have been sectioned in the region of the cell-cell adherens junction. Clearly, further investigation into this phenomenon is warranted.
Based on the expression pattern of Xin during skeletal muscle regeneration, we had hypothesized that Xin was involved in the promotion of myoblast proliferation and migration. However, our present findings demonstrate that Xin may be involved in attenuating myoblast proliferation and migration. We would propose that Xin may be involved in the activation of muscle satellite cells and associated cytoskeletal remodeling, thereby delaying the processes of proliferation and migration at sites where satellite cells have to fuse and differentiate. However, we were surprised to note that silencing endogenous Xin did not affect visible myotube formation, at least at 4 days of differentiation, but did upregulate MHC protein expression. The reasons underlying this finding are unclear but may be related to the need for Xin in normal sarcomere architecture and its absence results in increased MHC turnover rate. Future studies will investigate the expression of other actin-associated proteins and the effects of modifying Xin expression at specific timepoints of regeneration.
In conclusion, the present findings enhance our understanding of Xin within skeletal muscle and aid in the illumination of factors involved in the regulation of satellite cell progeny during skeletal muscle regeneration.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Beatham J, Gehmlich K, van der Ven PF, Sarparanta J, Williams D, Underhill P, Geier C, Furst DO, Udd B, Blanco G. Constitutive upregulations of titin-based signalling proteins in KY deficient muscles. Neuromuscul Disord 16: 437–445, 2006.[CrossRef][Web of Science][Medline]
3. Faulkner G, Pallavicini A, Comelli A, Salamon M, Bortoletto G, Ievolella C, Trevisan S, Kojic S, Dalla Vecchia F, Laveder P, Valle G, Lanfranchi G. FATZ, a filamin-, actinin-, and telethonin-binding protein of the Z-disc of skeletal muscle. J Biol Chem 275: 41234–41242, 2000.
4. Frey N, Olson EN. Calsarcin-3, a novel skeletal muscle-specific member of the calsarcin family, interacts with multiple Z-disc proteins. J Biol Chem 277: 13998–14004, 2002.
5. Goetsch SC, Hawke TJ, Gallardo TD, Richardson JA, Garry DJ. Transcriptional profiling and regulation of the extracellular matrix during muscle regeneration. Physiol Genomics 14: 261–271, 2003.
6. Goetsch SC, Martin CM, Embree LJ, Garry DJ. Myogenic progenitor cells express filamin C in developing and regenerating skeletal muscle. Stem Cells Dev 14: 181–187, 2005.[CrossRef][Web of Science][Medline]
7. Hawke TJ. Muscle stem cells and exercise training. Exerc Sport Sci Rev 33: 63–68, 2005.[CrossRef][Web of Science][Medline]
8. Hawke TJ, Garry DJ. Myogenic satellite cells: physiology to molecular biology. J Appl Physiol 91: 534–551, 2001.
9. Hawke TJ, Jiang N, Garry DJ. Absence of p21CIP rescues myogenic progenitor cell proliferative and regenerative capacity in Foxk1 null mice. J Biol Chem 278: 4015–4020, 2003.
10. Hawke TJ, Kanatous SB, Martin CM, Goetsch SC, Garry DJ. Rad is temporally regulated within myogenic progenitor cells during skeletal muscle regeneration. Am J Physiol Cell Physiol 290: C379–C387, 2006.
11. Jung-Ching. Lin J., Gustafson-Wagner EA, Sinn HW, Choi S, Jaacks SM, Wang DZ, Evans S, Li-Chun Lin J. Structure, expression, and function of a novel intercalated disc protein, Xin. J Med Sci 25: 215–222, 2005.[Medline]
12. Megeney LA, Rudnicki MA. Determination versus differentiation and the MyoD family of transcription factors. Biochem Cell Biol 73: 723–732, 1995.[Web of Science][Medline]
13. Ornatsky OI, Andreucci JJ, McDermott JC. A dominant-negative form of transcription factor MEF2 inhibits myogenesis. J Biol Chem 272: 33271–33278, 1997.
14. Pacholsky D, Vakeel P, Himmel M, Lowe T, Stradal T, Rottner K, Furst DO, van der Ven PF. Xin repeats define a novel actin-binding motif. J Cell Sci 117: 5257–5268, 2004.
15. Sabourin LA, Girgis-Gabardo A, Seale P, Asakura A, Rudnicki MA. Reduced differentiation potential of primary MyoD–/– myogenic cells derived from adult skeletal muscle. J Cell Biol 144: 631–643, 1999.
16. Shelton JM, Lee MH, Richardson JA, Patel SB. Microsomal triglyceride transfer protein expression during mouse development. J Lipid Res 41: 532–537, 2000.
17. Sinn HW, Balsamo J, Lilien J, Lin JJ. Localization of the novel Xin protein to the adherens junction complex in cardiac and skeletal muscle during development. Dev Dyn 225: 1–13, 2002.[CrossRef][Web of Science][Medline]
18. Smith CK, 2nd Janney MJ, Allen RE. Temporal expression of myogenic regulatory genes during activation, proliferation, and differentiation of rat skeletal muscle satellite cells. J Cell Physiol 159: 379–385, 1994.[CrossRef][Web of Science][Medline]
19. Thompson TG, Chan YM, Hack AA, Brosius M, Rajala M, Lidov HG, McNally EM, Watkins S, Kunkel LM. Filamin 2 (FLN2): a muscle-specific sarcoglycan interacting protein. J Cell Biol 148: 115–126, 2000.[CrossRef][Web of Science][Medline]
20. van der Ven PF, Ehler E, Vakeel P, Eulitz S, Schenk JA, Milting H, Micheel B, Furst DO. Unusual splicing events result in distinct Xin isoforms that associate differentially with filamin c and Mena/VASP. Exp Cell Res 312: 2154–2167, 2006.[CrossRef][Web of Science][Medline]
21. van der Ven PF, Wiesner S, Salmikangas P, Auerbach D, Himmel M, Kempa S, Hayess K, Pacholsky D, Taivainen A, Schroder R, Carpen O, Furst DO. Indications for a novel muscular dystrophy pathway. gamma-filamin, the muscle-specific filamin isoform, interacts with myotilin. J Cell Biol 151: 235–248, 2000.
22. Wang DZ, Hu X, Lin JL, Kitten GT, Solursh M, Lin JJ. Differential displaying of mRNAs from the atrioventricular region of developing chicken hearts at stages 15 and 21. Front Biosci 1: a1–a15, 1996.[Medline]
23. Wang DZ, Reiter RS, Lin JL, Wang Q, Williams HS, Krob SL, Schultheiss TM, Evans S, Lin JJ. Requirement of a novel gene, Xin, in cardiac morphogenesis. Development 126: 1281–1294, 1999.[Abstract]
24. Yan Z, Choi S, Liu X, Zhang M, Schageman JJ, Lee SY, Hart R, Lin L, Thurmond FA, Williams RS. Highly coordinated gene regulation in mouse skeletal muscle regeneration. J Biol Chem 278: 8826–8836, 2003.
25. Yun K, Wold B. Skeletal muscle determination and differentiation: story of a core regulatory network and its context. Curr Opin Cell Biol 8: 877–889, 1996.[CrossRef][Web of Science][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |