Am J Physiol Cell Physiol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 293: C1338-C1346, 2007. First published August 1, 2007; doi:10.1152/ajpcell.00221.2007
0363-6143/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/4/C1338    most recent
00221.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pandorf, C. E.
Right arrow Articles by Baldwin, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pandorf, C. E.
Right arrow Articles by Baldwin, K. M.

MUSCLE CELL BIOLOGY AND CELL MOTILITY

IIx myosin heavy chain promoter regulation cannot be characterized in vivo by direct gene transfer

Clay E. Pandorf, Fadia Haddad, Anqi X. Qin, and Kenneth M. Baldwin

Department of Physiology and Biophysics, University of California, Irvine, California

Submitted 30 May 2007 ; accepted in final form 28 July 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In skeletal muscle of the adult mammal IIx is a pivotal myosin heavy chain (MHC) isoform that can be either up- or downregulated depending on both the fiber type of the target muscle and the type of external stimulus imposed. Since little is known about promoter elements of the IIx MHC gene that are important for its transcriptional regulation in vivo,the main goal of this study was to characterize IIx MHC promoter activity and identify potential regulatory elements on the IIx MHC promoter. A direct gene transfer approach was used, and this approach involved transfection of promoter-reporter constructs into intact rat soleus and plantaris muscle under control and denervated conditions, as well as hindlimb suspension (i.e., models to upregulate IIx MHC transcription). Fast-twitch (plantaris) muscle fibers were confirmed to have significantly greater IIx MHC transcriptional products (pre-mRNA and mRNA) than slow-twitch (soleus) muscle fibers. However, promoter sequences corresponding to –2671 to +1720, –1000 to +392, and –605/+392 relative to the IIx MHC transcription start site, plus an additional construct ligated to a putative embryonic MHC enhancer, failed to produce a fiber type-specific response that is characteristic of the endogenous IIx MHC promoter. Furthermore, the activity of these promoter constructs did not demonstrate the expected response to denervation or hindlimb suspension (i.e., marked upregulation), despite normal uptake and activity of a coinjected {alpha}-actin reference promoter. On the basis of these findings with IIx MHC promoter-reporters we conclude that the loss of the native chromatin environment as well as other necessary cis elements may preclude use of the gene transfer approach, thereby suggesting that there are hidden layers of regulation for the IIx MHC gene.

soleus; plantaris; reverse transcription-polymerase chain reaction; pre-messenger RNA; messenger RNA; skeletal muscle


MYOSIN HEAVY CHAIN (MHC) is the most abundant protein expressed in skeletal muscle, comprising ~25% of the protein pool (2). This protein is expressed as four different isoforms that are observed in adult rodent myofibers, i.e., I, IIa, IIx, and IIb, and each is encoded by a distinct gene. Regulation of expression of each MHC is thought to be primarily at the transcriptional level (7, 13, 14). The function of a muscle is heavily influenced by its MHC composition, and thus the transcriptional activity of each MHC gene is a key factor in defining the muscle phenotype. Little is known, however, of how this transcriptional activity is regulated, particularly in the in vivo setting.

Expression of the adult isoforms of MHC is highly plastic in response to stimuli such as alterations in loading conditions, innervation pattern, and hormone state (2). The IIx MHC gene is particularly sensitive to these stimuli. For example, in rats, slow-twitch soleus muscle expresses very little IIx MHC in the normal control state (13, 21), whereas in response to muscle disuse/inactivity both IIx MHC pre-mRNA and mRNA are rapidly upregulated, and IIx MHC becomes the predominant MHC expressed in the soleus (at both mRNA and protein levels) (14, 21). There can also be muscle-specific predominance of IIx MHC expression in the normal control state, as exemplified by greater IIx MHC expression in the fast-contracting plantaris muscle compared with the slow-contracting soleus muscle (5, 13).

In considering the expression of IIx MHC within the context of the other adult-expressed MHCs, a dogma has been established suggesting that in response to a stimulus that shifts the MHC phenotype in a muscle the MHC transformation would follow a gradual shift from I to IIa to IIx to IIb in a slow-to-fast isoform shift, whereas the opposite would occur in a fast-to-slow shift paradigm (2). However, it has been demonstrated that this transformational pattern is not obligatory, and the regulation and coregulation of these genes are likely far more complex than initially appreciated. For example, Caiozzo et al. (4) showed that a combination of thyroid hormone and hindlimb unloading stimuli can induce a "jump-switch," such that individual soleus muscle fibers normally expressing exclusively type I MHC in the control state begin to simultaneously express a combination of type I, IIx, and IIb with treatment, thus bypassing expression of IIa MHC. One mechanism behind this jump-switch scenario, which we recently described (21), is attributed to antisense transcriptional activity initiated from within the intergenic region linking the IIa and IIx MHC genes. This antisense transcription is initiated in close proximity to the IIx MHC transcription start site and is correlated with both IIx MHC transcriptional activity and inhibition of IIa MHC expression. Our findings suggest that the IIa MHC promoter is the target of the antisense transcript. The activation of the IIx MHC promoter is thus likely to be the initiating event of such a jump-switch scenario, leading to upregulation of the IIx MHC gene and downregulation of the IIa MHC gene. The regulation of the IIx MHC gene is therefore pivotal to understanding MHC isoform switching, not only because it is linked to the expression of functional antisense transcripts, but also because in muscle that is shifting from either faster or slower MHC expression profiles, IIx MHC is often involved, being either upregulated or downregulated, in both fast- and slow-twitch muscle fibers (6, 7). IIx MHC is also the primary fast MHC in human skeletal muscle; thus regulation of its expression is of consequence to human skeletal muscle function (2). Given the central role of IIx MHC in MHC isoform shifts, we sought in this study to better understand its transcriptional regulation in the in vivo setting by defining the proximal promoter elements of the IIx MHC gene that are necessary for its normal expression, using direct gene transfer of promoter-reporter constructs.

Relatively little information is available on the transcriptional regulation of the IIx MHC gene promoter, and almost all of the published reports have exclusively used cell culture systems in an attempt to understand its regulation. Unfortunately, examining fiber type-specific gene regulation or imposing physiologically relevant stimuli such as muscle inactivity/unloading cannot be reliably mimicked with cell culture models (see, e.g., Ref. 23). Allen et al. (1) reported on the promoter activity of the IIx MHC proximal promoter using a gene transfer approach in vivo; however, even here it is unclear whether the IIx MHC promoter activity accurately reflected the activity of the endogenous promoter/gene.

The goal of the present project was to develop an in vivo transient IIx MHC promoter-reporter transfection system in which to assay endogenous IIx MHC promoter activity. Our criteria for achieving that goal were twofold. First, the IIx MHC reporter must demonstrate muscle fiber type specificity. Second, fidelity of response of the reporter to interventions impacting the loading state of the skeletal muscle should be consistent with the endogenous IIx MHC gene's response. These criteria would ensure that our promoter-reporter system accurately mimics the endogenous IIx MHC promoter. This assay could then be confidently used to characterize the IIx MHC promoter in a physiologically meaningful context. Here we report that in testing several promoter constructs of various lengths, including examining the role of a putative distal enhancer, the IIx MHC promoter activity with transient transfections does not mimic the activity of the endogenous IIx MHC promoter/gene. We therefore were not able to further characterize the IIx MHC promoter. These negative findings may reflect the reality behind the dearth of reports on the activity of this promoter, and they illustrate the difficulty in developing an accurate and valid assay for the promoter activity of this elusive, yet pivotal, MHC gene.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Experimental Design and Animal Procedures This study was conducted in three phases (n = ~10 rats/group). Phase I compared IIx MHC promoter-reporter activity in soleus versus plantaris muscle under normal control (Con) conditions with four different IIx MHC promoter constructs. Phase II compared IIx MHC promoter-reporter activity in soleus muscle under Con conditions and in response to unilateral denervation (Den). Phase III compared IIx MHC promoter-reporter activity in soleus muscle under Con conditions and in response to hindlimb suspension (HS). For all these phases, endogenous IIx MHC pre-mRNA and mRNA expression was analyzed. Pre-mRNA expression is utilized as a molecular marker of the endogenous gene transcription, whereas the reporter activity is utilized as a marker of the transfected promoter transcriptional activity.

Female Sprague-Dawley rats (95–110 g) were used for all experiments. They were housed in groups of four in a temperature-controlled environment under light-controlled conditions (i.e., 12:12-h light-dark cycle). All animals in a given experiment were allowed food and water ad libitum, and all procedures were approved by the Institutional Animal Care and Use Committee. All experimental manipulations were carried out for 7 days, which was shown in prior pilot experiments to be sufficient to induce measurable alterations in endogenous MHC gene expression. At the end of the experiment rats were euthanized, and tissues were rapidly removed, weighed, and frozen for later analysis.

Denervation protocol. Animals were anesthetized (10 mg ketamine and 20 mg acepromazine/100 g body wt) before all surgical and gene injection procedures, as described previously (11). Before plasmid injection a denervation procedure was performed by severing the sciatic nerve in the popliteal space region near the distal end of the femur on the left leg. The nerve on the right leg remained intact and thus served as a contralateral control. Pilot testing demonstrated similar results of test promoter activity and IIx MHC RNA when comparing bilateral denervated rats and nondenervated control rats with the unilateral Den method used throughout the experiments described here. This suggests that the unilateral Den procedure did not significantly alter the use of the contralateral Con leg as far as the variables analyzed in this report are concerned.

Hindlimb suspension protocol. The HS model used a tail traction method with a noninvasive tail casting procedure described previously (24). The technique utilized a swivel harness system incorporated into the casting materials, which was attached to a hook at the top of the cage. The hook was adjusted to allow only the front legs of the animal to reach the floor of the cage. Suspended animals were free to move about the cage, using their front legs to obtain food and water.

Plasmid injection procedures. A skin incision in the midcalf region was made to expose the soleus and plantaris muscles, and 20 µl of phosphate-buffered saline containing a mixture of two supercoiled DNA plasmids was injected into the muscles with a 29-gauge needle attached to a 0.5-ml insulin syringe. To improve uptake of plasmids in the plantaris muscle, electropermeabilization was induced on the plantaris muscle immediately after plasmid injection. The electroporation procedure was applied with two gold-plated stainless steel electrodes delivered in four pulses of 200 V/cm for 50 ms each at 1 Hz, followed by four additional pulses of opposite polarity, as described previously (12). All experiments were carried out for 7 days, which was shown in prior pilot experiments to be within the time period of maximum promoter-reporter expression. In addition, IIx MHC pre-mRNA and mRNA are highly upregulated within this time frame (see RESULTS), so the IIx MHC promoter was presumed to also be highly active within this time frame.

Reporter Plasmid Constructs All constructs, except where noted, were cloned from genomic DNA pooled from 10 rats with PfuUltra high-fidelity DNA polymerase (Stratagene) for 25–30 cycles with primers targeting selected regions for PCR amplification (see below). Primers for all IIx MHC promoters were designed to incorporate the MluI site in 5' and the XhoI site in 3' to allow for unidirectional cloning into the corresponding multicloning sites of the firefly luciferase expression vector pGL3 basic (Promega). DH5{alpha} Competent Cells (Life Technologies) were used to grow the plasmids. Plasmids were purified from these cells and then sequenced (Applied Biosystems sequencer 3100) to confirm that the IIx MHC promoter insert matched the published sequence in the GeneBank database.

To correct for variation in gene transfer efficiency associated with the intramuscular injection technique, a Renilla luciferase expression vector (pRL-null; Promega) containing a 2-kb sequence of the promoter of the skeletal muscle-specific gene {alpha}-actin (gift of S. Swoap, Williams College) was coinjected with the test promoter to serve as a reference vector. We previously validated (11, 15) the use of the {alpha}-actin promoter as a reference promoter to correct for transfection efficiency in skeletal muscle of control animals and in unloading paradigms when comparing several test promoter fragments to each other. Others have validated this same {alpha}-actin promoter as a reference promoter in comparing slow- versus fast-twitch fiber types, demonstrating similar activity in both fiber types (9).

In other experiments the pRL-null vector itself was also used as an additional reference promoter. This was done to ensure that our findings with IIx MHC promoter constructs coinjected with {alpha}-actin were not skewed as a consequence of the fact that {alpha}-actin promoter activity itself is decreased with DEN. The pRL-null vector lacks eukaryotic promoter and enhancer elements. It contains a multiple cloning site upstream of the Renilla luciferase gene. Any reporter expression is the result of low-background nonspecific transcriptional activity. Reporter expression driven by pRL-null is a factor of its uptake and thus allows correction for this variable (see RESULTS for further validation experiments). In a separate experiment we validated that the luciferase activity of the pRL-null vector is not sensitive to the Den stimulus. Other candidate reference vectors (e.g., cytomegalovirus, SV40, thymidine kinase) have been deemed by us (11, 12) and others (17, 18) to be invalid choices for the types of experiments carried out here.

Four different IIx MHC promoter fragments were cloned into the pGL3 vector. The –2671 to +1720 (numbers are relative to the IIx transcription start site) promoter fragment includes the entire IIa–IIx intergenic sequence, as well as the untranslated portion (including up to exon 3) of the IIx MHC gene. The translation start site (ATG) begins just before +1720, and is thus included in the construct. The 5'-end of the gene containing untranslated region of the mRNA as well the first two introns was found to contain important regulatory sites in the IIb MHC promoter (Di Maso NA, Haddad F, and Baldwin KM, unpublished findings). This fragment was amplified from the rat genomic DNA pool with ACCCacgcgtGGCTGGCCCTGTCTTTTGTCA as the forward primer and ACCCctcgagCATCTCGGCGTCGGAACTCAT as the reverse primer.

A –1000 to +392 bp promoter fragment was amplified with the –2671+1720 IIx promoter construct as template, ACCCacgcgtGCTTGGTTGCTTTGTTAG as the forward primer, and ACCCctcgagCAACCCCAACAGACACTC as the reverse primer. This construct was predicated on a IIx MHC promoter fragment recently studied by Allen et al. (1).

The –605 to +392 promoter fragment was created by using the –1000/+392 IIx promoter fragment as a template to amplify by PCR. The sequence containing the first 605 bp upstream of the IIx transcription start site consists of the most highly conserved sequence between rat, mouse, and human of any region this size in the 2,678 bp of the IIa–IIx intergenic region [as aligned in Mulan (20)]. This fragment was amplified with ACCCacgcgtCAGAAGTGGGAAGGGGATGA as the forward primer and ACCCctcgagCAACCCCAACAGACACTC as the reverse primer.

In addition to the above three constructs, we designed a fourth promoter reporter. The design of this latter construct is based on a previous report showing enhanced promoter-reporter activity of MHC reporters in both cell culture and in vivo systems by inclusion of potential enhancer elements from the embryonic MHC promoter (16). Thus we ligated this putative enhancer to the –1000/+392 IIx MHC promoter fragment. We determined this embryonic sequence, referred to as Chem E-2 by Konig et al. (16), by locating a region of high sequence conservation between rat and human (>70% similarity over >100-bp sequence lengths), as aligned in Mulan (20), which contained a string of three E-boxes (consensus sequence CANNTG). We also chose to include two other E-boxes to clone that lie outside of this conserved region (1 upstream and 1 downstream) to yield a 672-bp fragment of the embryonic MHC proximal promoter that contained five E-box consensus sites. This fragment was amplified by PCR as described above from genomic DNA with ACCCggtaccAAGGCTGTGAGGGGATGGT as the forward primer and ACCCacgcgtTGTGGCGGGGCAGTTTG as the reverse primer. The forward and reverse primers were designed to contain KpnI and MluI sites, respectively, to allow for unidirectional cloning and subsequent ligation to respective cloning sites located at the 5'-end of the –1000/+392 IIx MHC promoter insert within pGL3.

Reporter Expression Assay Frozen muscle tissues were homogenized in ice-cold passive lysis buffer (Promega) with a glass homogenizer. The homogenate was centrifuged at 10,000 g for 10 min at 4°C. The supernatant was reserved for the luciferase activity assay using Promega's Dual-Luciferase Reporter Assay System, which is designed for sensitive detection of both firefly luciferase and Renilla luciferase activities in a single-extract aliquot. Activities were measured as total light output (as measured by a Monolight 2010-C luminometer) per muscle and expressed as relative light units. Background levels, based on luminescence of noninjected muscle, were subtracted from the measured luminescence of test samples. These experiments were predicated on the assumption that the level of measured luminescence (i.e., luciferase activity) is proportional to the degree of promoter activity.

IIx MHC RNA Analyses Using RT-PCR Total RNA was extracted from frozen soleus and plantaris muscle with the Tri Reagent protocol (Molecular Research Center). Extracted RNA was DNase treated, with 1 U of RQ1 RNase-free DNase (Promega) per microgram of total RNA, and was incubated at 37°C for 30 min, followed by a second RNA extraction with Tri Reagent LS (Molecular Research Center).

RT-PCR was used to compare IIx MHC pre-mRNA and mRNA in soleus muscle in response to both Den and HS (n = 8 rats/group). These procedures were performed as described previously (21). Briefly, RT-PCR reactions were performed with the OneStep RT-PCR Kit (Qiagen), where the RT and PCR are performed in the same reaction tube, with minor modifications to the manufacturer's protocol as follows. The cDNA was synthesized by priming with the reverse PCR primer in the RT reaction. The forward primer was added before the PCR reaction, at the end of 15 min of heating at 94°C in order to denature the RT enzyme and activate the Taq DNA polymerase. Specific PCR primers were designed to target pre-mRNA and mRNA transcripts at the 5'-end of the type IIx MHC gene. Primers targeting mRNA were located on two separate exons (forward: ACGGTCGAAGTTGCATCCCTAAAG, reverse: CACCTTCGGTCTTGGCTGTCAC), whereas one of the primers targeting pre-mRNA was located on an intronic sequence (forward: TGCCACAGAAAGAGGGACGC, reverse: CTGGCTGTGGTGTGGCTGAAA).

To compare IIx MHC expression in soleus and plantaris (n = 6) real-time PCR was used (Stratagene Mx3000p) as previously described (21). Full Velocity SYBR Green premixed reagents (Stratagene) were used, and the reaction conditions were optimized to give efficiencies of 100 ± 5% based on standard curve analyses. PCR was carried out for 40 cycles with annealing and extension temperatures both at 60°C, followed by melting curve analysis. To compare two samples’ initial amounts of cDNA, we utilized the 2 {Delta}Ct method (where Ct is threshold cycle) (22), which assumes a PCR efficiency of 100%. For these experiments the primers targeting mRNA were the same as reported above; however, the primers targeting pre-mRNA were different (forward: TGCAAGGGGCTGGAAATTCAATGG, reverse: ACTCCTTGTTCCTTGCCAGTGCTGACA).

While mRNA is a commonly used marker of gene expression, it is an indirect measure of gene transcription, because mRNA may be subject to stability regulation (8). Barring treatment-induced regulation of primary transcript elongation or splicing efficiency, relative changes in pre-mRNA transcript abundance serve as the best available marker of the IIx MHC gene's transcription state, particularly when analyzed in combination with the spliced product of the pre-mRNA, the mRNA. The other available measure of a gene's transcriptional state, the nuclear run-on assay, in our hands is a technically unreliable measurement tool for the MHC genes, because of the inability to detect outcomes with consistent fidelity. Moreover, assessing the transcriptional state of other genes by measuring pre-mRNA with RT-PCR has been validated as an alternative to the nuclear run-on approach (10).

Statistical Analyses Data are reported as means ± SE. Differences between two groups (Con vs. Den or HS) were analyzed with an unpaired t-test. Statistical significance was set at P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Soleus Muscle Weight Soleus wet muscle weight was significantly decreased with Den compared with Con conditions. Over the course of these experiments mean Con soleus wet weight was 62.3 ± 0.95 mg and mean Den soleus wet weight was 36 ± 1.2 mg. Thus Den resulted in a 42% decrease in soleus wet weight over 7 days, which is a hallmark of the denervation stimulus. Soleus wet muscle weight was also significantly decreased with HS compared with Con, and to a similar degree as with Den. Mean Con soleus wet weight was 66.9 ± 1.7 mg and HS soleus wet weight was 40.4 ± 1.4 mg in these experiments.

Muscle Fiber Type Specificity One criterion we used to establish whether promoter-reporters had activity similar to the endogenous IIx MHC promoter was to compare the activity of each in slow fiber-type soleus muscle relative to fast fiber-type plantaris muscle. With the assumption that the transcriptional products of the IIx MHC gene reflect the activity of the gene's promoter, we examined unspliced pre-mRNAs and the spliced products, mRNA, using real-time RT-PCR to gain insight on the endogenous IIx MHC promoter activity. Real-time PCR assessment of the IIx RNA products in soleus and plantaris muscles shows that IIx pre-mRNA is 16-fold greater and IIx mRNA is 200-fold greater in plantaris compared with soleus muscle in the normal control (Con) state (Fig. 1A). Because of the vastly higher expression in both pre-mRNA and mRNA in the plantaris compared with the soleus we would expect the plasmid promoter-reporter to reflect a marked difference in activity between the two muscle types. Figure 2 presents a summary of each of the promoter constructs, of varying sizes, and their relative activity in plantaris versus soleus muscle. The activity of the IIx MHC promoter-reporters are shown corrected for {alpha}-actin promoter activity to account for differences in plasmid uptake efficiency. Results were quite variable, as demonstrated by the large SE bars (Fig. 2B). Mean differences between the two muscles also were not great. Thus none of the promoter-reporters showed significantly higher relative activity in the plantaris compared with the soleus, as we would expect based on the transcriptional products of the IIx MHC gene. Therefore, it does not appear that the IIx MHC promoter-reporter plasmids show a fiber type-specific response.


Figure 1
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 1. IIx myosin heavy chain (MHC) RNA transcript expression. A: IIx MHC RNA expression in soleus and plantaris muscles with real-time PCR. Ratio is calculated based on the 2{Delta}Ct method (where Ct is threshold cycle) (22). Ratio of IIx MHC pre-mRNA expression is depicted on left, and IIx MHC mRNA is depicted on right. In both cases there was a significant difference between plantaris and soleus measurements based on ratio means different from 1 (P < 0.001). B: IIx MHC pre-RNA (left) and mRNA (right) expression in soleus muscle in normal control (Con) vs. denervated (Den) conditions measured by end-point RT-PCR. C: same as in B except groups were Con and hindlimb suspension (HS). Data are means ± SE. *Significant change vs. Con.

 

Figure 2
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 2. IIx MHC promoter reporter constructs and comparison of activity by fiber type. A: schematic representation of the organization of the MHC genes on rat chromosome 10 and the IIa–IIx intergenic region enlarged below. The various-sized DNA fragments and their corresponding regions comprising the IIx MHC promoter are aligned at bottom. The translation start site of IIx MHC is indicated by ATG above the IIx MHC gene diagram. The approximate location of the Chem E-2 sequence is labeled in the embryonic MHC promoter region of the top diagram and indicated with gray shading. The fragments depicted were inserted into a pGL3-basic multicloning site to promote expression of firefly luciferase, which was subsequently assayed for in muscle extract. B: activity of various IIx MHC promoter constructs in plantaris vs. soleus. Shown are % changes in luciferase activity normalized to {alpha}-actin promoter activity (Renilla luciferase) in plantaris vs. soleus muscle. A value of 0% on the x-axis would indicate an identical promoter activity ratio between plantaris and soleus. None of the changes is statistically significant.

 
To illustrate that fiber type specificity could be demonstrated with a different MHC gene, a –3500 beta-MHC promoter construct that has been studied previously (11) was injected into soleus and plantaris muscles with procedures identical to those utilized for the IIx MHC promoter constructs. The beta-MHC promoter activity relative to that of the {alpha}-actin promoter was 0.27 ± 0.04 in the soleus muscle and 0.007 ± 0.002 in the plantaris muscle (n = 14 for each muscle). This markedly lower activity of the beta-MHC promoter-reporter in the plantaris compared with the soleus parallels beta-MHC mRNA levels in plantaris versus soleus (13). Thus fiber type specificity can be demonstrated with the beta-MHC promoter-reporter, but not with any of the IIx MHC promoter-reporters tested.

Fidelity of Response to Interventions Impacting Loading State/Activity Level of Skeletal Muscle The other criterion used to establish whether IIx MHC reporters had activity similar to the endogenous IIx MHC was to compare the activity of each in soleus muscle in Con versus Den conditions. RT-PCR analysis of the transcriptional products of the IIx MHC gene showed that both pre-mRNA and mRNA significantly increased in parallel in response to Den (Fig. 1B). However, in contrast to the IIx MHC pre-mRNA, which increased by 87% on average, three of the promoter fragments (–2671/+1720, –1000/+392, –605/+392) showed very little difference between Con and Den states in soleus muscle. Assuming that the pre-mRNA represents a reasonable approximation of the endogenous IIx MHC gene's promoter, the luciferase product of the IIx MHC promoter-reporter should have accumulated to quantities that at least exceed this degree of increase. Therefore, it does not appear that these IIx MHC promoter-reporters demonstrate the predicted response to interventions impacting loading state/innervation of the soleus muscle.

The IIx MHC promoter linked to the embryonic sequence (Chem E-2) was the only IIx MHC promoter-reporter tested that showed relative promoter activity that was even close to the changes in Den versus Con of the IIx MHC pre-mRNA. This promoter construct showed a mean increase of 66% in Den compared with Con conditions. However, this response suffered from very large variability, and thus was not statistically significant.

One issue that could confound the interpretation of these results is the fact that the activity of the reference promoter {alpha}-actin is decreased in the soleus in response to Den by ~50% on average across the promoters studied. However, the decreased {alpha}-actin reporter activity would result in an overestimate of the IIx MHC-to-{alpha}-actin ratio in the Den muscle (because of the smaller denominator); thus this confounding variable is not contributing to misinterpretation of results in this report, where the IIx MHC-to-{alpha}-actin ratio in Den is not increased above Con levels. Also, the mean absolute (uncorrected) luciferase activity for each of the IIx MHC reporters examined revealed no significant changes in the Con versus Den states (data not shown). Therefore, this lack of reporter response is inconsistent with the pre-mRNA response reported in Fig. 1B. Additionally, the decreased {alpha}-actin reporter activity in Den conditions was consistent across all experiments, thus allowing for valid comparison of reporter activity from one test promoter to another in which experimental conditions were identical.

To further ensure accurate interpretation of the findings, we sought out an alternative reference reporter that is unresponsive to Den. Consequently, we designed an experiment to determine whether the promoterless vector pRL-null could serve such a purpose and, if so, at what amount. Into Con and Den soleus muscle we injected four different increasing amounts of the pRL-null plasmid, to determine a plasmid amount that is capable of producing measurable activity sufficiently above that of background luciferase levels. Although pRL-null is promoterless, we found that when it was injected into soleus muscle there was a measurable amount of activity expressed in the muscle that varied to reflect differences in uptake. Uptake, as reflected by reporter expression, was linearly increased with pRL-null plasmid amount; pRL-null of 4, 6, 8, and 16 pmol per injection per musole positively correlated with the mean Renilla luciferase activity in each group (r = 0.99, P = 0.01 in Con soleus). Therefore, activity of the pRL-null reporter in soleus muscle depends on the degree of uptake, making it a valid choice as reference promoter. From this experiment we also determined that the pRL-null vector was unresponsive to Den in the soleus [759 ± 216 for Con, 878 ± 325 for Den (arbitrary units); P = 0.77, n = 6]. We selected 6 pmol as the concentration of pRL-null to inject for subsequent experiments because this concentration resulted in luciferase activity that was sufficiently above background levels to be easily detected. Furthermore, the relationship between test promoter (IIx MHC) and reference promoter (pRL null) was strongly correlated, as supported by a Pearson coefficient r of 0.9 (P = 0.003, n = 12) in comparing Renilla activity of the pRL-null vector with the coinjected IIx MHC luciferase reporter activity, demonstrating that despite the inherent variations in uptake between muscle samples reporter activity of the coinjected plasmids showed proportional uptake.

Taking the IIx MHC promoter that gave the best activity and the closest response to the endogenous promoter, the Chem E-2/IIx MHC promoter, we repeated the experiment with pRL-null as the reference promoter instead of {alpha}-actin and found that there was a pRL-null-corrected increase of 41% [5.8 ± 1.1 for Con, 8.2 ± 1.6 for Den (arbitrary units); nonsignificant]. Although the Chem E-2/IIx MHC promoter construct elicited a Den response closest to the transcriptional response (87% increase in IIx MHC pre-mRNA) its activity was still inadequate, and thus we feel confident in reporting that in response to Den intramuscular injection of promoter-reporter plasmids does not accurately reflect the activity of the endogenous promoter.

To ensure that the Den stimulus in and of itself was not adversely affecting the IIx MHC promoter constructs, we examined the –1000/+392 IIx MHC promoter construct in soleus and plantaris muscle, using an alternate model of muscle unloading, i.e., hindlimb suspension (HS). This model of muscle disuse resulted in a large increase in IIx MHC pre-mRNA that paralleled IIx MHC mRNA in HS compared with Con conditions (Fig. 1C) as assessed with RT-PCR. Because of the issue concerning use of {alpha}-actin as a reference promoter as described above, in this latter study we also tested the pRL-null vector as a reference promoter to correct for plasmid uptake efficiency. This experiment using HS showed that the –1000/+392 IIx promoter activity, relative to pRL-null, was 2.43 ± 0.33 in HS and 3.55 ± 1.1 in Con (arbitrary units, nonsignificant; relative change depicted in Fig. 3B). This finding confirms the data described above with the Den model that showed the response of the –1000/+392 IIx MHC promoter that was not consistent with transcriptional activity of the endogenous gene. Because the Den experiment using the –1000/+392 IIx MHC construct was performed with the {alpha}-actin reference promoter, the contralateral leg of rats in the HS study was also studied with the {alpha}-actin reference promoter, to allow for direct comparison of the two models. The –1000/+392 IIx MHC promoter, relative to {alpha}-actin, was 8.5 ± 2.0 in HS and 4.6 ± 0.6 in Con (arbitrary units, nonsignificant). Thus, while IIx MHC promoter activity relative to {alpha}-actin was higher in HS than Con conditions, it was not significantly greater and also was not as highly increased as IIx MHC pre-mRNA. Thus the two disuse/inactivity models studied consistently failed to demonstrate increased IIx MHC promoter activity compared with Con conditions.


Figure 3
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 3. IIx MHC promoter reporter activity in Den vs. Con soleus. A: firefly luciferase activity of each IIx MHC promoter construct, corrected for {alpha}-actin promoter activity and reported as % change in luciferase activity for soleus muscle in Den vs. Con. A value of 0% on the x-axis indicates an identical promoter activity ratio in Den and Con. None of the changes is statistically significant. B: firefly luciferase activity of the –1000/+392 IIx MHC promoter construct, shown corrected for pRL-null Renilla luciferase activity, in soleus muscle subjected to HS vs. Con.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The primary goal of the present study was to characterize the IIx MHC promoter by identifying important regulatory elements that confer muscle-specific activity and responsiveness to the disuse/inactivity model of muscle denervation as well as hindlimb suspension. Both of these models have been shown previously to induce marked slow-to-fast shifts in MHC gene expression centered on increases in IIx MHC expression. We felt it was important to focus on regulation of IIx MHC in vivo, as opposed to in cell culture, because only the former provides an environment in which to examine and manipulate expression of IIx MHC under opposing conditions, i.e., in fast- versus slow-twitch muscle and with normal activity versus muscle disuse/inactivity. Therefore, we cloned several different IIx MHC promoter constructs into pGL3 expression plasmids (including those that extended into the IIx MHC gene, i.e., –2671/+1720) and injected them into rat soleus and plantaris muscle, and also into soleus muscle that was denervated. In comparing plantaris versus soleus muscle and Den versus Con soleus we observed an increase in IIx MHC pre-mRNA transcripts that paralleled that of the mRNA response, which is consistent with a transcriptional response. We report that, compared with the transcriptional response of the endogenous IIx MHC gene, the IIx MHC promoter-reporter constructs did not demonstrate the divergence of fiber type-specific expression of IIx MHC observed in soleus compared with plantaris muscle, nor did they respond divergently to Den in soleus compared with Con conditions. Thus subsequent experiments to characterize regulatory elements of the IIx MHC promoter were deemed not to be feasible.

It is worth noting, as an aside, the large fold difference between IIx pre-mRNA and mRNA in plantaris versus soleus (16-fold vs. 200-fold, respectively; Fig. 1A). Differences in stability between pre-mRNA and mRNA may account for these large differences in their steady-state levels in the two fiber types. In fact, pre-mRNA has much a shorter half-life than mRNA; therefore, the difference in pre-mRNA levels may be magnified into a larger difference between the fiber types in mRNA accumulation. This difference is also evident in the Den and HS responses. In both cases, the mRNA response is of a larger magnitude. Alternatively, the large difference in mRNA versus pre-mRNA accumulation may be attributed to differential mRNA stability between the two fiber types. For example, translation has been found to interfere with mRNA decay by competing with the substrates of mRNA degradation (19). Therefore, mRNA that is translated at higher rates (such as IIx MHC mRNA in plantaris compared with soleus muscle) is better preserved.

The –1000 to +392 IIx MHC construct is similar in size to one reported previously by Allen et al. (1), and this sequence thus served as a starting point for these analyses. The lack of fiber type specificity reported here actually is similar to findings by Allen et al. (1) in which they reported relative luciferase levels that were nearly identical to each other in both soleus and plantaris for a IIx MHC promoter sized similarly to that used in the present study. However, these investigators used a different expression vector (VR1255). The other variously sized IIx MHC promoter constructs reported here also failed to demonstrate fiber type specificity.

Conversely, we have previously shown (12) fiber type specificity with several differently sized beta (i.e., type I)-MHC promoter constructs injected into soleus and plantaris muscles. We also repeated this experiment with a –3500 beta-promoter in the pGL3 vector in the present series of experiments and validated these previous findings. Furthermore, we previously demonstrated (Haddad F and Baldwin KM, unpublished findings) that IIb MHC promoter constructs also show fiber type-specific responses in the soleus and plantaris, whereby we demonstrated higher expression of this fast MHC in the fast-twitch plantaris than in the slow-twitch soleus. Therefore, fiber type specificity can be demonstrated with different MHC promoter constructs, with the use of the same technical approaches employed here.

We also feel that we can sufficiently rule out the possibility of flawed procedures for using the promoter-reporter technique. Researchers in our laboratory (11, 15) have successfully studied several other MHC gene promoters in vivo (e.g., types I and IIb) with identical methods and not only obtained higher levels of reporter expression but demonstrated responsiveness to various interventions with these promoters. Also, to rule out the possibility of interresearcher differences in technique or reagent variances, previous experiments of promoters that gave us high activity and were intervention responsive (e.g., type I MHC, myosin light chain kinase) were repeated in the process of collecting the data reported in this report (data not shown). These experiments resulted in responses similar to those reported previously (11, 12, 15) and thus confirmed the reliability and validity of the methods utilized here.

Increased IIx MHC promoter activity of the injected constructs also failed to materialize with the primary muscle disuse/inactivity model we used here, i.e., denervation. Thus another muscle disuse model, hindlimb unloading, was studied with the –1000/+392 IIx MHC promoter construct and confirmed our findings with Den. These results demonstrate that two different stimuli, which result in increased upregulation of IIx MHC transcriptional products, have failed to induce a similar response in promoter activity of IIx MHC promoter-reporters. However, the Chem E-2 embryonic sequence linked to the –1000/+392 IIx MHC promoter demonstrated an increase in activity that approximated that seen with the endogenous IIx MHC gene, although its activity was highly variable (see Fig. 3A). This Chem E-2 sequence contains numerous E-boxes, which are predicted to bind the myogenic helix-loop-helix factor/MyoD family proteins. Konig et al. (16) reported that a similar Chem E-2 sequence from the mouse ligated to a short IIx MHC promoter (to –304) can increase the expression of IIx MHC promoter-reporters in vitro. The skeletal muscle MHC genes exist in tandem on mammalian genomes (i.e., embryonic, IIa, IIx, IIb, neonatal, and extraocular in order from 5' to 3'; see Fig. 2A), with their gene order, orientation, size, and intergenic spacing roughly conserved. It has been speculated that this evolutionary conservation may be important to the expression of these genes, and particularly to their coordinated regulation, as observed in response to different muscle-loading conditions and developmental stages.

Extensive work has been done on the coregulation and coordinated expression of other gene families encoded in tandem genomic clusters, such as the beta-globin locus. Proper coordinated expression of the genes within this locus, for example, requires maintenance of the entire locus as a unit, so that powerful enhancer elements (the beta-locus control region) upstream of the beta-globin locus genes can engage in complex interactions with downstream targets within the globin gene sequences themselves (see Ref. 3 for review). It is possible that the skeletal muscle MHC genes are coordinated in an analogous manner. Two pieces of evidence make this an intriguing possibility. The first is the aforementioned increased activity of the Chem E-2/IIx MHC promoter construct in Den soleus muscle, an increase (though not statistically significant) approaching that of the endogenous IIx MHC gene transcriptional activity. The second lies in the confounding lack of activity of all of the other IIx MHC promoter constructs in Den versus Con soleus muscle. The embryonic sequence included in the Chem E-2/IIx MHC promoter construct may contain enhancer elements that control the MHC locus, and therefore we may have reconnected some normally cis-acting sequences by ligating the embryonic promoter sequence to the IIx MHC promoter sequence, thus recapitulating some semblance of natural chromosomal interactions. Without such an enhancer in place, normal IIx MHC promoter activity may not be possible (as suggested by the lack of responsiveness in the other IIx MHC promoter constructs we examined). Therefore, further research is required to establish interactions of the IIx MHC promoter with distal enhancers.

The Chem E-2/IIx MHC promoter construct did not have activity that was increased above that of the other IIx MHC promoter sequence constructs in the plantaris muscle, however. It is not clear why the Chem E-2/IIx MHC promoter construct seemed not to have enhanced activity in the plantaris, but perhaps it is due to the fast-twitch fiber phenotype of the plantaris, and a different gene regulatory strategy and/or a different enhancer element required to maintain that phenotype compared with that required to alter the slow-twitch fiber phenotype of the soleus. The Chem E-2 sequence is, after all, a relatively small region in the MHC locus chosen for its evolutionary conservation, and it thus represents an incomplete picture of enhancer elements that may regulate the IIx MHC promoter. An enhancer that promotes fiber type specificity and environmental responsiveness could be quite distant (1–2 million bases) or even within the IIx MHC gene; therefore a systematic approach should be undertaken to identify and functionally evaluate candidate enhancers to IIx MHC.

We recently reported (21) that an RNA transcript oriented in the sense direction is detected at incremental sites along the length of the 2.7-kb IIa–IIx intergenic region in the soleus and vastus intermedius muscles. Measurement of this transcript in this region corresponds to the regulation observed in the coding region of the IIa MHC gene in response to spinal cord isolation, and no interruptions in this transcript were detected by RT-PCR at incremental measurement sites in the IIa–IIx intergenic region. Thus this transcript is apparently continuous with the IIa MHC pre-mRNA. Because this RNA is therefore transcribed across the presumed promoter region of the IIx MHC gene, one could speculate that it may influence IIx MHC transcriptional activity. Furthermore, because this RNA is continuous with the IIa MHC coding transcript, it may provide a direct communication link from the IIa MHC to the IIx MHC gene. If this were the case, an intact genomic locus would be required for proper transcriptional regulation of the IIx MHC gene. Thus the lack of promoter activity of the isolated IIx MHC promoter regions examined in the present study may be a consequence of this native genomic organization and may involve specific epigenetic regulatory mechanisms. Clearly, more research is necessary to expand the observations reported previously (21).

At this point in time, we conclude that the IIx MHC promoter-reporter activity in these transient transfections does not recapitulate the activity of the endogenous IIx MHC promoter, as reflected in the RNA products of the IIx MHC gene and as determined with use of both the Den and HS models of muscle disuse/inactivity. Such is also the case in comparing normal soleus and plantaris muscles. Our objective in reporting these negative findings is to bring awareness of the difficulties and pitfalls that may be encountered when using a direct gene transfer approach to study the IIx MHC promoter in vivo. It is unclear why characterization of this promoter has proved to be elusive with the techniques used thus far. However, proper regulation of the IIx MHC gene may rely on other distant regulatory elements, the neighboring embryonic, IIa, and/or IIb MHC genes, and/or epigenetic processes involving the native chromatin conformation of the endogenous IIx MHC promoter—gene regulatory strategies that are not encompassed in a short plasmid preparation. Future research should pursue these possibilities.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Supported by National Institute of Arthritis and Musculoskeletal and Skin Diseases Grant AR-30346 to K. M. Baldwin.


    ACKNOWLEDGMENTS
 
The authors thank Paul Bodell, Phuc Tran, LiYing Zhang, Toni Garma, Cori Kobayashi, Alvin Yu, Hongyan Guo, and Weihua Jiang for excellent technical assistance.


    FOOTNOTES
 

Address for reprint requests and other correspondence: K. M. Baldwin, Dept. of Physiology and Biophysics, Univ. of California, Irvine, CA 92697 (email: kmbaldwi{at}uci.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Allen DL, Weber JN, Sycuro LK, Leinwand LA. Myocyte enhancer factor-2 and serum response factor binding elements regulate fast myosin heavy chain transcription in vivo. J Biol Chem 280: 17126–17134, 2005.[Abstract/Free Full Text]

2. Baldwin KM, Haddad F. Effects of different activity and inactivity paradigms on myosin heavy chain gene expression in striated muscle. J Appl Physiol 90: 345–357, 2001.[Abstract/Free Full Text]

3. Bank A. Regulation of human fetal hemoglobin: new players, new complexities. Blood 107: 435–443, 2006.[Abstract/Free Full Text]

4. Caiozzo VJ, Baker MJ, Baldwin KM. Novel transitions in MHC isoforms: separate and combined effects of thyroid hormone and mechanical unloading. J Appl Physiol 85: 2237–2248, 1998.[Abstract/Free Full Text]

5. Caiozzo VJ, Baker MJ, Huang K, Chou H, Wu YZ, Baldwin KM. Single-fiber myosin heavy chain polymorphism: how many patterns and what proportions? Am J Physiol Regul Integr Comp Physiol 285: R570–R580, 2003.[Abstract/Free Full Text]

6. Caiozzo VJ, Haddad F, Baker M, McCue S, Baldwin KM. MHC polymorphism in rodent plantaris muscle: effects of mechanical overload and hypothyroidism. Am J Physiol Cell Physiol 278: C709–C717, 2000.[Abstract/Free Full Text]

7. Caiozzo VJ, Haddad F, Baker MJ, Baldwin KM. Influence of mechanical loading on myosin heavy-chain protein and mRNA isoform expression. J Appl Physiol 80: 1503–1512, 1996.[Abstract/Free Full Text]

8. Cheadle C, Fan J, Cho-Chung YS, Werner T, Ray J, Do L, Gorospe M, Becker KG. Stability regulation of mRNA and the control of gene expression. Ann NY Acad Sci 1058: 196–204, 2005.[CrossRef][Web of Science][Medline]

9. Corin SJ, Levitt LK, O'Mahoney JV, Joya JE, Hardeman EC, Wade R. Delineation of a slow-twitch-myofiber-specific transcriptional element by using in vivo somatic gene transfer. Proc Natl Acad Sci USA 92: 6185–6189, 1995.[Abstract/Free Full Text]

10. Elferink CJ, Reiners JJ Jr. Quantitative RT-PCR on CYP1A1 heterogeneous nuclear RNA: a surrogate for the in vitro transcription run-on assay. Biotechniques 20: 470–477, 1996.[Web of Science][Medline]

11. Giger JM, Haddad F, Qin AX, Baldwin KM. In vivo regulation of the beta-myosin heavy chain gene in soleus muscle of suspended and weight-bearing rats. Am J Physiol Cell Physiol 278: C1153–C1161, 2000.[Abstract/Free Full Text]

12. Giger JM, Haddad F, Qin AX, Baldwin KM. Functional overload increases beta-MHC promoter activity in rodent fast muscle via the proximal MCAT (betae3) site. Am J Physiol Cell Physiol 282: C518–C527, 2002.[Abstract/Free Full Text]

13. Haddad F, Qin AX, Zeng M, McCue SA, Baldwin KM. Interaction of hyperthyroidism and hindlimb suspension on skeletal myosin heavy chain expression. J Appl Physiol 85: 2227–2236, 1998.[Abstract/Free Full Text]

14. Huey KA, Roy RR, Baldwin KM, Edgerton VR. Temporal effects of inactivity on myosin heavy chain gene expression in rat slow muscle. Muscle Nerve 24: 517–526, 2001.[CrossRef][Web of Science][Medline]

15. Huey KA, Roy RR, Haddad F, Edgerton VR, Baldwin KM. Transcriptional regulation of the type I myosin heavy chain promoter in inactive rat soleus. Am J Physiol Cell Physiol 282: C528–C537, 2002.[Abstract/Free Full Text]

16. Konig S, Burkman J, Fitzgerald J, Mitchell M, Su L, Stedman H. Modular organization of phylogenetically conserved domains controlling developmental regulation of the human skeletal myosin heavy chain gene family. J Biol Chem 277: 27593–27605, 2002.[Abstract/Free Full Text]

17. Leszczynski JK, Esser KA. The MEF2 site is necessary for induction of the myosin light chain 2 slow promoter in overloaded regenerating plantaris muscle. Life Sci 73: 3265–3276, 2003.[CrossRef][Web of Science][Medline]

18. Matuszyk J, Ziolo E, Cebrat M, Kochel I, Strzadala L. Nurr1 affects pRL-TK but not phRG-B internal control plasmid in genetic reporter system. Biochem Biophys Res Commun 294: 1036–1039, 2002.[CrossRef][Web of Science][Medline]

19. Meyer S, Temme C, Wahle E. Messenger RNA turnover in eukaryotes: pathways and enzymes. Crit Rev Biochem Mol Biol 39: 197–216, 2004.[CrossRef][Web of Science][Medline]

20. Ovcharenko I, Loots GG, Giardine BM, Hou M, Ma J, Hardison RC, Stubbs L, Miller W. Mulan: multiple-sequence local alignment and visualization for studying function and evolution. Genome Res 15: 184–194, 2005.[Abstract/Free Full Text]

21. Pandorf CE, Haddad F, Roy RR, Qin AX, Edgerton VR, Baldwin KM. Dynamics of myosin heavy chain gene regulation in slow skeletal muscle: role of natural antisense RNA. J Biol Chem 281: 38330–38342, 2006.[Abstract/Free Full Text]

22. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45, 2001.[Abstract/Free Full Text]

23. Stevenson EJ, Koncarevic A, Giresi PG, Jackman RW, Kandarian SC. Transcriptional profile of a myotube starvation model of atrophy. J Appl Physiol 98: 1396–1406, 2005.[Abstract/Free Full Text]

24. Thomason DB, Herrick RE, Surdyka D, Baldwin KM. Time course of soleus muscle myosin expression during hindlimb suspension and recovery. J Appl Physiol 63: 130–137, 1987.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
C. Rinaldi, F. Haddad, P. W. Bodell, A. X. Qin, W. Jiang, and K. M. Baldwin
Intergenic bidirectional promoter and cooperative regulation of the IIx and IIb MHC genes in fast skeletal muscle
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2008; 295(1): R208 - R218.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/4/C1338    most recent
00221.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pandorf, C. E.
Right arrow Articles by Baldwin, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pandorf, C. E.
Right arrow Articles by Baldwin, K. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.