Am J Physiol Cell Physiol AJP: Heart and Circulatory Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 293: C1160-C1170, 2007. First published July 5, 2007; doi:10.1152/ajpcell.00578.2006
0363-6143/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/3/C1160    most recent
00578.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Polk, W. W.
Right arrow Articles by Woods, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Polk, W. W.
Right arrow Articles by Woods, J. S.

RECEPTORS AND SIGNAL TRANSDUCTION

RhoA regulation of NF-{kappa}B activation is mediated by COX-2-dependent feedback inhibition of IKK in kidney epithelial cells

William W. Polk, Maureen E. Ellis, John V. Kushleika, P. Lynne Simmonds, and James S. Woods

Department of Environmental and Occupational Health Sciences, University of Washington, Seattle, Washington

Submitted 16 November 2006 ; accepted in final form 4 July 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Numerous studies have demonstrated a central role of renal tubular epithelial cells in the etiology of kidney injury and disease through the elaboration of inflammatory mediators. However, little is known about the cellular signaling mechanisms involved in this process. In this study we employed normal rat kidney epithelial (NRK52E) cells to identify a novel LPS-induced signaling pathway in which RhoA-mediated AP-1 activity promotes expression of cyclooxygenase-2 (COX-2) with consequent feedback inhibition of NF-{kappa}B activation through IKKbeta. Inhibition of RhoA signaling using either the RhoA kinase inhibitor Y-27632 or a dominant negative mutant of RhoA (RhoA-DN) dramatically extended the duration of p65-DNA binding, I{kappa}B{alpha} phosphorylation, and IKKbeta activity following LPS treatment. Prolongation of events associated with NF-{kappa}B activation was also observed in cells pretreated and/or cotransfected with the JNK inhibitor SP600125 or deletion mutants of MEKK1 (MEKK1-KD) or Jun (Jun-DN). Conversely, constitutive expression of RhoA prevented NF-{kappa}B activation by LPS, and this effect was reversed by cotransfection with MEKK1-KD. In addition, we found that the RhoA/AP-1 signaling axis plays a necessary role in COX-2 expression by LPS and that this effect is independent of NF-{kappa}B activation. Moreover, inhibition of COX-2 activity results in persistent p65-DNA binding, I{kappa}B{alpha} phosphorylation, and IKKbeta activity, similar to that observed after prevention of RhoA/AP-1 axis signaling. These findings suggest that COX-2 links the RhoA/AP-1 signaling cascade to NF-{kappa}B activation, thereby defining a novel integrated model for regulation of the inflammatory response of kidney epithelial cells to LPS and potentially other external stimuli.

AP-1; cyclooxygenase-2; inflammation; lipopolysaccharide, nuclear factor-{kappa}B; I{kappa}B kinase


NUCLEAR FACTOR-{kappa}b (NF-{kappa}B) is a pleiotrophic transcriptional activator that is known to be involved in the inducible expression of a wide variety of genes, including those that mediate inflammatory responses (3, 40). Although much attention has focused on the role of NF-{kappa}B in these functions in endothelial and immunological cells, relatively few studies have investigated signaling mechanisms underlying regulation of NF-{kappa}B activation by inflammatory agents in epithelial cells of renal tubular origin. Identification of such mechanisms is of increasing interest in light of emerging evidence that renal tubular epithelial cells play a central role in the etiology of both acute and chronic kidney diseases through expression of inflammatory mediators and attractants that are produced in association with NF-{kappa}B activation (14, 43).

NF-{kappa}B is retained in the inactive form in the cytoplasm by the inhibitor I{kappa}B. Upon stimulation by various agents, I{kappa}B undergoes phosphorylation, targeting it for ubiquitination and degradation by the proteasome (22, 25). NF-{kappa}B is readily activated in renal tubular epithelial cells by numerous proinflammatory agents, including bacterial lipopolysaccharide (LPS) and tumor necrosis factor-{alpha} (TNF-{alpha}) (2, 18, 45). However, the mechanisms regulating this response are poorly understood. Recently, several reports have noted concomitant activation of small G proteins of the Rho super family (RhoA, Rac, Cdc42) by inflammatory cytokines and LPS in epithelial and other cell types (27, 42), suggesting their possible involvement in the regulation of the inflammatory response. Of particular interest is the association of RhoA in signaling events with the activation of various transcription factors, including NF-{kappa}B (4, 27, 30). In addition, it has been reported that inhibition of RhoA signaling results in superinduction of the inducible form of nitric oxide synthetase (iNOS) (20, 44), upregulation of which is known to require the activation of coordinately regulated NF-{kappa}B and Jun proteins comprising the AP-1 family of leucine zipper transcription factors (20, 30). RhoA impacts AP-1 through MEKK1, a MAPKKK that activates c-Jun through SAPK/JNK and inhibits Jun transcription (12, 16, 27). A mechanistic association of AP-1 and NF-{kappa}B has been suggested (37, 41); however, it has not been established how or if RhoA-mediated AP-1 activation impacts NF-{kappa}B signaling.

Like iNOS, cyclooxygenase-2 (COX-2) has been shown to be regulated by c-Jun, a principal constituent of AP-1 (8, 10, 36). COX-2, however, is unique among the genes upregulated by AP-1 in that it displays both anti-inflammatory and proinflammatory actions within the same cell type (29). The proinflammatory action of COX-2 has been thoroughly reviewed (19). The anti-inflammatory action of COX-2 appears to be mediated through formation of cyclopentenone prostaglandins, e.g., PGJ2, which have been shown to facilitate an inhibitory feedback loop in the NF-{kappa}B pathway by directly inhibiting I{kappa}B kinasebeta (IKKbeta) activity (31, 38).

In the experiments described in this report, we used normal rat kidney epithelial (NRK52E) cells to test the hypothesis that RhoA-stimulated AP-1 activity promotes COX-2 expression and consequent feedback inhibition of NF-{kappa}B activation through IKKbeta. We have shown that RhoA inhibits IKKbeta through activation of the MEKK1/JNK/AP-1 axis and, moreover, that inhibition of RhoA signaling prolongs NF-{kappa}B-DNA binding by promoting IKKbeta activity independently of the resynthesis of I{kappa}B{alpha} or NF-{kappa}B transactivation. Thus RhoA-mediated COX-2 expression is both sufficient and necessary for inhibition of NF-{kappa}B-DNA binding. These findings demonstrate that COX-2 links the Rho/AP-1 signaling cascade to NF-{kappa}B activation and thereby define a novel integrated model for regulation of the inflammatory response of kidney epithelial cells to external stimuli.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell culture and treatments. NRK52E cells, a clonal line established from normal rat tubular epithelial cells (ATCC no. CRL-1571), were acquired from the American Type Culture Collection (Manassas, VA). Cells were propagated in Dulbecco's modified Eagle's medium (DMEM) with high glucose, pyruvate, and L-glutamate (Invitrogen, Carlsbad, CA), supplemented with 5% heat-inactivated newborn calf serum and 2% fetal calf serum (Invitrogen) plus 100 U/ml penicillin and 100 µg/ml streptomycin (Sigma-Aldrich, St. Louis, MO). Cell monolayer mats were grown in polystyrene six-well plates or in 25- and 75-cm2 cant-necked, vent-cap, uncoated flasks (Corning, Corning, NY), and passages were facilitated with 0.25% trypsin-EDTA (Invitrogen). Treatments were performed when cell mats covered 80–95% of the flask surface. NRK52E cells were pretreated with 30 µM RhoA kinase inhibitor Y-27632 [(R)-(+)-trans-N-4-pyridyl-4-(1-aminoethyl)-cyclohexane-carboxamide, dihydrochloride], geranylgeranyl transferase inhibitor (GGTI-298) (Calbiochem/EMD Biosciences, La Jolla, CA), JNK inhibitor II {anthra[1,9-cd]pyrazol-6(2H)-one; SP600125}, or the COX inhibitors indomethacin [1-(4-chlorobenzoyl)-5-methoxy-2,3-indole acetic acid] (Sigma) or COX-2 inhibitor II {4-[(5-difluoromethyl-3-phenyl)-4-isoxazoly]benzenesulfonamide; SC-791} (Calbiochem) for 30–60 min or overnight (GGTI) before stimulation with 1 µg/ml LPS from Escherichia coli serotype 026:B6 (Sigma). Treatment agents were solubilized in either endotoxin-free water or dimethyl sulfoxide (DMSO) (Sigma), and treatment stocks were made up such that most treatment volumes were 1 µl/ml culture medium. Rat IFN-{gamma} (Calbiochem) was solubilized in sterile phosphate-buffered saline with 0.1% bovine serum albumin and administered to cultures at 100–300 U/ml in conjunction with LPS for iNOS studies. All other drugs and chemicals were obtained from standard commercial sources and met cell culture and molecular biology requirements. Cells were harvested at times indicated after LPS treatment.

EMSA and autoradiography. To evaluate NF-{kappa}B bound to the nuclear DNA, nuclear protein fractions were collected from the treated cultures and processed as previously described (45). For signal generation, a Promega (Madison, WI) NF-{kappa}B oligonucleotide double-stranded probe was end-labeled with [{gamma}-P32]dATP using T4 kinase (Roche, Indianapolis, IN). The radiolabeled probe was separated from free nucleotide using a TE Micro Select-D G-25 microcentrifuge spin column (IBI, Shelton, CT) according to manufacturer's instructions. Binding reactions between sample proteins and the prepared probe were performed as described (45) and assayed using Novex (Invitrogen) 6% Tris-borate-EDTA (TBE) precast gels, 0.5x TBE running buffer, and Hi-Density TBE sample buffer. Gels were run at 80–100 V until the bromphenol blue dye front traveled at least 75% of the gel length and then were dried. Autoradiograms of protein migration patterns were generated and analyzed as described (45).

Western blot analyses. Cells were lysed in solution I as described by DiDonato (17), supplemented with 0.1% Triton X-100 and 1 µl/ml phosphatase inhibitor cocktails 1 and 2 (Sigma). The Western protocol was a modification of that previously described (18). Briefly, 10–40 µg of protein were separated by electrophoresis, transferred onto polyvinylidene difluoride, and then probed with the appropriate primary antibody. The blots were developed using SuperSignal West Pico chemiluminescent substrate (Pierce, Rockford, IL) as described by the manufacturer. All secondary antibodies and the COX-2, iNOS, and p65 primary antibodies were acquired from Santa Cruz Biotechnology (Santa Cruz, CA). The anti-I{kappa}B{alpha} and phospho phospho-S32/36-I{kappa}B{alpha} were obtained from Cell Signaling Technology (Beverly, MA). Blots were stripped with ChemiStrip (Chemicon International, Temecula, CA) and reblotted. Equal protein loading was confirmed using the bicinchoninic acid determination (BCA assay; Pierce).

IKK activity assay. IKK activity was determined using a modification of the assay described by DiDonato (17) as follows. Cells were lysed in modified solution I as described above. The lysates were incubated on ice for 10 min, sonicated, and cleared by centrifugation at 15,000 g for 10 min. The IKK complex was immunoprecipitated from 500 µg of total protein by tumbling for 2 h at 4°C with either 1 µg of anti-IKKbeta (Upstate Biotechnology, Lake Placid, NY) or 1.5 µg of anti-IKK{alpha} (Santa Cruz Biotechnology) per sample. The samples were then tumbled for 1 h at 4°C with 30 µl of protein L-agarose (Santa Cruz Biotechnology) or protein A-agarose Plus (Pierce) beads. The tubes were spun for 30 s at 15,000 g and washed four times, twice in solution I and twice in kinase buffer (20 mM beta-glycerophosphate, 10 mM MgCl2, 0.1 mM Na3VO4, 10 mM p-nitrophenyl phosphate, 50 mM NaCl, 2 mM DTT, 1 µl/ml protease inhibitor cocktail, and 20 mM HEPES-NaOH, pH 7.6). After each wash, the beads were pelleted and the supernatant was completely removed. The resultant pellets were incubated in a shaking water bath for 10 min at 37°C in 25 µl of kinase buffer supplemented with 1–2 µg/ml glutathione S-transferase-I{kappa}B{alpha} (Santa Cruz Biotechnology), 20 µM ATP, and 5 µCi of [{gamma}-32P]ATP. Samples were loaded with LDS sample buffer (Invitrogen) and resolved by TBE gel electrophoresis (45). Equal loading of IKK was confirmed by Coomassie blue staining (Sigma).

Transfection studies. NRK52E cells were transfected using Effectene (Qiagen, Valencia, CA) according to the manufacturer's protocol. For stable transfection, mixed colonies were selected with geneticin (Invitrogen) across 3 wk before culturing for experiments. The sequence of the AP-1 decoy was GGATCCATGACTCAGAAGACGACACACGTCTTCTGAGTCAT, as described by Ahn et al. (1) and synthesized by Midland Certified Reagent (Midland, TX). The sequence of the NF-{kappa}B decoy was GGATCCGGGACTTTCCAAGACGACACACGTCTTGGAAAGTCCC. The dominant negative Jun (Jun-DN) lacking the transactivation domain (TAM67) was a gift of Dr. Michael Birrer (University of Washington, Seattle, WA). The COX-2-expressing plasmid (Cox-2-CA) was a gift of Dr. Timothy Hla (University of Connecticut, Farmington, CT). The plasmid expressing IKKbeta-DN was provided by Amgen (Thousand Oaks, CA). The RhoA dominant negative (Rho-DN; RhoN19) and RhoA constitutively active (Rho-CA; RhoL63) expression plasmids were a gift of Dr. Scott Weed (Colorado Health Sciences University, Denver, CO). The kinase-dead (MEKK1-KD) and constitutively active forms of MEKK1 (HA-MEKK1) were generously provided by Dr. Gary Johnson (University of North Carolina, Chapel Hill, NC). Plasmids containing a construct composed of a 4x tandem repeat of the NF-{kappa}B promoter response element inserted upstream of the coding region of a firefly luciferase gene in pGL2-basic (p4x-NF-{kappa}B-luc) as well as the control vector (pCDNA 3) were provided by Dr. Nelson Fausto (University of Washington, Seattle, WA).

Statistical analyses. The difference between treatment groups was evaluated using Student's t-test, with statistical significance set at P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Inhibition of RhoA signaling prolongs NF-{kappa}B-DNA binding. In initial studies, we determined that inhibition of RhoA signaling promotes persistent LPS-induced NF-{kappa}B-DNA binding. As shown in Fig. 1A, treatment of cells with LPS alone induced maximal NF-{kappa}B-DNA binding at 15–30 min, followed by a rapid decline in binding intensity to 15% of maximal at 1 h and to untreated levels by 3 h. Pretreatment of cells with the Rho kinase inhibitor Y-27632 did not alter the time course of NF-{kappa}B activation by LPS, but rather increased and prolonged the binding intensity up to 4 h (Fig. 1B). Comparable findings were made following LPS treatment of cells stably transfected with the Rho-DN expression vector (Fig. 1C) and with cells pretreated with the geranylgeranyl transferase inhibitor GGTI-298 (not shown), confirming involvement of RhoA signaling in this effect. Similar observations were made with respect to nuclear p65 levels (Fig. 1, D–F). Together, these findings support the view that RhoA acts to prevent sustained NF-{kappa}B activation and that inhibition of RhoA signaling results in the prolonged NF-{kappa}B-DNA binding observed following LPS treatment.


Figure 1
View larger version (56K):
[in this window]
[in a new window]

 
Fig. 1. Inhibition of RhoA signaling prolongs NF-{kappa}B-DNA binding. A: wild-type NRK52E cells treated with endotoxin-free water (control vehicle) or LPS (1 µg/ml culture medium) were harvested for preparation of nuclear extracts and analysis of NF-{kappa}B-DNA binding by gel mobility shift assays (EMSAs) at the times indicated following vehicle or LPS administration. NT, not treated (vehicle). B: cells were pretreated with the Rho kinase inhibitor Y-27632 (Y27; 30 µM) for 1 h before LPS administration. EMSAs were performed at the times indicated following DMSO (vehicle) or LPS treatment. C: cells were stably transfected with plasmids expressing the dominant negative form of RhoA (Rho-DN) as described and harvested for preparation of nuclear extracts at the times indicated following vehicle or LPS administration. D–F: cells were treated as in A–C, respectively, for the indicated times. Subsequently, cells were harvested and nuclear extracts were analyzed by Western blot immunoassays using antibody specific for p65. Plots illustrate optical band densities (OD) x 1,000 for DNA binding or nuclear protein levels. Data are representative of at least 3 individual sets of experiments. *P < 0.05; §P < 0.05, significantly different from LPS alone at 30, 60, 120, and 180 min. #P < 0.05; ¶P < 0.05; significantly different from LPS alone at 15, 30, 60, 120, and 180 min.

 
RhoA inhibits NF-{kappa}B-DNA binding through activation of MEKK1/JNK/AP-1. Previous studies have shown that NF-{kappa}B signaling in renal epithelial cells is inhibited by activation of c-Jun, a principal constituent of AP-1 (32). Since RhoA can impact expression and activation of c-Jun (6, 13, 26) through the MEKK1/JNK axis (21, 47), we hypothesized that the persistent NF-{kappa}B-DNA binding observed following inhibition of RhoA is dependent on this cascade. To examine this possibility, we undertook studies to define the role of the MEKK1/JNK axis in the observed RhoA-inhibition of NF-{kappa}B-DNA binding and of AP-1 as mediator of this effect. As shown in Fig. 2A, stable transfection of cells with Rho-CA largely prevented the activation of NF-{kappa}B-DNA binding observed following LPS treatment of wild-type cells or cells transfected with the empty vector (Fig. 1A), whereas cotransfection with MEKK1-KD overcame the inhibition of NF-{kappa}B activation by LPS in Rho-CA-transfected cells (Fig. 2B). Moreover, as shown in Fig. 2, C and D, inhibition of the JNK activity by SP600125 or stable transfection of cells with Jun-DN, respectively, permitted sustained LPS-induced NF-{kappa}B-DNA binding without affecting early NF-{kappa}B activation kinetics, comparable to that observed after Y-27632 pretreatment or stable transfection with Rho-DN. In addition, transfection of cells with HA-MEKK1 prevented sustained NF-{kappa}B-DNA binding observed 2–4 h after LPS administration to cells cotransfected with Rho-DN (Fig. 2E). In additional studies, pretreatment of cells with Y-27632 largely prevented activation of AP-1 by LPS, as measured by AP-1-DNA binding (Fig. 2, F and G). Together, these findings demonstrate that in kidney epithelial cells, RhoA mediates LPS-induced NF-{kappa}B-DNA binding in a MEKK1- and JNK-dependent manner and support the participation of AP-1 in this effect.


Figure 2
View larger version (38K):
[in this window]
[in a new window]

 
Fig. 2. Cyclosporin A blocks the increase in aconitase activity following repeated contractions in mouse EDL muscle. A: values are means ± SE for 6 muscles. Muscles were exposed to 10 µM cyclosporin A (filled bars) or diluent (open bars) for 40 min. Half the muscles were stimulated to perform repeated contractions during the last 10 min of incubation. *P < 0.05. B: force recordings during the 10 min of repeated contractions in control ({circ}) and cyclosporin A-treated (bullet) muscles. Values are means ± SE for 6 muscles.

 
RhoA/JNK/AP-1 signaling inhibits NF-{kappa}B-DNA binding through IKKbeta. To further examine the mechanism by which inhibition of RhoA signaling promotes persistent NF-{kappa}B activation in kidney epithelial cells, we studied the consequences of RhoA inhibition on the upstream NF-{kappa}B effectors I{kappa}B{alpha} and IKKbeta. As shown in Fig. 3A, we found that the phosphorylated form of I{kappa}B{alpha}, which is detectable at only very low levels in untreated wild-type cells, increased rapidly within 5–10 min and then declined to control (untreated) values within 30 min after LPS administration. In contrast, in cells stably transfected with Rho-DN, we observed substantially more robust phosphorylation of I{kappa}B{alpha} immediately following LPS treatment (Fig. 3B). Moreover, despite a rapid decline from peak levels, I{kappa}B{alpha} phosphorylation was sustained for at least 4 h after LPS treatment of Rho-DN cells at levels three to six times those observed in comparably treated wild-type cells.


Figure 3
View larger version (34K):
[in this window]
[in a new window]

 
Fig. 3. Aconitase in mouse EDL muscle is phosphorylated on serine residues. Muscle extracts were immunoprecipitated with aconitase and after electrophoresis were blotted with antibody against phosphoserine (p-Ser). First lane, negative control of a muscle extract not immunoprecipitated with aconitase; 2nd–5th lanes, paired EDL muscles in the basal state and after repeated contractions (Stim).

 
Consistent with these observations, we found that cytosolic I{kappa}B{alpha} was maximally degraded within ~15 min after LPS treatment of wild-type cells, and this was followed by resynthesis of I{kappa}B{alpha} to near basal levels during the subsequent 1- to 2-h posttreatment period (Fig. 3C). Similar observations were made with respect to the early course of I{kappa}B{alpha} degradation following LPS treatment of cells stably transfected with Rho-DN. However, as shown in Fig. 3D, subsequent I{kappa}B{alpha} resynthesis was not impaired in Rho-DN cells but was instead enhanced at 1–3 h following LPS treatment, possibly as a consequence of prolonged NF-{kappa}B-DNA binding (Fig. 1F). Similar findings were observed after inhibition of RhoA signaling using Y-27632 (not shown). These findings suggest that RhoA signaling normally limits the duration of NF-{kappa}B activation in kidney epithelial cells by reducing the rate of I{kappa}B{alpha} phosphorylation following LPS treatment.

To further investigate the mechanistic etiology of altered NF-{kappa}B activation by RhoA inhibition, we evaluated the consequences of impaired RhoA signaling on the kinetics of IKKbeta activation. As observed in Fig. 3E, LPS treatment induced rapid but transient activation of IKKbeta, with maximal activity observed within 5–10 min following LPS treatment of wild-type cells, consistent with the kinetics of I{kappa}B{alpha} phosphorylation (Fig. 3A). Rho-DN transfection both enhanced the initial rate of IKKbeta activation and promoted sustained IKKbeta activity for up to 4 h following LPS treatment (Fig. 3F). Similar results were obtained following LPS administration to cells pretreated with Y-27632 (gel not shown). These observations suggest that RhoA normally acts to restrict or inhibit IKKbeta activity and that prolonged IKKbeta activation associated with inhibition of RhoA signaling is sufficient to promote sustained NF-{kappa}B-DNA binding (Fig. 1, A–C).

To demonstrate further that the inhibitory effects of RhoA signaling are mediated predominantly through AP-1, we evaluated the consequences of impaired AP-1 signaling on the kinetics of IKKbeta activation. Consistent with effects described above on NF-{kappa}B-DNA binding (Fig. 2D), stable transfection of cells with Jun-DN resulted in sustained IKKbeta activity following LPS treatment (Fig. 3G). Similar findings were observed following LPS administration to cells pretreated with the JNK inhibitor SP600125 (not shown).

RhoA signaling inhibits NF-{kappa}B-mediated transcription and gene expression. To address the specificity of RhoA signaling on NF-{kappa}B activation through IKKbeta, we evaluated the role of RhoA on NF-{kappa}B transactivation and subsequent gene expression. As shown in Fig. 4A, {kappa}B-driven luciferase activity was significantly increased at 4 h following treatment of wild-type cells with LPS. Notably, pretreatment with either SP600125 or prior transfection with Rho-DN promoted significantly increased activation of {kappa}B luciferase by LPS, compared with that observed in wild-type cells alone. Moreover, as shown in Fig. 4, B and C, expression of the NF-{kappa}B-mediated gene iNOS was increased at 4 h following co-administration of LPS and IFN-{gamma}, and Y-27632 or SP600125 pretreatment significantly potentiated this effect. We obtained comparable results when substituting Y-27632 pretreatment for Rho-DN transfection or transfection with Jun-DN for SP600125 pretreatment for the experiments described in Fig. 4A and when measuring TNF-{alpha} mRNA in place of iNOS protein, as described in Fig. 4, B and C (data not shown). These findings indicate that RhoA modulates NF-{kappa}B transactivation and gene expression via components of the Jun/AP-1 signaling axis in kidney epithelial cells.


Figure 4
View larger version (31K):
[in this window]
[in a new window]

 
Fig. 4. RhoA signaling inhibits NF-{kappa}B-mediated transcription and gene expression. A: wild-type cells or cells stably transfected with the Rho-DN or control vectors, as described in legends to Fig. 1, were transiently transfected with the 4x-NF-{kappa}B-driven luciferase reporter plasmid and a Renilla reniformas reference vector. Luciferase measurements were made for wild-type cells, cells pretreated with SP600125 (30 µM), and cells transfected with Rho-DN with or without 4-h exposure to 1 µg/ml LPS. NF-{kappa}B-driven luciferase values were normalized to Renilla luciferase activity and expressed as ratio-induction x 1,000. B and C: inducible nitric oxide synthase (iNOS) protein levels were determined by Western blot analysis in wild-type cells and in cells pretreated with Y-27632 (30 µM) or SP600125 (30 µM) before costimulation (I/L) with LPS (1 µg/ml) and rat IFN-{gamma} (Ifn; 100 U/ml). Data are means ± SD of at least 3 replicate experiments. Analysis of differences between treatment groups was determined using a paired, 1-tailed t-test. *P < 0.05, significantly different from I/L alone.

 
COX-2 expression is RhoA/AP-1 dependent but NF-{kappa}B independent. To identify the specific mechanistic site(s) through which RhoA signaling translates to impaired NF-{kappa}B activation, we observed findings from published studies (9, 35, 46) suggesting that control of COX-2 gene transcription in various cell types requires concomitant regulation by NF-{kappa}B and AP-1. To clarify the association of NF-{kappa}B and Rho/AP-1 signaling with COX-2 expression in kidney epithelial cells, we first investigated the effects of inhibition of IKKbeta/NF-{kappa}B and RhoA/AP-1 signaling axes, respectively, on COX-2 activation by LPS. As shown in Fig. 5A, COX-2 expression, as determined by Western blot analysis of COX-2 protein levels, was significantly increased within 2 h following treatment with LPS and continued to increase during the subsequent 2-h period. Unexpectedly, however, neither transient transfection with the IKKbeta-DN (Fig. 5B), at a concentration that prevented p65-DNA binding and activation of {kappa}B luciferase, nor treatment of wild-type cells with an NF-{kappa}B decoy (Fig. 5D) inhibited LPS-induced COX-2 gene expression. This finding was further demonstrated by treatment of wild-type cells with the specific IKKbeta inhibitor BMS-345541 (Calbiochem) before LPS administration (not shown). In contrast, stable transfection of cells with Rho-DN or Jun-DN completely prevented COX-2 expression as measured by Western analysis of COX-2 protein levels (as shown) or, alternatively, by TaqMan analysis of COX-2 mRNA (adjusted for GAPDH mRNA) at all time points following LPS administration. In addition, treatment of cells with an AP-1 decoy (Fig. 5C) prevented induction of COX-2 by LPS. Moreover, COX-2 mRNA and protein levels as well as AP-1-DNA binding intensity were significantly elevated 1.5-, 2-, and 2.3-fold, respectively, in cells transfected with either Rho-CA or HA-MEKK1 (data not shown). These findings collectively demonstrate that the RhoA/JNK/AP-1 signaling axis plays a necessary role in LPS-induced COX-2 expression in kidney epithelial cells and that this effect is independent of NF-{kappa}B activation.


Figure 5
View larger version (37K):
[in this window]
[in a new window]

 
Fig. 5. Cyclooxygenase-2 (COX-2) expression is RhoA/AP-1 dependent but NF-{kappa}B independent. Wild-type cells (A) or cells stably transfected with plasmids expressing IKKbeta-DN (B), Rho-DN (not shown), or Jun-DN (not shown) or pretreated with decoys to AP-1 (C) or NF-{kappa}B (D) were treated with vehicle or LPS (1 µg/ml). Cell lysates were prepared at the times indicated after LPS administration and analyzed by immunoblotting for COX-2. Data are representative of at least 3 individual sets of experiments. #P < 0.05; §P < 0.05, significantly different from LPS alone at all times except 0 and 30 min. ¶P < 0.05, significantly different from LPS alone at 60, 120, 180, and 240 min.

 
COX-2 prevents NF-{kappa}B activation by inhibiting IKKbeta activity. The above findings suggest that RhoA signaling might impair NF-{kappa}B activity via COX-2 activation. To evaluate this possibility, we investigated whether inhibition of COX-2 activity results in prolongation of NF-{kappa}B activation similar to that observed following inhibition of RhoA signaling. As shown in Fig. 6, A and B, treatment of cells with the general COX inhibitor indomethacin or the highly specific COX-2 inhibitor II before LPS administration resulted in prolonged IKKbeta activation at times up to 4 h after LPS administration. Similar observations were made with respect to NF-{kappa}B activation (Fig. 6C), comparable to findings observed in cells pretreated with Y-27632 and SP600125 or stably expressing Rho-DN. In addition, transient transfection of cells with a COX-2 expression vector completely prevented activation of NF-{kappa}B by LPS (Fig. 6D). These findings collectively support the view that COX-2 expression is sufficient to prevent prolonged NF-{kappa}B activation in kidney epithelial cells. They also strongly imply that COX-2 is both necessary and sufficient to facilitate feedback inhibition generated by the activation of RhoA downstream of LPS.


Figure 6
View larger version (39K):
[in this window]
[in a new window]

 
Fig. 6. COX-2 prevents NF-{kappa}B activation by inhibiting IKKbeta activity. A and B: wild-type cells were pretreated with the general COX inhibitor indomethacin (Indo; 30 µM) (A) or the highly specific COX-2 inhibitor II (COX-2 Inhib-II; 200 nM) (B) for 1 h before LPS administration as described in the legend to Fig. 1. Cell lysates were prepared at the times indicated after DMSO (vehicle) or LPS treatment, and IKK activity was determined as described in the legend to Fig. 3. Kinase activity is expressed as relative induction of activity in cells treated with vehicle. IKK activity in cells treated with LPS alone, as described in the legend to Fig. 3E, is shown for comparison. C and D: wild-type cells were pretreated with Indo (30 µM) (C) for 1 h or stably transfected with plasmids expressing COX-2 activity (COX-2-CA) (D). Cells were harvested for preparation of nuclear extracts and analysis of NF-{kappa}B-DNA binding at the times indicated following vehicle or LPS administration. Data are representative of at least 3 individual sets of experiments. *P < 0.05, significantly different from LPS alone at all times except 0 min. #P < 0.05, significantly different from LPS alone at 60, 120, 180, and 240 min. §P < 0.05, significantly different from LPS alone at 30 min.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Numerous studies have suggested a regulatory role for RhoA signaling in NF-{kappa}B activation and NF-{kappa}B-mediated inflammatory gene expression in various cell types (4, 8, 28, 30). A role of the Rho/MEKK1/ JNK/AP-1 signaling axis in COX-2 expression in various cell models has also been reported (10, 28, 42). This study is the first to our knowledge to demonstrate that RhoA-mediated inhibition of NF-{kappa}B activation is dependent on the MEKK1/AP-1 signaling axis and to identify COX-2 expression a critical mediator of this process. These observations define a novel integrated model for the regulation of the inflammatory response of kidney epithelial cells to external stimuli, as depicted in Fig. 7, and suggest a plausible mechanistic explanation for the previously described anti-inflammatory actions of JNK pathway constituents (4, 14, 32, 38).


Figure 7
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 7. Integrated model for regulation of NF-{kappa}B activation and NF-{kappa}B-mediated inflammatory response by the Rho/AP-1 signaling axis. LPS and possibly other inflammatory stimuli activate COX-2 via the RhoA/AP-1 signaling axis. Activation of COX-2 leads to inhibition of NF-{kappa}B activation and suppression of the coordinately activated NF-{kappa}B-mediated inflammatory response. Dotted line suggests tentative or hypothetical mechanism PP, polyphosphorylation of the membrane receptor complex.

 
Recent studies have demonstrated a central role for COX-2 and specific products of COX-2 activity in regulating IKK as well as other sites of the NF-{kappa}B activation pathway in various cell types (7, 23, 29, 38). The precise COX-2 products that mediate IKK inhibition in the kidney epithelial cell model employed in the present studies remain to be identified. The most likely candidates are the cyclopentenone prostaglandins that include PGJ2 and its metabolites, the ring systems of which contain an electrophilic carbon that can react covalently with free SH groups of cellular proteins, specifically those of IKKbeta (31, 38). Notably, 15-deoxy-{Delta}12,14-prostaglandin J2 (15d-PGJ2) has been reported to inhibit IKKbeta activity and subsequent I{kappa}B{alpha} degradation in TNF-{alpha}- or 12-O-tetradecanoylphorbol-13-acetate-stimulated Jurkat, COS-7, or HEK-293 cell lines (31). Alternatively, analogs of prostaglandin A have also been shown to inhibit NF-{kappa}B activity (29). The finding of abundant COX-2 expression by renal proximal tubular cells following treatment with LPS as observed in the present study supports the likely participation of these anti-inflammatory prostaglandins in this process. In addition, preliminary studies undertaken with exogenously added prostaglandins have suggested that multiple prostaglandins, including 15d-PGJ2, must be present for efficient termination of NF-{kappa}B-DNA binding (data not shown).

As depicted in Fig. 1, NF-{kappa}B-DNA binding and p65 translocation are enhanced in Rho-DN-transfected cells within 30 min following LPS treatment but before COX-2 induction. The most likely explanation for this response is that products of constitutively active COX-2 act to inhibit IKKbeta activity and that concentrations of these products are lower in Rho-DN cells because of decreased constitutive COX-2 expression, as depicted in Fig. 7. In this case, the direct action of LPS on IKKbeta is countered by products of COX-2 to a lesser extent than in wild-type cells, accounting for the higher IKK activity and NF-{kappa}B binding observed in Rho-DN cells shortly following LPS treatment. This explanation is supported by the findings of no detectable COX-2 expression (either protein or mRNA) in Rho-DN cells (Fig. 5) and, conversely, elevated COX-2 expression (both protein and mRNA) in Rho-CA cells compared with wild type.

This study further defines a role for AP-1 in the RhoA-mediated activation of COX-2 by LPS in kidney epithelial cells. The current observations are consistent with those of Schmeck et al. (34) describing the requirement of RhoA in LPS-induced COX-2 expression and of Marinissen et al. (26) showing that RhoA stimulates JNK activation through RhoA kinase with subsequent increased expression of AP-1 proteins. The present studies extend these findings in demonstrating the requisite role of RhoA in LPS-mediated AP-1 activation and the association of these events with COX-2 expression in renal epithelial cells. The finding that signaling downstream of RhoA is prevented by inhibition of MEKK1, JNK, or AP-1 is consistent with the hypothesis that AP-1 is necessary for the signaling activity of RhoA leading to COX-2 expression and consequent modulation of NF-{kappa}B activity.

Although a primary role of RhoA in LPS-mediated AP-1 activation is demonstrated from the present findings, the involvement of JNK as a direct participant in this process is less clear. The current findings involving TAM67 Jun-DN support the role of AP-1 more so than of JNK per se, since TAM67 acts specifically to limit the availability of AP-1 binding partners in the formation of functional heterodimers but does not contain the JNK interacting NH2 terminus and therefore should not act as a specific dominant negative to JNK (5). Moreover, inhibition of RhoA signaling via Rho-DN or Y-27632 only partially inhibited phosphorylation of JNK at the T183/Y185 sites in these studies (data not shown), also questioning a predominant role of JNK activation in this process. In addition, whereas only short-term incubation of cells with Y-27632 was required for LPS-mediated prolongation of NF-{kappa}B-DNA binding, overnight treatment with the JNK inhibitor SP600125 was sometimes required to elicit the same results, also suggesting an indirect or limited role for JNK in RhoA signaling to AP-1. Notably, MEKK1 has been reported to modulate AP-1 binding partners independently of JNK activation (13). Studies are in progress to clarify the role of JNK in RhoA-mediated AP-1 activation and COX-2 expression in the present cell model.

The present observations regarding signaling mechanisms involved in the resolution of LPS-induced NF-{kappa}B activity are of particular interest in light of emerging evidence that renal tubular epithelial cells are principal mediators of the inflammatory response and, hence, may play a central role in the etiology of numerous renal diseases, particularly those involving exposure to infectious agents (15, 40, 43). Inasmuch as persistent inflammatory reactions increase the potential for tissue damage, it is reasonable that cell-specific strategies have evolved to mitigate inflammation in response to external stimuli. The findings presented suggest one such strategy in which a novel feedback inhibitory loop terminates LPS-stimulated inflammatory signaling through regulation of COX-2 expression by the Rho/MEKK1/AP-1 signaling axis. This process does not minimize the importance of the previously described I{kappa}B{alpha} and transactivation paradigms (24, 39, 48) but instead proposes an alternative mechanism for obligatory termination of prolonged NF-{kappa}B signaling. Other studies have demonstrated that I{kappa}B{alpha} is incapable of removing p65 when phosphorylated on S536 (33), consistent with the present findings. As an IKK-dependent event, phosphorylation of S536 represents the more plausible method of prolonging p65-DNA binding despite the increased levels of I{kappa}B{alpha} observed.

In conclusion, the present findings demonstrate that RhoA activates COX-2 via the MEKK1/AP-1 signaling axis and that this process subsequently results in COX-2-mediated inhibition of NF-{kappa}B activation independent of NF-{kappa}B transcriptional activity. These findings support the view that COX-2 links the Rho/MEKK1/AP-1 signaling cascade to NF-{kappa}B activation in a novel integrated model of the inflammatory response of kidney epithelial cells in response to external stimuli. These findings are consistent with the consensus role of NF-{kappa}B as a central mediator of the inflammatory process (3, 11, 40) and suggest potential avenues of future investigation to identify the ultimate effectors involved and for therapeutic intervention of this response.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported in part by the University of Washington National Institute of Environmental Health Sciences (NIEHS)-sponsored Center for Ecogenetics and Environmental Health Grant P30 ES07033 and University of Washington NIEHS-sponsored Superfund Program Project Grant P42 ES04696. Additional funding was provided by the Wallace Research Foundation.


    ACKNOWLEDGMENTS
 
We thank Christopher Franklin, PhD, University of Colorado Health Sciences Center, for critical review of this manuscript.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J. S. Woods, Dept. of Environmental and Occupational Health Sciences, Univ. of Washington, 4225 Roosevelt Way NE, Suite 100, Seattle, WA 98105 (e-mail: jwoods{at}u.washington.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Ahn JD, Morishita R, Kaneda Y, Lee SJ, Kwan KY, Choi SY, Lee KU, Park JY, Moon IJ, Park JG, Yoshizumi M, Ouchi Y, Lee IK. Inhibitory effects of novel AP-1 decoy oligodeoxynucleotides on vascular smooth muscle cell proliferation in vitro and neointimal formation in vivo. Circ Res 9: 1325–1332, 2002.

2. Amoah-Apraku B, Chandler LJ, Harrison JK, Tank SS, Igelfinger JR, Guzman NJ. NF-{kappa}B and transcriptional control of renal epithelial-inducible nitric oxide synthase. Kidney Int 48: 674–682, 1995.[Web of Science][Medline]

3. Barnes PJ, Karin M. Nuclear factor-{kappa}B: a pivotal transcription factor in chronic inflammatory diseases. N Engl J Med 336: 1066–1071, 1997.[Free Full Text]

4. Benitah SA, Valerón PF, Lacal JC. ROCK and nuclear factor-{kappa}B-dependent activation of cyclooxygenase-2 by Rho GTPases: effects on tumor growth and therapeutic consequences. Mol Biol Cell 14: 3041–3045, 2003.[Abstract/Free Full Text]

5. Brown PH, Chen TK, Birrer MB. Mechanism of action of a dominant-negative mutant of c-Jun. Oncogene 9: 791–799, 1994.[Web of Science][Medline]

6. Bubici C, Papa S, Zazzeroni F, Franzoso G. NF-{kappa}B and JNK: an intricate affair. Cell Cycle 3: 1524–1529, 2004.[Web of Science][Medline]

7. Castrillo A, de las Haras B, Hortelano S, Rodríguez B, Villar A, Boscá L. Inhibition of the nuclear factor {kappa}B (NF-{kappa}B) pathway by tetracyclic kaurene diterpenes in macrophages. Specific effects on NF-{kappa}B-inducing kinase activity and on the coordinate activation of ERK and p38 MAPK. J Biol Chem 276: 15854–15860, 2001.[Abstract/Free Full Text]

8. Chang YWE, Putzer K, Ren L, Kaboord B, Chance TW, Qoronfleh MW, Jakobi R. Differential regulation of cyclooxygenase 2 expression by small GTPases Ras, Rac1, and RhoA. J Cell Biochem 96: 314–329, 2005.[CrossRef][Web of Science][Medline]

9. Chen LC, Chen BK, Chang JM, Chang WC. Essential role of c-Jun induction and coactivator p300 in epidermal growth factor-induced gene expression of cyclooxygenase-2 in human epidermoid carcinoma A431 cells. Biochim Biophys Acta 1683: 38–48, 2004.[Medline]

10. Chen LC, Chen BK, Chang WC. Activating protein 1-mediated cyclooxygenase-2 expression is independent of N-terminal phosphorylation of c-Jun. Mol Pharmacol 67: 2057–2069, 2005.[Abstract/Free Full Text]

11. Chen LW, Egan L, Li ZW, Greten FR, Kagnoff MF, Karin M. The two faces of IKK and NF-{kappa}B inhibition: prevention of systemic inflammation but increased local injury following intestinal ischemia-reperfusion. Nat Med 9: 575–581, 2003.[CrossRef][Web of Science][Medline]

12. Coso OA, Chiariello M, Yu JC, Teramoto H, Crespo P, Xu N, Miki T, Gutkind JS. The small GTP-binding proteins Rac1 and Cdc42 regulate the activity of the JNK/SAPK signaling pathway. Cell 81: 1137–1146, 1995.[CrossRef][Web of Science][Medline]

13. Cuevas BD, Uhlik MT, Garrington TP, Johnson GL. MEKK1 regulates the AP-1 dimer repertoire via control of JunB transcription and Fra-2 protein stability. Oncogene 24: 801–809, 2005.[CrossRef][Web of Science][Medline]

14. De Haij S, Bakker AC, van der Geest RN, Haegeman G, Vanden Berghe W, Aarbiou J, Daha MR, van Kooten C. NF-{kappa}B mediated IL-6 production by renal epithelial cells is regulated by c-Jun NH2-terminal kinase. J Am Soc Nephrol 16: 1603–1611, 2005.[Abstract/Free Full Text]

15. De Haij S, Woltman AM, Bakker AC, Daha MR, van Kooten C. Production of inflammatory mediators by renal epithelial cells is insensitive to glucocorticoids. Br J Pharmacol 137: 197–204, 2002.[CrossRef][Web of Science][Medline]

16. Denhardt DT. Signal-transducing protein phosphorylation cascades mediated by Ras/Rho proteins in the mammalian cell: the potential for multiplex signalling. Biochem J 318: 729–747, 1996.[Web of Science][Medline]

17. DiDonato JA. Assaying for I{kappa}B kinase activity. Methods Enzymol 322: 393–400, 2000.[Web of Science][Medline]

18. Dieguez-Acuña FJ, Ellis ME, Kushleika J, Woods JS. Mercuric ion attenuates nuclear factor-{kappa}B activation and DNA binding in normal rat kidney epithelial cells: implications for mercury-induced nephrotoxicity. Toxicol Appl Pharmacol 173: 176–187, 2000.[CrossRef][Web of Science]

19. Dubois RN, Abramson SB, Crofford L, Gupta RA, Simon LS, Van De Putte LBA, Lipsky PE. Cyclooxygenase in biology and disease. FASEB J 12: 1063–1073, 1998.[Abstract/Free Full Text]

20. Finder JD, Litz JL, Blaskovich MA, McGuire TF, Qian Y, Hamilton AD, Davies P, Sebti SM. Inhibition of protein geranylgeranylation causes a superinduction of nitric-oxide synthase-2 by interleukin-1beta in vascular smooth muscle cells. J Biol Chem 272: 13484–13488, 1997.[Abstract/Free Full Text]

21. Gallagher ED, Gutowski S, Sternweis PC, Cobb MH. RhoA binds to the amino terminus of MEKK1 and regulates its kinase activity. J Biol Chem 279: 1872–1877, 2004.[Abstract/Free Full Text]

22. Ghosh S, May MJ, Kopp EB. NF-{kappa}B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu Rev Immunol 16: 225–260, 1998.[CrossRef][Web of Science][Medline]

23. Gomez PF, Pillinger MH, Attur M, Marjanovic N, Dave M, Park J, Bingham COIII, Al-Mussawir H, Abramson SB. Resolution of inflammation: prostaglandin E2 dissociates nuclear trafficking of individual NF-{kappa}B subunits (p65, p50) in stimulated rheumatoid synovial fibroblasts. J Immunol 175: 6924–6930, 2005.[Abstract/Free Full Text]

24. Hoffmann A, Levchenko A, Scott ML, Baltimore A. The I{kappa}B-NF-{kappa}B signaling module: temporal control and selective gene activation. Science 298: 1241–1245, 2002.[Abstract/Free Full Text]

25. Karin M, Ben-Neriah Y. Phosphorylation meets ubiquitination: the control of NF-{kappa}B activity. Annu Rev Immunol 18: 621–663, 2000.[CrossRef][Web of Science][Medline]

26. Marinissen MJ, Chiariello M, Tanos T, Bernard O, Narumiya S, Gutkind JS. The small GTP-binding protein RhoA regulates c-jun by a ROCK-JNK signaling axis. Mol Cell 13: 29–41, 2004.

27. Montaner S, Perona R, Saniger L, Lacal JC. Multiple signalling pathways lead to the activation of the nuclear factor {kappa}B by the Rho family of GTPases. J Biol Chem 273: 12779–12785, 1998.[Abstract/Free Full Text]

28. Muniyappa R, Xu R, Ram JL, Sowers JR. Inhibition of Rho protein stimulates iNOS expression in rat vascular smooth muscle cells. Am J Physiol Heart Circ Physiol 278: H1762–H1768, 2000.[Abstract/Free Full Text]

29. Poligone B, Baldwin AS. Positive and negative regulation of NF-{kappa}B by COX-2: roles of different prostaglandins. J Biol Chem 276: 38658–38664, 2001.[Abstract/Free Full Text]

30. Rattan R, Giri S, Singh AK, Singh I. RhoA negatively regulates cytokine-mediated inducible nitric oxide synthase expression in brain-derived transformed cell lines: negative regulation of IKK{alpha}. Free Radic Biol Med 35: 1037–1050, 2003.[CrossRef][Web of Science][Medline]

31. Rossi A, Kapahi P, Natoli G, Takahashi T, Chen Y, Karin M, Santoro MG. Anti-inflammatory cyclopentenone prostaglandins are direct inhibitors of I{kappa}B kinase. Nature 403: 103–108, 2000.[CrossRef][Medline]

32. Sánchez-Pérez I, Benitah SA, Martínez-Gomariz M, Lacal JC, Perona R. Cell stress and MEKK1-mediated c-Jun activation modulate NF{kappa}B activity and cell viability. Mol Biol Cell 13: 2933–2945, 2002.[Abstract/Free Full Text]

33. Sasaki CY, Barberi TJ, Ghosh P, Longo DL. Cell stress and MEKK1-mediated c-Jun activation modulate NF{kappa}B activity and cell viability. J Biol Chem 280: 34538–34547, 2005.[Abstract/Free Full Text]

34. Schmeck B, Brunsch M, Seybold J, Krull M, Eichel-Streiber C, Suttorp N, Hippenstiel S. Rho protein inhibition blocks cyclooxygenase-2 expression by proinflammatory mediators in endothelial cells. Inflammation 27: 89–95, 2003.[CrossRef][Web of Science][Medline]

35. Schmedtje JF Jr, Ji YS, Lui WL, DuBoi RN, Runge MS. Hypoxia induces cyclooxygenase-2 via the NF-{kappa}B p65 transcription factor in human vascular endothelial cells. J Biol Chem 272: 601–608, 1997.[Abstract/Free Full Text]

36. Smith WL, DeWitt DL, Garavito RM. Cyclooxygenases: structural, cellular, and molecular biology. Annu Rev Biochem 69: 145–182, 2000.[CrossRef][Web of Science][Medline]

37. Stein B, Baldwin AS Jr, Ballard DW, Green WC, Angel P, Herrlich P. Cross-coupling of the NF-{kappa}B p65 and Fos/Jun transcription factors produces potentiated biological function. EMBO J 12: 3879–3891, 1993.[Web of Science][Medline]

38. Straus DS, Pascual G, Li M, Welch JS, Ricote M, Hsiang CH, Sengchanthalangsy LL, Ghosh G, Glass CK. 5-Deoxy-{Delta}12,14-prostaglandin J2 inhibits multiple steps in the NF-{kappa}B signaling pathway. Proc Natl Acad Sci USA 97: 4844–4849, 2000.[Abstract/Free Full Text]

39. Sun SC, Ganchi PA, Ballard DW, Greene WC. NF-{kappa}B controls expression of inhibitor I{kappa}B{alpha}: evidence for an inducible autoregulatory pathway. Science 259: 1912–1915, 1993.[Abstract/Free Full Text]

40. Tak PP, Firestein GS. NF-{kappa}B: a key role in inflammatory diseases. J Clin Invest 107: 7–11, 2001.[CrossRef][Web of Science][Medline]

41. Tang G, Minemoto Y, Dibling B, Purcell NH, Li Z, Karin M, Lin A. Inhibition of JNK activation through NF-{kappa}B target genes. Nature 414: 313–317, 2001.[CrossRef][Medline]

42. Teramoto H, Crespo P, Coso OA, Igishi T, Xu N, Gutkind JS. The small GTP-binding protein rho activates c-Jun N-terminal kinases/stress-activated protein kinases in human kidney 293T cells. Evidence for a Pak-independent signaling pathway. J Biol Chem 271: 25731–25734, 1996.[Abstract/Free Full Text]

43. Van Kooten C, Daha MR, van Es LA. Tubular epithelial cells: a critical cell type in the regulation of renal inflammatory processes. Exp Nephrol 7: 429–437, 1999.[CrossRef][Web of Science][Medline]

44. Witteck A, Yao Y, Fechir M, Förstermann U, Kleinert H. Rho protein-mediated changes in the structure of the actin cytoskeleton regulate human inducible NO synthase gene expression. Exp Cell Res 287: 106–115, 2003.[CrossRef][Web of Science][Medline]

45. Woods JS, Ellis ME, Dieguez-Acuña FJ, Corral J. Activation of NF-{kappa}B in normal rat kidney epithelial (NRK52E) cells is mediated via a redox-insensitive, calcium-dependent pathway. Toxicol Appl Pharmacol 154: 219–227, 1999.[CrossRef][Web of Science][Medline]

46. Xie W, Hershman HR. Transcriptional regulation of prostaglandin synthase 2 gene expression by platelet-derived growth factor and serum. J Biol Chem 271: 31742–31748, 1996.[Abstract/Free Full Text]

47. Yamamoto K, Arakawa T, Ueda N, Yamamoto S. Transcriptional roles of nuclear factor {kappa}B and nuclear factor-interleukin-6 in the tumor necrosis factor {alpha}-dependent induction of cyclooxygenase-2 in MC3T3-E1 cells. J Biol Chem 270: 31315–31320, 1995.[Abstract/Free Full Text]

48. Zabel U, Baeuerle PA. Purified human I{kappa}B can rapidly dissociate the complex of the NF-{kappa}B transcription factor with its cognate DNA. Cell 61: 255–265, 1990.[CrossRef][Web of Science][Medline]




This article has been cited by other articles:


Home page
Mol Cancer ResHome page
S. Doublier, C. Riganti, C. Voena, C. Costamagna, E. Aldieri, G. Pescarmona, D. Ghigo, and A. Bosia
RhoA Silencing Reverts the Resistance to Doxorubicin in Human Colon Cancer Cells
Mol. Cancer Res., October 1, 2008; 6(10): 1607 - 1620.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/3/C1160    most recent
00578.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Polk, W. W.
Right arrow Articles by Woods, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Polk, W. W.
Right arrow Articles by Woods, J. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.