HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: 293/3/C1139    most recent 00142.2007v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (2) Citing Articles via Google Scholar Google Scholar Articles by Weigert, C. Articles by Schleicher, E. D. Search for Related Content PubMed PubMed Citation Articles by Weigert, C. Articles by Schleicher, E. D.

MUSCLE CELL BIOLOGY AND CELL MOTILITY

Upregulation of IL-6 mRNA by IL-6 in skeletal muscle cells: role of IL-6 mRNA stabilization and Ca²⁺-dependent mechanisms

¹Department of Internal Medicine, Division of Endocrinology, Metabolism, Pathobiochemistry, and Clinical Chemistry, ²Department of Pharmacology, Institute of Pharmacy, and ³Division of Sports Medicine, Medical Clinic, University of Tuebingen, Tuebingen, Germany

Submitted 5 April 2007 ; accepted in final form 2 July 2007

	ABSTRACT

TOP ABSTRACT EXPERIMENTAL PROCEDURES RESULTS DISCUSSION GRANTS REFERENCES

 
Skeletal muscle cells have been established as significant producers of IL-6 during exercise. This IL-6 production is discussed as one possible mediator of the beneficial effects of physical activity on glucose and fatty acid metabolism. IL-6 itself could be the exercise-related factor that upregulates and maintains its own production. We investigated this hypothesis and the underlying molecular mechanism in cultured C₂C₁₂ cells. IL-6 led to a rapid and prolonged increase in IL-6 mRNA, which was also found in human myotubes. Because IL-6 has been shown to activate AMP-activated kinase (AMPK), we studied whether, in turn, activated AMPK induces IL-6 expression. Pharmacological activation of AMPK with 5-aminoimidazole-4-carboxamide-1--4-ribofuranoside upregulated IL-6 mRNA expression, which was blocked by knockdown of AMPK ₁ and ₂ using small, interfering RNA (siRNA) oligonucleotides. However, the effect of IL-6 was shown to be independent of AMPK, since the siRNA approach silencing the AMPK -subunits did not reduce the upregulation of IL-6 induced by IL-6 stimulation. The self-stimulatory effect of IL-6 partly involves a Ca²⁺-dependent pathway: IL-6 increased intracellular Ca²⁺, and intracellular blockade of Ca²⁺ with a Ca²⁺ chelator reduced the IL-6-mediated increase in IL-6 mRNA levels. Moreover, inhibition of Ca²⁺/calmodulin-dependent kinase kinase with STO-609 or the siRNA approach decreased IL-6 mRNA levels of control and IL-6-stimulated cells. A major, STO-609-independent mechanism is the IL-6-mediated stabilization of its mRNA. The data suggest that IL-6 could act as autocrine factor upregulating its mRNA levels, thereby supporting its function as an exercise-activated factor in skeletal muscle cells.

5-aminoimidazole-4-carboxamide-1--4-ribofuranoside; AMP-activated kinase; STO-609; calcium/calmodulin-dependent kinase kinase; C₂C₁₂ cells

The regulation of IL-6 gene activation and expression in inflammatory conditions has been studied in detail (29, 31), including in studies of skeletal muscle cells (12, 13). In contrast, the molecular regulation of IL-6 expression during exercise is less clear. Muscle contraction activates several signaling pathways and exercise-related factors, which are therefore possible mediators that lead to enhanced IL-6 expression. Among them, IL-6 itself is an interesting candidate. At least in skeletal muscle under low-glycogen conditions, the IL-6 release occurs before the increase in IL-6 gene transcription, indicating that this early release must be due to IL-6 protein storage in the muscle (30). The secreted IL-6 could then, in a positive feedback loop, activate its own expression. An autocrine regulation of IL-6 production was postulated because, after infusion of recombinant IL-6 in humans, substantial IL-6 mRNA expression was observed in skeletal muscle (26).

The rapid and transient activation of the AMP-activated kinase (AMPK) during exercise could also be important for IL-6 production (16, 30, 32). Individual values of AMPK activity and IL-6 release correlated significantly over a 60-min trial on a bicycle ergometer (30). Pharmacological activation of AMPK with the AMP analog 5-aminoimidazole-4-carboxamide-1--4-ribofuranoside (AICAR) activated IL-6 expression in fibroblasts (9). In addition, activation of AMPK by IL-6 was demonstrated in skeletal muscle in vivo and in cell cultures (2, 7, 27). We hypothesized that, in turn, signal transduction via AMPK during exercise could lead to enhanced IL-6 expression.

Intracellular Ca²⁺ concentrations ([Ca²⁺]_i) could also play an important role in exercise-related IL-6 expression. Muscle contraction induces Ca²⁺ release from the sarcoplasmic reticulum (5), and Ca²⁺ is an important regulator of IL-6 expression, as demonstrated by stimulation of rat soleus muscle, human skeletal muscle cells, or L6 myotubes with the Ca²⁺ ionophore ionomycin (8, 20, 24) or with depolarization-induced slow Ca²⁺ transients in C₂C₁₂ cells (23). However, a causal relationship linking exercise-related Ca²⁺ signaling to the enhanced IL-6 expression has not been shown (1, 19).

In the present study, we examined the regulation of IL-6 expression in skeletal muscle cells by IL-6, AMPK, and Ca²⁺. Using C₂C₁₂ cells, we demonstrated a self-stimulatory effect of IL-6, which is AMPK independent and is mediated via a Ca²⁺-dependent signaling pathway and stabilization of IL-6 mRNA.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT EXPERIMENTAL PROCEDURES RESULTS DISCUSSION GRANTS REFERENCES

 
Materials. C₂C₁₂ cells were from American Type Culture Collection (Manassas, VA). Cell culture media and supplements were from Cambrex (Verviers, Belgium); phosphatase inhibitors, human recombinant IL-6, SB-203580, actinomycin D, STO-609, cyclosporin A, ionomycin, and BAPTA-AM were from Sigma (Munich, Germany); mouse recombinant IL-6 was from R&D Systems (Wiesbaden, Germany); light cycler system was from Roche (Mannheim, Germany); fura 2-AM was from Invitrogen (Karlsruhe, Germany); and AICAR was from Chemos (Regenstauf, Germany). Antibodies against phospho-STAT-3 (Tyr⁷⁰⁵), STAT-3, AMPK , phospho-acetyl-CoA carboxylase (ACC) (Ser⁷⁹), phospho-p38 MAPK, and p38 MAPK were from Cell Signaling (Frankfurt, Germany); antibodies against AMPK ₁, AMPK ₂, and ACC were from Upstate Biotechnology (Lake Placid, NY); antibodies against Ca²⁺/calmodulin-dependent kinase kinase (pan) (CaMKK) were from BD Biosciences (Heidelberg, Germany); and antibodies against CaMKK and were from Santa Cruz (Santa Cruz, CA).

Cell culture. C₂C₁₂ myoblasts were cultured in DMEM containing 25 mM glucose, 10% FCS, 2 mM glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. Stimulation was performed in DMEM containing 5.5 mM glucose and 2% FCS. Human primary myotubes were cultured and stimulated as recently described (28, 38).

RT-PCR and real-time quantitative PCR analysis. Reverse transcription of total RNA (1 µg) was performed in a volume of 20 µl using random hexamers and avian myeloblastosis virus reverse transcriptase with the first-strand cDNA synthesis kit for RT-PCR (Roche) as described (38). Aliquots (2 µl) of the reverse transcription reactions were then submitted in duplicate to online quantitative PCR with the Light Cycler system (Roche) with SYBR green using FastStart DNA-Master SYBR green I (Roche). For human IL-6, the following primer pairs were used: sense, ccagctatgaactccttctc; antisense, gcttgttcctcacatctctc, product of 425 bp. For mouse IL-6, the following primer pairs were used: sense, gatgctaccaaactggatataatc; antisense, ggtccttagccactccttctgtg, product of 268 bp. For mouse SOCS-3, the following primer pairs were used: sense, gctggccaaagaaataacca; antisense, agctcaccagcctcatctgt, product of 224 bp. For mouse -actin, the following primer pairs were used: sense, agccatgtacgtagccatcc; antisense, ctctcagctgtggtggtgaa, product of 227 bp. PCR was performed in a volume of 20 µl/2 µl FastStart DNA-Master SYBR green I, 4 mmol/l MgCl₂, and primers according to a primer concentration of 1 µmol/l. After denaturation at 95°C for 10 min, for human IL-6, cycling was performed by denaturing at 95°C for 15 s, annealing at 63°C for 10 s, and elongation for 17 s (the number of cycles was 45). For mouse IL-6, annealing was at 65°C for 5 s and elongation was for 11 s (the number of cycles was 50). For mouse SOCS-3, annealing was at 66°C for 10 s, elongation was for 9 s, and the number of cycles was 45. For mouse -actin, annealing was at 69°C for 10 s, elongation was for 10 s, and the number of cycles was 45.

Small, interfering RNA. Small, interfering RNA (siRNA) oligonucleotides targeting mouse AMPK ₂, mouse CaMKK , and CaMKK were designed, synthesized, and annealed at Dharmacon Research (Lafayette, CO). For siRNA targeting the mouse AMPK ₁ mRNA, the sequence AGAAGUGUGUGAGAAGUUC (nucleotides 882–900, GenBank accession no. AY885266) was used. An unrelated siRNA targeting firefly luciferase was used as control in all experiments. Transfection was performed with CellPhect (Amersham Biosciences, Buckinghamshire, UK) with 200 nM siRNA according to the instructions of the manufacturer. Briefly, 1 x 10⁵ cells/well were seeded in six-well plates and transfected in DMEM containing 25 mM glucose and 10% FCS without antibiotics. Twenty-four hours after the glycerol shock, cells were stimulated as indicated.

Measurement of [Ca²⁺]_i. [Ca²⁺]_i was measured at 37°C in single cells by the fura 2 method according to Grynkiewicz et al. (15) using equipment and software from TILL photonics (Gräfelfing, Germany). C₂C₁₂ cells were loaded with a mixture of fura 2-AM (5 µM) and Pluronic F127 (0.0125%) for 45 min at 37°C. Intracellular fura 2 was excited alternately at 340 or 380 nm by means of an oscillating diffraction grating. The excitation light was directed through the objective (PlanNeofluor x40 objective; Zeiss, Stuttgart, Germany) by means of a glass fiber light guide and a dichroic mirror. The emitted light was filtered (LP 515 nm) and measured by a digital camera. The ratio of the emitted light intensity at 340-to-380 nm excitation was used to monitor changes in [Ca²⁺]_i. Values are given as arbitrary units (changes in 340-to-380 nm fluorescence ratio).

Western blotting. Cell lysis and Western blotting were performed as previously described (40).

Statistical analysis. Results presented are derived from at least three independent experiments. Means ± SE were calculated, and groups of data were compared with Student's t-test. Statistical significance was set at P < 0.05.

	RESULTS

TOP ABSTRACT EXPERIMENTAL PROCEDURES RESULTS DISCUSSION GRANTS REFERENCES

 
IL-6 increases its mRNA levels. First, we studied whether incubation of C₂C₁₂ cells with IL-6 could increase IL-6 mRNA levels. We found a stimulatory effect using 20 ng/ml IL-6 with no further increase after incubation with 100 ng/ml (Fig. 1A). This upregulation is rapid and found first after 2 h of IL-6 incubation, with a further increase after 16 and 24 h (Fig. 1B). To achieve maximum stimulation in subsequent experiments, we used 20 ng/ml IL-6 for 24 h. The stimulatory effect of IL-6 on its own expression was also observed in human myotubes, indicating that the effect of IL-6 is independent of the differentiation status of the skeletal muscle cells (data not shown).

View larger version (15K): [in this window] [in a new window]   Fig. 1. IL-6 induces IL-6 expression. C2C12 myocytes were stimulated with IL-6 as indicated (A), and IL-6 mRNA expression was measured using real-time PCR (B). Rel, relative; Con, control. Results are means ± SE of at least 4 separate experiments. mRNA expression of untreated cells was set as 1. *P < 0.05 vs. control.

View larger version (12K): [in this window] [in a new window]   Fig. 2. A, B: Effect of 5-aminoimidazole-4-carboxamide-1--4-ribofuranoside (AICAR) on IL-6 mRNA expression in C2C12 skeletal muscle cells. C2C12 myocytes were stimulated with AICAR as indicated, and IL-6 mRNA expression was measured using real-time PCR. Results are means ± SE of at least 4 separate experiments. mRNA expression of untreated cells was set as 1. *P < 0.05 vs. control. C: C2C12 cells were transfected with small interfering RNA (siRNA) oligonucleotides targeting AMP-activated kinase (AMPK) 1-subunit (si-AMPK 1), 2-subunit (si-AMPK 2), or firefly luciferase as control (si-con). Forty hours after transfection, cells were harvested and cytosolic extracts were separated by SDS-PAGE and immunoblotted with anti-AMPK 1 or 2 antibodies. D: 40 h after transfection, cells were stimulated with 1 mM AICAR for 24 h and IL-6 mRNA was measured by real-time PCR. Results are means ± SE of 4 separate experiments. mRNA expression of si-con-transfected, untreated cells was set as 1. *P < 0.05 vs. unstimulated cells; #P < 0.05 vs. si-con-transfected cells stimulated with AICAR.

The self-induced upregulation of IL-6 expression is independent of AMPK. Because the pharmacological activation of AMPK was sufficient to induce IL-6 expression (Fig. 2), we studied the participation of AMPK in autocrine IL-6 upregulation. Knockdown of AMPK ₁-subunit completely prevented basal, IL-6-induced, and AICAR-induced phosphorylation of the AMPK substrate ACC on Ser⁷⁹ (Fig. 3A), demonstrating almost complete inhibition of AMPK activity by knockdown of AMPK ₁-subunit. The IL-6-induced phosphorylation of STAT-3 was not reduced by silencing AMPK, indicating that the IL-6-dependent Janus kinase/STAT pathway was not inhibited (Fig. 3A). Moreover, the increase in IL-6 expression after incubation with IL-6 was not affected by knockdown of AMPK ₁- or ₂-subunit (Fig. 3B). These data indicate that the self-induced stimulation of IL-6 expression is not mediated via AMPK activation.

View larger version (21K): [in this window] [in a new window]   Fig. 3. Participation of AMPK-dependent pathways in IL-6-induced IL-6 mRNA expression. A: C2C12 cells were transfected with siRNA oligonucleotides targeting AMPK 1-subunit (si-AMPK 1) or firefly luciferase as control (si-con). Forty hours after transfection, cells were stimulated with 20 ng/ml IL-6 or 1 mM AICAR for 20 min, and cytosolic extracts were separated by SDS-PAGE and immunoblotted with anti-AMPK (pan-specific), anti-phospho-STAT-3, and anti-phospho-acetyl-CoA carboxylase (ACC) antibodies. B: 40 h after transfection, cells were stimulated with 20 ng/ml IL-6 for 24 h and IL-6 mRNA was measured with real-time PCR. Results are means ± SE of 4 separate experiments. mRNA expression of si-con-transfected, untreated cells was set as 1. *P < 0.05 vs. unstimulated cells.

Stimulation with AICAR for 60 and 240 min resulted in enhanced phosphorylation of p38 MAPK, demonstrating the activation of this pathway by the AMPK activator (Fig. 4A). The stimulation with IL-6 led to a more rapid and transient phosphorylation of p38 MAPK (Fig. 4B). Inhibition of the p38 MAPK pathway with SB-203580 clearly reduced IL-6 mRNA expression in control, AICAR-treated, and IL-6-treated cells (Fig. 4, C and D). In contrast to the remaining relative increase in IL-6 levels found in IL-6-treated cells (Fig. 4D), the effect of AICAR was completely blocked in the presence of 10 µM of the inhibitor (Fig. 4C). Thus the AICAR-induced activation of AMPK leads to enhanced IL-6 expression via the p38 MAPK pathway, whereas the effects of IL-6 are at least partially independent of the activity of this pathway.

View larger version (12K): [in this window] [in a new window]   Fig. 4. Regulation of IL-6 expression by the p38 MAPK pathway. C2C12 cells were stimulated with AICAR (A) or IL-6 (B) as indicated, and phosphorylation of p38 MAPK was monitored by immunoblotting using anti-phospho-p38 MAPK and p38 MAPK protein antibodies (top in A and B). Shown are representative immunoblots and the densitometric quantification of data obtained from 4 independent experiments. *P < 0.05 vs. unstimulated cells. C and D: before stimulation with AICAR (C) or IL-6 (D), C2C12 cells were preincubated with 1 or 10 µM SB-203580 for 30 min. IL-6 mRNA expression was measured after 24 h with real-time PCR. Results are means ± SE of 4 separate experiments. mRNA expression of untreated cells was set as 1. *P < 0.05 vs. unstimulated cells; #P < 0.05 vs. stimulated cells without inhibitor.

First, we studied the effect of IL-6 on [Ca²⁺]_i (Fig. 5, A and B). The majority of the cells displayed oscillations of [Ca²⁺]_i under control conditions, as shown in the initial phase (Fig. 5A). Addition of IL-6 (20 ng/ml) was followed by a reversible increase of [Ca²⁺]_i. In 32% of all cells tested, IL-6 application induced a rapid Ca²⁺ peak and a second phase in which [Ca²⁺]_i remained elevated above basal values (Fig. 5A). In the other cells, there was no peak increase but the shape of oscillations changed, and overall [Ca²⁺]_i was larger than under control conditions. Addition of ATP, which has been reported as inducer of [Ca²⁺]_i in skeletal muscle cells (46), resulted in a similar pattern with a more pronounced, rapid Ca²⁺ peak (Fig. 5A). To quantify the effect of IL-6 on [Ca²⁺]_i, the area under the curve (AUC_F340/380, where F340/380 is the 340-to-380 nm fluorescence ratio) was calculated for 2 min before and immediately after the bath solution was changed, respectively (Fig. 5B). AUC_F340/380 was 2,352 ± 170 arbitrary units x min under control conditions and raised to 8,626 ± 1,201 arbitrary units x min in the presence of IL-6 (n = 50, P < 0.001).

View larger version (11K): [in this window] [in a new window]   Fig. 5. Role of Ca2+-dependent pathways in IL-6-induced IL-6 expression. Cells were stimulated in DMEM-5.5 mM glucose-2% FCS with IL-6 as indicated by the horizontal bars, and alterations of intracellular Ca2+ concentration ([Ca2+]i) are shown as changes of 340/380 fluorescence (F). au, Arbitrary units. A: experiment where IL-6 changed [Ca2+]i in a biphasic manner. For comparison, the effect of 300 µM ATP was tested at the end of each experiment. B: summary of the Ca2+ response of untreated C2C12 cells and the effect of acute IL-6 application. As a measure for an increase of [Ca2+]i, the area under the curve (AUCF340/380, where F340/380 is the 340-to-380 nm fluorescence ratio) under control conditions and in the presence of IL-6 was calculated for 2 min in each case. Results are means ± SE (50 cells of 3 independent preparations). *P < 0.001 vs. control. C: cells were preincubated with 5 µM BAPTA-AM for 60 min before IL-6 (20 ng/ml) was added for a further 24 h. IL-6 mRNA expression of untreated cells was set as 1. *P < 0.05 vs. unstimulated cells; #P < 0.05 vs. cells without inhibitor stimulated with IL-6.

Role of calcineurin and CaMKK in IL-6 expression. The upstream CaMKK - and -subunits and the serine-threonine phosphatase calcineurin respond to exercise-induced elevation of [Ca²⁺]_i (14, 37, 43) and have been implicated in Ca²⁺/calmodulin-dependent gene expression during muscle contraction (3, 4, 22, 41). Inhibition of calcineurin with 1 or 5 µM cyclosporin A had no effect on IL-6 mRNA expression in IL-6-treated cells (Fig. 6A). To evaluate the role of CaMKK, we used the CaMKK inhibitor STO-609. We found a significant reduction of IL-6 expression below values of untreated control cells with 2.5 and 10 µg/ml of STO-609 in both unstimulated and IL-6-stimulated cells (Fig. 6B). The concentrations of STO-609 applied in these experiments, although a widely used concentration to study specific effects of CaMKK, could, besides CaMKK, partly inhibit the activity of other kinases, most notably AMPK (17). The participation of this kinase, however, was clearly excluded by the siRNA approach (Fig. 3). A direct inhibition of the IL-6 signaling cascade by STO-609 could also be ruled out because the IL-6-induced phosphorylation of STAT-3 and the induction of SOCS-3 expression were not influenced by this inhibitor (Fig. 6, C and D). To obtain specific inhibition of CaMKK, siRNA oligonucleotide-mediated knockdown was applied. Silencing of CaMKK - and -isoforms with isoform-specific oligonucleotides was verified by Western blotting (Fig. 6E). The knockdown of CaMKK - or CaMKK -isoform alone had no effect on IL-6-induced IL-6 expression, whereas knockdown of both isoforms clearly reduced the IL-6-stimulated increase by 30% (Fig. 6F). The inhibition of CaMKK alone and of both isoforms also reduced basal IL-6 expression (Fig. 6F).

View larger version (23K): [in this window] [in a new window]   Fig. 6. Role of calcineurin and Ca2+/calmodulin-dependent kinase kinase (CaMKK) in IL-6 expression. Cells were preincubated with the indicated concentrations of cyclosporin A (CsA; A) or STO-609 (B) for 60 min before 20 ng/ml IL-6 was added for a further 24 h. IL-6 mRNA expression of untreated cells was set as 1. *P < 0.05 vs. unstimulated cells; #P < 0.05 vs. cells without inhibitor stimulated with IL-6. C: cells were preincubated with 10 µg/ml STO-609 for 60 min before 20 ng/ml IL-6 was added. Cytosolic extracts were separated by SDS-PAGE and immunoblotted with anti-phospho-STAT-3 and anti-STAT-3 antibodies. D: cells were preincubated with 10 µg/ml STO-609 for 60 min before 20 ng/ml IL-6 was added for a further 24 h. SOCS-3 mRNA expression of untreated cells was set as 1. *P < 0.05 vs. unstimulated cells. E: C2C12 cells were transfected with siRNA oligonucleotides targeting CaMKK - and -isoforms or firefly luciferase as control (–). Forty hours after transfection, cells were harvested and cytosolic extracts were separated by SDS-PAGE and immunoblotted with anti-CaMKK (pan-specific) antibodies. Immunodetection with isoform-specific antibodies gave similar results (data not shown). F: 40 h after transfection, cells were stimulated with 20 ng/ml IL-6 for 24 h, and IL-6 mRNA expression was measured by real-time PCR. Results are means ± SE of 4 separate experiments. mRNA expression of si-con-transfected, untreated cells was set as 1. *P < 0.05 vs. unstimulated cells; #P < 0.05 vs. stimulated cells. G: C2C12 myocytes were stimulated with ionomycin (iono), IL-6, or both for 8 h, and IL-6 mRNA expression was measured by real-time PCR. Results are means ± SE of at least 4 separate experiments. mRNA expression of untreated cells was set as 1. *P < 0.05 vs. control; P < 0.05 vs. IL-6 alone.

IL-6 increases mRNA stability. Treatment with the inhibitor of the p38 MAPK pathway (SB-203580), with the CaMKK inhibitor STO-609, and the knockdown of CaMKK clearly reduced the IL-6-mediated expression of IL-6 mRNA; however, a relative increase of IL-6 mRNA levels relative to unstimulated cells cultured under identical conditions remained. Therefore, we hypothesized that IL-6 could lead to increased mRNA levels by stabilizing IL-6 mRNA. An mRNA stability assay was performed in the presence of 5 µg/ml actinomycin D. Preincubation with IL-6 for 30 min clearly increased the amount of the remaining IL-6 mRNA at the different time points studied (Fig. 7A). Calculation of the mRNA half-life of IL-6 under basal conditions revealed a half-life of 35 ± 5 min, which was doubled in the presence of IL-6 (75 ± 17 min). This mRNA-stabilizing effect of IL-6 was not prevented when the assay was performed with 10 µg/ml STO-609; the data in Fig. 7B are presented as IL-6 expression units, which show the STO-609-mediated decrease in absolute mRNA expression levels of IL-6 as expected, whereas the presence of IL-6 delayed the degradation of the mRNA (Fig. 7B). These data indicate that IL-6 has a rapid (within 30 min) stabilizing effect on its mRNA, which is independent of CaMKK.

View larger version (12K): [in this window] [in a new window]   Fig. 7. IL-6 increases IL-6 mRNA stability. A: C2C12 cells were pretreated with 20 ng/ml IL-6 for 30 min before addition of 5 µg/ml actinomycin D (ActD). Percentage of remaining IL-6 mRNA relative to -actin mRNA is shown. Results are means ± SE of 5 separate experiments. *P < 0.05 vs. cells without IL-6. B: cells were preincubated with 10 µg/ml STO-609 before IL-6 and ActD were added as described in A. The expression units of IL-6 mRNA relative to -actin mRNA are shown. IL-6 mRNA levels of IL-6-treated cells without STO-609 have not been determined in these experiments. *P < 0.05 vs. cells without IL-6.

	DISCUSSION

TOP ABSTRACT EXPERIMENTAL PROCEDURES RESULTS DISCUSSION GRANTS REFERENCES

Our data provided clear evidence that IL-6 stimulates its own expression in skeletal muscle cells. This increase has been demonstrated in C₂C₁₂ myoblasts and in human myotubes. It is an early event, first demonstrated after 2 h of IL-6 stimulation with increasing mRNA levels after 16 and 24 h. In vivo data on IL-6 protein levels in human skeletal muscle during and after exercise reported a first rapid increase in IL-6 within minutes after start of the exercise performance, which was discussed as release from intracellular storage pools of IL-6 protein (30). Our data on IL-6 mRNA expression in skeletal muscle cells suggest that this released IL-6 could then act as an autocrine stimulatory factor to enhance its own expression and production, leading to the increased IL-6 mRNA and protein levels found several hours after the exercise bout. At least from our in vitro cell culture data, it could be suggested that IL-6 is an important factor for the enhanced production of IL-6 during and after exercise.

AMPK-dependent signaling appeared to be a promising candidate for mediating the autocrine effects of IL-6. The activation of AMPK by IL-6 has been demonstrated in skeletal muscle cells, including human myotubes and L6 myotubes (2, 7) and using mouse skeletal muscle strips (27). Treatment of mice with IL-6 also resulted in a very rapid phosphorylation of AMPK and its substrate ACC in skeletal muscle (Weigert, unpublished observations). Moreover, the activation of AMPK during exercise correlated with the IL-6 release from the contracting muscle (30), and activation of AMPK using AICAR led to enhanced IL-6 expression in fibroblasts (9). Of note, CaMKK is an upstream AMPK kinase and a CaMKK-dependent AMPK activation was demonstrated in skeletal muscle after increases in [Ca²⁺]_i (17, 21, 42). Unexpectedly, however, the self-stimulatory upregulation of IL-6 expression in C₂C₁₂ cells was found to be independent of AMPK. The knockdown of AMPK ₁- and ₂-isoforms did not reduce IL-6 expression, although this approach was suitable to prevent IL-6- and AICAR-induced ACC phosphorylation and the AICAR-induced IL-6 expression. We admit that we could not exclude, based on the cell culture data, that exercise-related AMPK activation is implicated in the enhanced IL-6 expression in the contracting muscle. However, the data in the present study did not support a role of AMPK in the autocrine effect of IL-6.

It is not clear why the activation of AMPK using AICAR led to increased IL-6 expression, whereas the activation of AMPK by IL-6 is not responsible for the self-stimulatory effect of IL-6. Because the effect of AICAR was prevented by knockdown of AMPK, involvement of other AICAR-activated, AMPK-independent pathways in the enhanced IL-6 expression appears unlikely. It is possible that the intensity and duration of AMPK activity induced by AICAR are more pronounced and thus suitable to increase IL-6 expression, whereas the effect of IL-6 on AMPK activity is not sufficient to support an upregulation.

Moreover, our data provide strong evidence that the self-stimulatory effect of IL-6 is, to a great extent, based on stabilization of IL-6 mRNA. In particular, the first increase in IL-6 mRNA levels found after 2 h in the C₂C₁₂ cells could be explained by the rapid effect of IL-6 on its mRNA stability. IL-6 mRNA shares with the mRNA of several interleukins and cytokines the feature of being very unstable; thus delay of mRNA degradation is a common posttranscriptional mechanism to upregulate the expression of these proteins (33). The calculated half-life of IL-6 mRNA in unstimulated C₂C₁₂ cells was 35 min, well in line with data reported earlier in other cells (33). This instability is determined by AU-rich elements located in the 3'-untranslated region. The binding of RNA-binding proteins to these sequences regulates the rate of degradation of IL-6 mRNA. In the present study, we did not perform experiments on the mechanism of the IL-6-induced increase in the half-life of its mRNA. Recently, a similar self-stabilizing effect has been reported for IL-4, which is mediated via the RNA-binding protein HuR (45).

A further novel finding is the increase in [Ca²⁺]_i induced by stimulation of the C₂C₁₂ cells with IL-6. Because several studies have established that a rise in [Ca²⁺]_i is an important stimulator for IL-6 expression (20, 23, 24), this result could provide a second mechanism for the upregulation of IL-6 mRNA. Additional support for this hypothesis comes from the observation that the calcium chelator BAPTA reduced the self-induced IL-6 expression. Inhibition of CaMKK by STO-609 or by siRNA-mediated knockdown also decreased IL-6 mRNA levels, albeit with different degrees of effectiveness, which might be explained by the remaining CaMKK activity in the siRNA oligonucleotide-transfected cells or by inhibition of other kinases by STO-609. Inhibition of CaMKK additionally reduced basal IL-6 expression. These results indicate that [Ca²⁺]_i is a strong activator of IL-6 expression. Because Ca²⁺-dependent pathways also appeared to be involved in basal regulation of IL-6 expression, the relative effect of the IL-6-induced increase in [Ca²⁺]_i on the self-induced upregulation of IL-6 is difficult to determine. However, the pronounced additive effect of IL-6 and the Ca²⁺ ionophore ionomycin suggests a major contribution of the IL-6-induced mRNA stability or other mechanisms to the self-stimulatory effect.

In conclusion, the present study provides new information on the possible functions of IL-6 in the working muscle during exercise and emphasizes the role of IL-6 as an exercise factor. In addition to the recently described metabolic properties of IL-6, namely, the improvement of glucose uptake and glycogen synthesis and the activation of fatty acid oxidation (2, 7, 39), our data suggest that IL-6 could enhance and support the increase in [Ca²⁺]_i, which is a crucial signal for the adaptive response of the working muscle to exercise (5). Moreover, IL-6 could maintain its activity in a positive feedback loop, leading to enhanced IL-6 expression beyond cessation of exercise performance.

	GRANTS

TOP ABSTRACT EXPERIMENTAL PROCEDURES RESULTS DISCUSSION GRANTS REFERENCES

 
This study was supported by grants from the Deutsche Forschungsgemeinschaft to C. Weigert (WE 4176/1-1) and to M. Düfer (DU425/1-2).

	ACKNOWLEDGMENTS

 
We thank M. Hoene for critical discussion.

	FOOTNOTES

 

Address for reprint requests and other correspondence: C. Weigert, Dept. of Internal Medicine, Division of Endocrinology, Metabolism, Pathobiochemistry and Clinical Chemistry, Univ. of Tuebingen, Otfried-Mueller-Strae 10, D-72076 Tuebingen, Germany (e-mail: cora.weigert{at}med.uni-tuebingen.de)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

	REFERENCES

TOP ABSTRACT EXPERIMENTAL PROCEDURES RESULTS DISCUSSION GRANTS REFERENCES

 
1. Ahn JD, Morishita R, Kaneda Y, Kim HJ, Kim YD, Lee HJ, Lee KU, Park JY, Kim YH, Park KK, Chang YC, Yoon KH, Kwon HS, Park KG, Lee IK. Transcription factor decoy for AP-1 reduces mesangial cell proliferation and extracellular matrix production in vitro and in vivo. Gene Ther 11: 916–923, 2004.[CrossRef][ISI][Medline]

2. Al Khalili L, Bouzakri K, Glund S, Lonnqvist F, Koistinen HA, Krook A. Signaling specificity of interleukin-6 action on glucose and lipid metabolism in skeletal muscle. Mol Endocrinol 20: 3364–3375, 2006.[Abstract/Free Full Text]

3. Banzet S, Koulmann N, Sanchez H, Serrurier B, Peinnequin A, Alonso A, Bigard X. Contraction-induced interleukin-6 transcription in rat slow-type muscle is partly dependent on calcineurin activation. J Cell Physiol 210: 596–601, 2007.[CrossRef][ISI][Medline]

4. Banzet S, Koulmann N, Simler N, Birot O, Sanchez H, Chapot R, Peinnequin A, Bigard X. Fibre-type specificity of interleukin-6 gene transcription during muscle contraction in rat: association with calcineurin activity. J Physiol 566: 839–847, 2005.[Abstract/Free Full Text]

5. Berchtold MW, Brinkmeier H, Muntener M. Calcium ion in skeletal muscle: its crucial role for muscle function, plasticity, and disease. Physiol Rev 80: 1215–1265, 2000.[Abstract/Free Full Text]

6. Bruce CR, Dyck DJ. Cytokine regulation of skeletal muscle fatty acid metabolism: effect of interleukin-6 and tumor necrosis factor-. Am J Physiol Endocrinol Metab 287: E616–E621, 2004.[Abstract/Free Full Text]

7. Carey AL, Steinberg GR, Macaulay SL, Thomas WG, Holmes AG, Ramm G, Prelovsek O, Hohnen-Behrens C, Watt MJ, James DE, Kemp BE, Pedersen BK, Febbraio MA. Interleukin-6 increases insulin-stimulated glucose disposal in humans and glucose uptake and fatty acid oxidation in vitro via AMP-activated protein kinase. Diabetes 55: 2688–2697, 2006.[Abstract/Free Full Text]

8. Chan MH, McGee SL, Watt MJ, Hargreaves M, Febbraio MA. Altering dietary nutrient intake that reduces glycogen content leads to phosphorylation of nuclear p38 MAP kinase in human skeletal muscle: association with IL-6 gene transcription during contraction. FASEB J 18: 1785–1787, 2004.[Abstract/Free Full Text]

9. Du JH, Xu N, Song Y, Xu M, Lu ZZ, Han C, Zhang YY. AICAR stimulates IL-6 production via p38 MAPK in cardiac fibroblasts in adult mice: a possible role for AMPK. Biochem Biophys Res Commun 337: 1139–1144, 2005.[ISI][Medline]

10. Febbraio MA, Pedersen BK. Muscle-derived interleukin-6: mechanisms for activation and possible biological roles. FASEB J 16: 1335–1347, 2002.[Abstract/Free Full Text]

11. Fernandez-Real JM, Ricart W. Insulin resistance and chronic cardiovascular inflammatory syndrome. Endocr Rev 24: 278–301, 2003.[Abstract/Free Full Text]

12. Frost RA, Nystrom GJ, Lang CH. Lipopolysaccharide regulates proinflammatory cytokine expression in mouse myoblasts and skeletal muscle. Am J Physiol Regul Integr Comp Physiol 283: R698–R709, 2002.[Abstract/Free Full Text]

13. Frost RA, Nystrom GJ, Lang CH. Multiple Toll-like receptor ligands induce an IL-6 transcriptional response in skeletal myocytes. Am J Physiol Regul Integr Comp Physiol 290: R773–R784, 2006.[Abstract/Free Full Text]

14. Garnier A, Fortin D, Zoll J, N'Guessan B, Mettauer B, Lampert E, Veksler V, Ventura-Clapier R. Coordinated changes in mitochondrial function and biogenesis in healthy and diseased human skeletal muscle. FASEB J 19: 43–52, 2005.[Abstract/Free Full Text]

15. Grynkiewicz G, Poenie M, Tsien RY. A new generation of Ca²⁺ indicators with greatly improved fluorescence properties. J Biol Chem 260: 3440–3450, 1985.[Abstract/Free Full Text]

16. Hardie DG. AMP-activated protein kinase: a key system mediating metabolic responses to exercise. Med Sci Sports Exerc 36: 28–34, 2004.

17. Hawley SA, Pan DA, Mustard KJ, Ross L, Bain J, Edelman AM, Frenguelli BG, Hardie DG. Calmodulin-dependent protein kinase kinase- is an alternative upstream kinase for AMP-activated protein kinase. Cell Metab 2: 9–19, 2005.[CrossRef][ISI][Medline]

18. Hiscock N, Chan MH, Bisucci T, Darby IA, Febbraio MA. Skeletal myocytes are a source of interleukin-6 mRNA expression and protein release during contraction: evidence of fiber type specificity. FASEB J 18: 992–994, 2004.[Abstract/Free Full Text]

19. Ho RC, Hirshman MF, Li Y, Cai D, Farmer JR, Aschenbach WG, Witczak CA, Shoelson SE, Goodyear LJ. Regulation of IB kinase and NF-B in contracting adult rat skeletal muscle. Am J Physiol Cell Physiol 289: C794–C801, 2005.[Abstract/Free Full Text]

20. Holmes AG, Watt MJ, Carey AL, Febbraio MA. Ionomycin, but not physiologic doses of epinephrine, stimulates skeletal muscle interleukin-6 mRNA expression and protein release. Metabolism 53: 1492–1495, 2004.[CrossRef][ISI][Medline]

21. Jensen TE, Rose AJ, Hellsten Y, Wojtaszewski JF, Richter EA. Caffeine-induced Ca²⁺ release increases AMPK-dependent glucose uptake in rodent soleus muscle. Am J Physiol Endocrinol Metab 293: E286–E292, 2007.[Abstract/Free Full Text]

22. Jensen TE, Rose AJ, Jorgensen SB, Brandt N, Schjerling P, Wojtaszewski JF, Richter EA. Possible CaMKK-dependent regulation of AMPK phosphorylation and glucose uptake at the onset of mild tetanic skeletal muscle contraction. Am J Physiol Endocrinol Metab 292: E1308–E1317, 2007.[Abstract/Free Full Text]

23. Juretic N, Garcia-Huidobro P, Iturrieta JA, Jaimovich E, Riveros N. Depolarization-induced slow Ca²⁺ transients stimulate transcription of IL-6 gene in skeletal muscle cells. Am J Physiol Cell Physiol 290: C1428–C1436, 2006.[Abstract/Free Full Text]

24. Keller C, Hellsten Y, Steensberg A, Pedersen BK. Differential regulation of IL-6 and TNF-alpha via calcineurin in human skeletal muscle cells. Cytokine 36: 141–147, 2006.[CrossRef][ISI][Medline]

25. Keller C, Steensberg A, Pilegaard H, Osada T, Saltin B, Pedersen BK, Neufer PD. Transcriptional activation of the IL-6 gene in human contracting skeletal muscle: influence of muscle glycogen content. FASEB J 15: 2748–2750, 2001.[Free Full Text]

26. Keller P, Keller C, Carey AL, Jauffred S, Fischer CP, Steensberg A, Pedersen BK. Interleukin-6 production by contracting human skeletal muscle: autocrine regulation by IL-6. Biochem Biophys Res Commun 310: 550–554, 2003.[CrossRef][ISI][Medline]

27. Kelly M, Keller C, Avilucea PR, Keller P, Luo Z, Xiang X, Giralt M, Hidalgo J, Saha AK, Pedersen BK, Ruderman NB. AMPK activity is diminished in tissues of IL-6 knockout mice: the effect of exercise. Biochem Biophys Res Commun 320: 449–454, 2004.[CrossRef][ISI][Medline]

28. Krutzfeldt J, Kausch C, Volk A, Klein HH, Rett K, Haring HU, Stumvoll M. Insulin signaling and action in cultured skeletal muscle cells from lean healthy humans with high and low insulin sensitivity. Diabetes 49: 992–998, 2000.[Abstract]

29. Libermann TA, Baltimore D. Activation of interleukin-6 gene expression through the NF-kappa B transcription factor. Mol Cell Biol 10: 2327–2334, 1990.[Abstract/Free Full Text]

30. MacDonald C, Wojtaszewski JF, Pedersen BK, Kiens B, Richter EA. Interleukin-6 release from human skeletal muscle during exercise: relation to AMPK activity. J Appl Physiol 95: 2273–2277, 2003.[Abstract/Free Full Text]

31. Matsusaka T, Fujikawa K, Nishio Y, Mukaida N, Matsushima K, Kishimoto T, Akira S. Transcription factors NF-IL6 and NF-B synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proc Natl Acad Sci USA 90: 10193–10197, 1993.[Abstract/Free Full Text]

32. Musi N, Yu H, Goodyear LJ. AMP-activated protein kinase regulation and action in skeletal muscle during exercise. Biochem Soc Trans 31: 191–195, 2003.[ISI][Medline]

33. Paschoud S, Dogar AM, Kuntz C, Grisoni-Neupert B, Richman L, Kuhn LC. Destabilization of interleukin-6 mRNA requires a putative RNA stem-loop structure, an AU-rich element, and the RNA-binding protein AUF1. Mol Cell Biol 26: 8228–8241, 2006.[Abstract/Free Full Text]

34. Penkowa M, Keller C, Keller P, Jauffred S, Pedersen BK. Immunohistochemical detection of interleukin-6 in human skeletal muscle fibers following exercise. FASEB J 17: 2166–2168, 2003.[Abstract/Free Full Text]

35. Petersen EW, Carey AL, Sacchetti M, Steinberg GR, Macaulay SL, Febbraio MA, Pedersen BK. Acute IL-6 treatment increases fatty acid turnover in elderly humans in vivo and in tissue culture in vitro. Am J Physiol Endocrinol Metab 288: E155–E162, 2005.[Abstract/Free Full Text]

36. Pradhan AD, Manson JE, Rifai N, Buring JE, Ridker PM. C-reactive protein, interleukin 6, and risk of developing type 2 diabetes mellitus. JAMA 286: 327–334, 2001.[Abstract/Free Full Text]

37. Soderling TR. The Ca-calmodulin-dependent protein kinase cascade. Trends Biochem Sci 24: 232–236, 1999.[CrossRef][ISI][Medline]

38. Weigert C, Brodbeck K, Staiger H, Kausch C, Machicao F, Haring HU, Schleicher ED. Palmitate, but not unsaturated fatty acids, induces the expression of interleukin-6 in human myotubes through proteasome-dependent activation of nuclear factor-B. J Biol Chem 279: 23942–23952, 2004.[Abstract/Free Full Text]

39. Weigert C, Hennige AM, Brodbeck K, Haring HU, Schleicher ED. Interleukin-6 acts as insulin sensitizer on glycogen synthesis in human skeletal muscle cells by phosphorylation of Ser⁴⁷³ of Akt. Am J Physiol Endocrinol Metab 289: E251–E257, 2005.[Abstract/Free Full Text]

40. Weigert C, Sauer U, Brodbeck K, Pfeiffer A, Haring HU, Schleicher ED. AP-1 proteins mediate hyperglycemia-induced activation of the human TGF-₁ promoter in mesangial cells. J Am Soc Nephrol 11: 2007–2016, 2000.[Abstract/Free Full Text]

41. Witczak CA, Fujii N, Hirshman MF, Goodyear LJ. Ca²⁺/calmodulin-dependent protein kinase kinase alpha regulates skeletal muscle glucose uptake independent of AMPK and Akt activation. Diabetes 56: 1403–1409, 2007.[Abstract/Free Full Text]

42. Woods A, Dickerson K, Heath R, Hong SP, Momcilovic M, Johnstone SR, Carlson M, Carling D. Calcium/calmodulin-dependent protein kinase kinase-beta acts upstream of AMP-activated protein kinase in mammalian cells. Cell Metab 2: 21–33, 2005.[CrossRef][ISI][Medline]

43. Wu H, Rothermel B, Kanatous S, Rosenberg P, Naya FJ, Shelton JM, Hutcheson KA, DiMaio JM, Olson EN, Bassel-Duby R, Williams RS. Activation of MEF2 by muscle activity is mediated through a calcineurin-dependent pathway. EMBO J 20: 6414–6423, 2001.[CrossRef][ISI][Medline]

44. Xi X, Han J, Zhang JZ. Stimulation of glucose transport by AMP-activated protein kinase via activation of p38 mitogen-activated protein kinase. J Biol Chem 276: 41029–41034, 2001.[Abstract/Free Full Text]

45. Yarovinsky TO, Butler NS, Monick MM, Hunninghake GW. Early exposure to IL-4 stabilizes IL-4 mRNA in CD4+ T cells via RNA-binding protein HuR. J Immunol 177: 4426–4435, 2006.[Abstract/Free Full Text]

46. Yeung D, Zablocki K, Lien CF, Jiang T, Arkle S, Brutkowski W, Brown J, Lochmuller H, Simon J, Barnard EA, Gorecki DC. Increased susceptibility to ATP via alteration of P2X receptor function in dystrophic mdx mouse muscle cells. FASEB J 20: 610–620, 2006.[Abstract/Free Full Text]

This article has been cited by other articles:

				B. M. Meador, C. P. Krzyszton, R. W. Johnson, and K. A. Huey Effects of IL-10 and age on IL-6, IL-1{beta}, and TNF-{alpha} responses in mouse skeletal and cardiac muscle to an acute inflammatory insult J Appl Physiol, April 1, 2008; 104(4): 991 - 997. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 293/3/C1139    most recent 00142.2007v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (2) Citing Articles via Google Scholar Google Scholar Articles by Weigert, C. Articles by Schleicher, E. D. Search for Related Content PubMed PubMed Citation Articles by Weigert, C. Articles by Schleicher, E. D.