Am J Physiol Cell Physiol AJP: Endocrinology and Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 293: C468-C476, 2007. First published April 25, 2007; doi:10.1152/ajpcell.00286.2005
0363-6143/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/1/C468    most recent
00286.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jennings, M. L.
Right arrow Articles by Hannigan, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jennings, M. L.
Right arrow Articles by Hannigan, R.

MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS

Transport and regulatory characteristics of the yeast bicarbonate transporter homolog Bor1p

Michael L. Jennings,1 Todd R. Howren,1 Jian Cui,1 Maria Winters,1 and Robyn Hannigan2

1Department of Physiology and Biophysics, University of Arkansas for Medical Sciences, Little Rock; and 2Department of Chemistry and Physics, Arkansas State University, Jonesboro, Arkansas

Submitted 14 June 2005 ; accepted in final form 5 April 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The functional properties of the Saccharomyces cerevisiae bicarbonate transporter homolog Bor1p (YNL275wp) were characterized by measuring boron (H3BO3), Na+, and Cl fluxes. Neither Na+ nor Cl appears to be a transported substrate for Bor1p. Uphill efflux of boron mediated by Bor1p was demonstrated directly by loading cells with boron and resuspending in a low-boron medium. Cells with intact BOR1, but not the deletant strain, transport boron outward until the intracellular concentration is sevenfold lower than that in the medium. Boron efflux through Bor1p is a saturable function of intracellular boron (apparent Km ~1–2 mM). The extracellular pH dependences of boron distribution and efflux indicate that uphill efflux is driven by the inward H+ gradient. Addition of 30 mM HCO3 does not affect boron extrusion by Bor1p, indicating that HCO3 does not participate in Bor1p function. Functional Bor1p is present in cells grown in medium with no added boron, and overnight growth in 10 mM H3BO3 causes only a small increase in the levels of functional Bor1p and in BOR1 mRNA. The fact that Bor1p is expressed when there is no need for boron extrusion and is not strongly induced in the presence of growth-inhibitory boron concentrations is surprising if the main physiological function of yeast Bor1p is boron efflux. A possible role in vacuolar dynamics for Bor1p was recently reported by Decker and Wickner (10). Under the conditions used presently, there appears to be mildly abnormal vacuolar morphology in the deletant strain.

boron; SLC4; YNL275w


THE BICARBONATE TRANSPORTER gene family known as SLC4 (28) includes Na+-independent Cl/HCO3 exchangers, electrogenic and electroneutral Na+-HCO3 cotransporters, and Na+-dependent anion exchangers (1, 18, 26). The functions of these transporters have been characterized extensively in mammals and in some invertebrates (27). In addition, the genomes of plants and fungi (but not prokaryotes) contain open reading frames (ORFs) that are members of SLC4 but whose functions are, for the most part, not well established. An exception is the Arabidopsis thaliana SLC4 ORF known as BOR1, which was shown by Takano et al. (32) to be necessary for boron1 [B(OH)3/B(OH)4] loading of xylem. A. thaliana Bor1p functions as a pathway for uphill boric acid efflux from pericycle cells into root stellar apoplasm (32), thereby increasing the concentration of boron in xylem. In Arabidopsis, boron levels do not strongly affect BOR1 gene transcription; the level of functional transporter, however, is regulated by stimulation of endocytosis and degradation of Bor1p when boron levels are high (31).

In their study of Arabidopsis BOR1, Takano et al. (32) found that a homologous Saccharomyces cerevisiae ORF, YNL275w (BOR1),2 is responsible for the ability of yeast to maintain a low cellular boron content following incubation for 1 h in medium containing 0.5 mM boric acid. More recently Nozawa et al. (20) showed that BOR1 deletant strains are more susceptible than wild-type strains to growth inhibition by boric acid and that overexpression of BOR1 produces further protection against boric acid toxicity. Very recently, Takano et al. (30) published the first boron transport measurements in yeast, showing that efflux is slower in the deletant strain than in the wild-type strain.

Other functional information about Bor1p comes from the work of Zhao and Reithmeier (37), who expressed S. cerevisiae Bor1p with a COOH-terminal tag and found that the protein is targeted to the plasma membrane and is not a glycoprotein. They also found that Bor1p can bind stilbenedisulfonates and that this binding can be inhibited by monovalent inorganic anions, but not by sulfate or phosphate. A recent study by Decker and Wickner (10) showed that S. cerevisiae Bor1p-green fluorescent protein (GFP) localizes preferentially to the vacuole and that cells lacking Bor1p have fragmented vacuoles. These findings suggest a role for yeast Bor1p in the trafficking of proteins needed for vacuole fusion.

A separate SLC4 member (human SLC4 A11), previously known as BTR1 (24) and renamed NaBC1, was shown recently by Park et al. (23) to be an electrogenic Na+-borate [B(OH)4] cotransporter. In the absence of boric acid, NaBC1 acts as a conductive pathway for Na+ and H+/OH. Park et al. (23) further showed that boric acid and/or borate, at low concentrations (<0.5 mM), activates the MAP kinase pathway and stimulates mammalian cell growth. Higher boric acid/borate concentrations inhibit growth. Overexpression of NaBC1 causes both the stimulatory and inhibitory effects of boron to take place at lower concentrations, indicating that NaBC1 uses the inward Na+ gradient to drive an uphill influx of borate (23).

The experiments described in this article were designed to test several functional characteristics of boron transport through S. cerevisiae Bor1p, including the driving force for uphill transport, the possible role of bicarbonate, the saturability of efflux, the regulation of the transporter by boron in the growth medium, and the proposed effect of Bor1p on vacuolar morphology. We demonstrate directly that Bor1p mediates a saturable uphill boron efflux, with characteristics consistent with a bicarbonate-independent exchange of extracellular H+ for intracellular H3BO3. Functional Bor1p is constitutively expressed in cells grown in rich medium without added boron, and functional protein as well as BOR1 mRNA are increased only slightly during growth in boron concentrations that significantly inhibit growth. The lack of major induction results in only a limited ability of native Bor1p to increase the resistance of yeast to growth inhibition by boric acid.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Materials, strains, and growth conditions. Unless otherwise indicated, all media, salts, buffers, and other chemicals were obtained from Fisher Scientific (Pittsburgh, PA) or Sigma-Aldrich (St. Louis, MO). Boric acid transport experiments were performed on Euroscarf strains 1169 and 6808, purchased from Invitrogen (Carlsbad, CA). Both strains were derived from strain BY4741 (MATa his3{Delta}1 leu2{Delta}0 met15{Delta}0 ura3{Delta}0). Strain 1169 is the BOR1 deletant, and strain 6808 is an arbitrarily chosen control deletant that lacks MET3 (ATP sulfurylase), a gene that is not needed for growth in rich medium. The deleted genes were replaced by a KanMX module that confers resistance to geneticin (G418). For the boron transport experiments, strains were grown aerobically in YPD medium (1% Difco yeast extract, 2% Bacto-peptone, 2% glucose) plus 0.25 mg/ml G418 at 30°C with rotary shaking.

Radionuclides (22Na+ and 36Cl) were purchased from DuPont NEN (Boston, MA). Plasmid expression of Bor1p as well as 22Na+ and 36Cl transport experiments were performed with BOR1 deletant strain 1169 and also with strain FKY282 (MAT{alpha} SRP40 pep4::LEU2 ura3-12 leu2-3,-112 his3-11,-15 trp1-1 ade2-1, kanamycin resistant), the strain used by Groves et al. (14) to express the membrane domain of the human AE1 anion exchanger. Influx of 22Na+ was also measured in strain B31 (MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1, ura3-1, mall0, ena1{Delta}::HIS3::ena4{Delta} nha1{Delta}::LEU2), which is deleted in several Na+ efflux pathways (2).

Preparation of plasmid pG1T containing epitope-tagged BOR1. Plasmid pG1T was a generous gift from Robert Farley (University of Southern California). The sole EcoRI site in pG1T, near the GAL1 promoter, was removed by site-directed mutagenesis (QuikChange; Stratagene, La Jolla, CA), and an EcoR1 site was introduced into the multiple cloning site. The BOR1 ORF was amplified from genomic DNA (from strain FKY282) using PCR with primers located 226 bases upstream of the translation start site and 88 bases downstream of the stop codon. The 5' end of each primer contained sequences for restriction sites (EcoRI and NheI), which were used to insert the PCR product into the multiple cloning site of pG1T. The final construct (pG1T/BOR1), including hemagglutinin sequences between the initiator methionine and the remaining BOR1 ORF, was verified by sequencing.

Boric acid/borate influx. Overnight cultures were centrifuged and resuspended in YPD (same volume as the original culture) buffered with 5 mM citrate, titrated to pH 5.2 with KOH, plus various concentrations of B(OH)3 to initiate influx, and incubated with shaking at 30°C. At various times, aliquots were diluted >10-fold in ice-cold distilled water and centrifuged immediately (2 min, 4,000 rpm), and the supernatant was removed completely. Cell pellets were resuspended in 50 or 100 µl of water and heated for 30 min at 100°C (32). Solids were centrifuged in a microfuge, and 25 µl of supernatant were assayed for total boron colorimetrically by the curcumin reaction (Texas A&M Technical Bulletin; http://www-odp.tamu.edu/publications/tnotes/tn15/f_chem2.htm). Boron content is represented as millimoles per liter of cell water. Interference in the assay by other components of the cellular extract was not significant, as indicated by the fact that late time points in efflux experiments in low-boron media showed negligible boron contents. As an additional confirmation of the validity of the assay, cellular boron contents were also measured on some of the samples by inductively coupled plasma mass spectrometry (ICP-MS), using a PerkinElmer Sciex DRC II Dynamic Reaction Cell ICP-MS (13). Results using the two methods were indistinguishable (see GoFig. 2A).


Figure 1
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 1. Lack of effect of deletion or overexpression of the Saccharomyces cerevisiae bicarbonate transporter homolog Bor1p on 36Cl or 22Na+ influx. A: BOR1 deletant strain carrying plasmid pG1T/BOR1 was grown in yeast nitrogen broth (YNB) medium containing either 2% glucose (bullet) or 2% galactose ({blacktriangledown}). Influx of 36Cl was measured at 22°C in YNB (4 mM total Cl). B: wild-type BOR1 (strain FKY282; bullet) or BOR1 deletant cells ({blacktriangledown}) were grown overnight at 30°C in YNB medium in which all but ~5 µM Cl was replaced by SO42–. Influx of 36Cl was measured for 2, 4, 6, and 8 min at 22°C after changing to fresh medium and adding 0.036, 0.1, 0.36, or 1.08 mM Na36Cl. The curves drawn through the data are Michaelis-Menten functions with Km = 0.013 (bullet) and 0.010 mM ({blacktriangledown}). C: influx of 22Na+ was measured for 2–15 min at 22°C in YNB medium (1.7 mM total Na+) in the following strains: left, wild-type vs. BOR1 deletant strain (Del); middle, BOR1 deletant strain with pG1T/BOR1, grown in 2% glucose or 2% galactose; and right, strain B31 grown in YNB/galactose with or without transformation by pG1T/BOR1. WT, wild type.

 

Figure 2
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 2. A: comparison of cellular boron contents by the curcumin method and inductively coupled plasma mass spectrometry (ICP-MS). Yeast cells were incubated in YPD medium (1% Difco yeast extract, 2% Bacto-peptone, 2% glucose) containing various concentrations of H3BO3. Cells were centrifuged, resuspended in YPD, incubated for various times, and then centrifuged to stop the boron efflux. Cells were then heated for 30 min at 100°C in 50 or 100 µl of water. Boron content of the extract was determined using either the curcumin method or ICP-MS (see MATERIALS AND METHODS). B: time course of increase in cellular boron in S. cerevisiae strains with wild-type (bullet) or deleted BOR1 ({blacktriangleup}). Cells from overnight cultures were suspended in YPD plus 4 mM B(OH)3 and incubated at 30°C. Suspension was diluted 10-fold in cold water at the indicated times and centrifuged immediately, and total cellular boron was determined using the curcumin method. Error bars represent range of data for 2 determinations on a single cell preparation. C: steady-state boron distribution ratios (cell water:extracellular medium) in wild-type (bullet) or BOR1 deletant strains ({blacktriangleup}) following incubation in YPD containing 5 mM citrate, pH 5.0–5.3, at 30°C for 60–90 min in the presence of 1, 2, 4, 8, or 16 mM H3BO3. Error bars represent range of data for 2 experiments (1 and 16 mM boron) or SD for 3–4 experiments (2, 4, or 8 mM boron). [B], boron concentration.

 
For investigation of the effect of bicarbonate on boron distribution, cells from overnight cultures were incubated 1 h at 30°C in YPD medium containing 2 or 4 mM boron, buffered with 5 mM K-citrate and 10 mM Bis-Tris (pH 6.2) or 50 mM MES-Tris (pH 7.0). Comparisons were made of boron contents of cells in two parallel 10-ml suspensions. In one of the suspensions, KHCO3 was added from a 1 M stock to a final concentration of 29 mM, and the suspension was bubbled (50–100 ml/min) with a mixture of air, O2, and CO2 to keep the extracellular pH at 6.2 ± 0.1 (70% CO2) or 7.0 ± 0.1 (~12% CO2) and the O2 between 21 and 30%. The extracellular pH in the CO2/HCO3-supplemented suspensions drifted downward very slowly, and no addition of base was needed to keep the pH in the stated range during the incubation. In the other suspension, no addition of KHCO3 was made, and the suspension was bubbled with air to minimize the accumulation of CO2 and HCO3. The extracellular pH of the air-bubbled suspension was monitored continuously, and additions of KOH were made periodically to keep the pH with 0.1 unit of the initial pH. After 1 h, aliquots of both suspensions were diluted 10-fold in ice-cold distilled water and centrifuged immediately, and the cellular boron contents were determined as described above.

Cell water was calculated from the wet weight of the cell pellet, with the assumption that the cell pellet contains 0.78 g total water/g pellet (measured on several samples of haploid strains), of which 0.28 g is outside the plasma membrane (based on the difference in boron content of cold-washed and unwashed cells). This estimate of extracellular water agrees with that of Conway and Downey (8).

Boron efflux. Following incubation for 60–90 min or overnight in YPD plus various concentrations of boric acid, cells were centrifuged and immediately resuspended in 200 volumes of YPD buffered with 5 mM citrate, pH 5.2–5.3, at 30°C to initiate efflux, and intracellular boron concentration was measured in aliquots following centrifugation at various times. For each time point, the instantaneous efflux was estimated from the difference between the intracellular boron concentrations at the previous and following time point divided by the time interval between the previous and following time points.

RT-PCR. RNA was extracted from yeast with Trizol reagent (Invitrogen) and reverse transcribed with Moloney murine leukemia virus reverse transcriptase (ABgene, Rochester, NY) primed with random hexamers. Real-time PCR was performed using a MyIQ thermal cycler (Bio-Rad, Hercules, CA) with primers obtained from Integrated DNA Technologies (Coralville, IA). Primers for amplifying BOR1 were designed using Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) and had the sequences ACTTGGCTGGCATATGAACC (forward) and ATTCCTAGAACCCCGCTGAT (reverse). Control PCR reactions verified the absence of genomic DNA.

Differential interference contrast and FM 4-64 microscopy. Fluorescent dye FM4-64 [N-(3-triethylammoniumpropyl)-4-(p-diethylaminophenylhexatrienyl) pyridinium dibromide; Synapto red] was purchased from Calbiochem (La Jolla, CA). Cells were labeled with FM4-64 essentially as described by Vida and Emr (34). Overnight cultures of control and BOR1 deletant strains were centrifuged and resuspended in YPD at absorbance (600 nm) of 20, and FM 4-64 was added to a final concentration of 32 µM from a 16 mM stock in DMSO. Cells were incubated with dye for 15 min, centrifuged, resuspended in YPD, and incubated for 1 h at 30°C to allow the dye to be internalized and traffic to the vacuole (34) and was then put on ice before slide preparation. The suspension (2 µl), either in YPD or after centrifugation and resuspension in water, was applied to glass slides coated with polylysine, covered with an 18 x 18-mm coverslip, sealed with nail polish, and examined immediately using a Zeiss Axiovert 200M microscope with a x100 objective. Final images (see GoGoGoGoGoFig. 8) were prepared from raw micrographs using NIH ImageJ software.


Figure 3
View larger version (18K):
[in this window]
[in a new window]

 
Fig. 3. Saturable boron efflux mediated by Bor1p. A: time course of efflux of boron from cells with deleted BOR1 (strain 1169). Cells were loaded with boron by incubation in YPD plus 2, 4, or 16 mM B(OH)3 for 1.5 h at 30°C. Efflux was measured in YPD with no added boron, pH 5.0–5.5, at 30°C. B: time course of efflux of boron from cells with wild-type BOR1 (strain 6808). Cells were loaded with boron by incubation in YPD plus 4, 8, or 16 mM B(OH)3 for 1.5 h at 30°C. Efflux was measured as in A. C: efflux of boron into YPD medium as a function of the intracellular boron concentration ([B]in) [strain 6808 (wild-type BOR1)]. Data points were derived from the efflux measurements in Fig. 4B and other similar experiments (see MATERIALS AND METHODS). Open circles represent efflux from cells that had been grown overnight in YPD plus 10 mM H3BO3; filled symbols represent efflux from cells that had been exposed to 4, 8, 10, or 16 mM H3BO3 for 60–90 min before the efflux was measured. The dashed line represents the diffusive efflux measured in the deletant strain (from data in A). The curve through the data represents a Michaelis-Menten function added to the diffusive efflux represented by the dashed line. The Michaelis-Menten parameters for the curve were Vmax = 0.67 mmol·liter cell water–1·min–1 and Km = 1.8 mmol/liter cell water. cw, Cell water.

 

Figure 4
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 4. Direct demonstration of active boron efflux mediated by Bor1p. Yeast cells of strain 1169 (BOR1 deletant) or 6808 (wild-type BOR1) were incubated for 90 min in YPD containing 40 mM H3BO3 and 5 mM citrate buffer, pH 5.5. Cells were centrifuged and resuspended in YPD and 5 mM citrate, pH 5.5, and incubated at 30°C. At the indicated times, aliquots were centrifuged, and the boron contents of cells ([B]in) and medium ([B]out) were measured using the curcumin method.

 

Figure 5
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 5. A: time course of efflux of boron into YPD medium at extracellular pH 5.0 ± 0.1 and 6.6 ± 0.4. Cells from strain 6808 (wild-type BOR1) were loaded with boron by preincubation for 1 h at 30°C in YPD plus 5 mM B(OH)3. Cells were centrifuged and resuspended at 22°C in YPD buffered with 10 ({blacktriangledown}) or 20 mM MOPS ({blacktriangleup}) (initial pH 7.0) or 10 mM MOPS and 5 mM citrate, pH 5.0 ({blacksquare}, bullet). The lines through the data correspond to efflux rate constants of 0.068 min–1 ({blacktriangledown}, {blacktriangleup}) and 0.155 min–1 ({blacksquare}, bullet). B: lack of effect of HCO3/CO2 on the steady-state distribution of boron. Cells from strain 6808 were incubated 60 min in YPD, pH 6.2 ± 0.1 or 7.0 ± 0.1, containing 2 mM H3BO3, and the boron distribution was measured at 30°C as in Fig. 3, in the presence (CO2) and absence (air) of 25–30 mM HCO3/CO2 (see MATERIALS AND METHODS). Bars represent means and SD of a total of 4 determinations using 2 separate cell preparations at each pH value. C: lack of effect of HCO3/CO2 on boron efflux. Overnight cultures of strain 6808 were loaded with boron by incubation for 1 h at 30°C in YPD and 4 mM H3BO3, buffered with 10 mM Bis-Tris and 5 mM citrate. Suspensions were bubbled with air (no added HCO3) or with 70% CO2-30% O2 and 29 mM added KHCO3. In both cases, the extracellular pH was 6.35 ± .05. After boron loading, cells were centrifuged, supernatant was removed, and efflux was initiated by resuspension at 22°C in the same medium (air or CO2/HCO3) without added boron.

 

Figure 6
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 6. A: time course of boron efflux from cells of strain 6808 (wild-type BOR1) that had been incubated in YPD plus 10 mM or 40 mM H3BO3 for either 1 h (bullet, {circ}) or overnight ({blacktriangleup}, {triangleup}). Efflux was measured at 30°C in YPD with no added boron, as in Fig. 3. B: relative levels of BOR1 mRNA of cells of strain 6808 grown overnight in YPD with 0 or 10 mM added H3BO3. Error bars represent range of 2 determinations on 2 different cell preparations with real-time RT-PCR.

 

Figure 7
View larger version (18K):
[in this window]
[in a new window]

 
Fig. 7. Effect of boric acid on growth of S. cerevisiae. Exponential cultures were diluted in media containing 0, 3, 6, 10, 20, 40, 60, or 80 mM B(OH)3 and incubated at 30°C aerobically with rotary shaking. Cell density was measured at 60- to 90-min intervals as absorbance at 590 nm. Growth rate was calculated by fitting absorbance to an exponential function of time for at least 4 data points covering 4–6 h. Rates are plotted relative to the rate with no added boron. A: strain 1169 (BOR1 deletant) or strain 6808 (wild-type BOR1) grown in YPD (2% glucose). Values are means ± SD of 3 cell preparations. B: strain 1169 (BOR1 deletant) with plasmid pG1T/BOR1 (overexpressed) grown in YNB (2% galactose or 2% glucose). Values are means ± range of 2 cell preparations. For comparison, the dotted curves at right represent the data for the deletant strain from the respective strain at left.

 

Figure 8
View larger version (100K):
[in this window]
[in a new window]

 
Fig. 8. Vacuole morphology in wild-type and BOR1 deletant strains. Overnight cultures in YPD were labeled with FM4-64 as described by Vida and Emr (34) (see MATERIALS AND METHODS). Slides were prepared of cells either in YPD (A and C) or within 30 min of suspension in water (B and D). Images at left of each panel are differential interference contrast images, and images at right are FM4-64 fluorescence.

 

    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Lack of 22Na+ or 36Cl flux mediated by Bor1p. Because many members of the bicarbonate transporter family (SLC4) transport Cl, Na+, or both (1, 18, 26), it is of interest to test these ions as potential substrates of Bor1p. Overexpression of BOR1 in the deletant strain did not increase the influx of either 22Na+ or 36Cl (Fig. 1). Overexpression of BOR1 in strain B31, which is deficient in several Na+ efflux pathways (2), also did not stimulate 22Na+ influx (Fig. 1C). We also examined 36Cl influx at concentrations of 0.01–1 mM, which are lower than those that have been investigated previously in yeast (9, 14, 17). Influxes at low concentration revealed the existence of a high-affinity transporter for 36Cl, which are described separately (Jennings ML and Cui J, unpublished observations). The high-affinity Cl flux was present in both the wild-type and the BOR1 deletant strain (Fig. 1B) and was therefore not catalyzed by Bor1p. We conclude that neither Na+ nor Cl is transported by Bor1p under the conditions examined.

Steady-state distribution of boron and time course of influx. Figure 2B shows the time course of increase of total cellular boron for cells incubated at 30°C in YPD plus 4 mM H3BO3, buffered at pH 5.2 with 5 mM Na-citrate. In the BOR1 deletant strain, the time course of influx was indistinguishable from a single exponential, with a steady-state cellular boron content that was slightly lower (per unit cell water) than the extracellular concentration. The steady-state boron distribution ratio ([B]in/[B]out) was 0.7–0.8. This distribution ratio may not be significantly different from unity, considering that after 60–90 min, the influx had only reached about 95% of equilibrium, and there were minor losses (probably 5–10%, but difficult to measure) of boron during the wash before analysis. Given these considerations, a measured distribution ratio of 0.7–0.8 in the deletant strain is very close to that expected for a passive distribution. Our data indicate that, to a first approximation, boron is neither extruded from nor concentrated in the cells of the BOR1 deletant strain.

It should be pointed out that the boron distribution ratio in the BOR1 deletant (Fig. 2) was significantly lower than those reported very recently by Takano et al. (30) in the same strain. For example, Takano et al. (30) found that at an extracellular boron concentration of 10 mM, the cellular boron was 19 mmol/kg wet wt, which was over 30 mmol per liter of intracellular water. The difference between our data and those of Takano et al. (30) is not likely to be caused by the analytical method; curcumin and ICP-MS give the same values for boron concentration in hot water extracts of yeast (Fig. 2A).

In strains with wild-type BOR1, cellular boron reached a steady-state level more rapidly than in the deletant strain (Fig. 2B), and the steady-state level was far lower than that expected for a passive distribution. Figure 2C shows the steady-state boron distribution ratio as a function of extracellular concentration. As expected for a passive distribution, the symmetrical boron distribution in the deletant strain was independent of concentration over the range studied. In contrast, for cells with wild-type BOR1, the distribution ratio [B]in/[B]out became progressively larger at higher concentrations; at 16 mM boron, the two strains had similar intracellular boron contents, as expected if Bor1p-mediated efflux is a saturable function of the intracellular boron concentration. The concentration dependence of boron distribution ratio in the wild-type strain is in qualitative agreement with data of Takano et al. (30, 32).

Boron efflux mediated by Bor1p. The time course of net boron efflux into a low-boron medium at 30°C is shown in Fig. 3. Cells were incubated 1 h in YPD containing various concentrations of H3BO3 and then washed and resuspended in YPD, pH 5.2, with no added boron. The time course of efflux in the deletant strain was indistinguishable from a single exponential at all concentrations (Fig. 3A). The half-time for efflux in the deletant strain was 12–15 min, similar to the time course for influx (Fig. 2) and in excellent agreement with the half-time for boron efflux in the same deletant strain published by Takano et al. (30).

In contrast to the deletant strain, the time course of boron efflux from the wild-type strain was exponential only at the lowest concentrations (Fig. 3B). At cellular boron concentrations above ~1 mM, the semilogarithmic slope was progressively steeper as the intracellular concentration decreased, indicating that efflux saturates at high boron concentrations. Instantaneous effluxes at each intracellular boron concentration are plotted in Fig. 3C. Efflux was described reasonably well by a hyperbolic (Michaelis-Menten) function plus a nonsaturable component, the magnitude of which was derived independently from the fluxes in the knockout strain (Fig. 3A). The maximal efflux for the saturable component was 0.7 mmol·liter cell water–1·min–1, and the half-maximal intracellular boron concentration was roughly 1–2 mM.

Direct demonstration of uphill boron efflux. The steady-state distribution and efflux rates of boron in wild-type strain were certainly consistent with the idea that Bor1p mediates an uphill boron efflux. A direct demonstration of active boron transport requires loading of cells with a high boron concentration and showing that Bor1p can transport boron outward against a gradient. In the experiment shown in Fig. 4, cells were preloaded in YPD medium containing 40 mM H3BO3, centrifuged, and resuspended in medium containing 2 mM H3BO3, and the time courses of intracellular and extracellular boron concentrations were measured. In the deletant strain, intracellular boron concentration dropped progressively from an initial value of over 20 mM to a final value very close to the extracellular concentration, as expected if boron transport in these cells is mainly by way of passive diffusion. In the wild-type strain, the boron concentration dropped to a value far below the extracellular level, demonstrating directly that Bor1p catalyzed an uphill efflux of boron, resulting in an inward gradient of about sevenfold. The final boron distribution in cells preloaded in a 40 mM boron medium and then resuspended in 2 mM boron was indistinguishable from that of cells in 2 mM boron with no preexposure to high boron concentration (Fig. 2).

Extracellular pH dependence of efflux suggests H+ antiport. The rate of efflux of boron from cells with intact BOR1 was dependent on the extracellular pH (Fig. 5A). Efflux was more rapid at pH 5.5 than at pH 6.5–7, consistent with the idea that the uphill boron efflux is driven by the inward H+ gradient. Figure 5B shows that the steady-state distribution of boron was more symmetrical at higher pH, again consistent with the idea that the uphill boron efflux is driven by an influx of H+. We attempted to detect H+ influx associated with boron efflux, but the background rate of H+ efflux was too high to detect an decrement associated with boron transport.

Lack of effect of bicarbonate on boron distribution and efflux. Because Bor1p is a member of the bicarbonate transporter family, it was of interest to determine whether bicarbonate itself is either transported by Bor1p or affects boron transport. Tracer (H14CO3 ) bicarbonate transport measurements are possible in principle, but only with extremely high pH on both sides of the membrane (see Ref. 36); these conditions are not compatible with a study of intact yeast. It is, however, possible to vary CO2/HCO3 at constant extracellular pH and measure the effect on boron distribution and transport. Figure 5B shows that at extracellular pH of either 6.2 or 7.0, the steady-state boron distribution was not affected by the presence of 25 mM HCO3 (with sufficient CO2 to be in equilibrium with HCO3 at the stated pH). Moreover, net boron efflux into a low-boron (10–5 M) medium at pH 6.35 was not affected by 29 mM HCO3 (Fig. 5C). The fact that there was no detectable effect of ~30 mM HCO3 in the extracellular medium (which must also increase intracellular CO2 and HCO3) suggests that bicarbonate does not interfere with boron transport (see DISCUSSION).

Lack of induction of BOR1 by growth in media containing H3BO3. The rate of boric acid efflux was not strongly affected by the duration of exposure of cells to boric acid. The filled symbols in Fig. 3C refer to cells that had been acutely loaded with H3BO3 for 1–1.5 h. Data indicated by open symbols were derived from experiments on cells that had been grown overnight in 10 mM H3BO3. This concentration retarded growth somewhat (see below) but allowed growth of cells in sufficient quantities for transport assays. The boron efflux at each intracellular concentration was indistinguishable in cells loaded overnight from that in cells exposed to boron for 1–1.5 h. This finding is illustrated further in Fig. 6A, which shows the time course of boron efflux from parallel cultures, each of which was loaded with boron by incubation in 10 mM H3BO3. One of the cultures was incubated with 10 mM H3BO3 overnight, and the other was incubated for 1 h. There may have been a slight increase in the rate of efflux in the cells that had been exposed to boron overnight, but the effect was small. Overnight incubation at an even higher boron concentration, 40 mM, also did not increase the rate of boron efflux compared with cells loaded for only 1.6 h (Fig. 6A, open symbols).

Figure 6B shows the relative amounts of BOR1 mRNA, as estimated by real-time RT-PCR on extract of cells from the same cultures as those used in the transport experiments in Fig. 6A. There may have been a slight stimulation of mRNA levels by incubation in 10 mM H3BO3, but, as was observed with transport, the effect was small. Therefore, expression of neither BOR1 mRNA nor functional Bor1p is strongly stimulated by growth in media containing concentrations of H3BO3 sufficient to cause a severalfold inhibition of cumulative growth in overnight cultures (see below).

Effect of H3BO3 on growth of S. cerevisiae. Although ~10–5 M H3BO3 is included in many synthetic culture media for S. cerevisiae (29), it is not clear whether boron is absolutely essential for yeast growth. Boron is, however, a significant nutrient for S. cerevisiae, because the addition of boric acid to nominally boron-free synthetic medium increases cell number by ~50% in overnight cultures (3). The half-maximal effect of boron on growth is in the low micromolar range (3). Using both the curcumin assay and ICP-MS, we estimated that the boron concentration in the YPD medium we used was 1–5 x 10–5 M. The boron concentration in normal YPD medium is therefore adequate for optimum growth.

At concentrations much higher than those normally found in growth medium, boric acid is known to be toxic to yeast (21, 22). If Bor1p is able to keep the cellular boron levels low in the presence of potentially toxic extracellular concentrations of boron, then the BOR1 deletant strain should be more susceptible than wild-type strains to growth inhibition by boron. Figure 7A shows that wild-type and BOR1 deletant strains had similar sensitivity to growth inhibition by H3BO3. Although expression of native Bor1 did not strongly protect yeast from growth inhibition by H3BO3, overexpression of Bor1p under control of the GAL1 promoter did protect (Fig. 7B), as expected from the work of Nozawa et al. (20).

Vacuolar morphology in BOR1 deletant strain. Decker and Wickner (10) recently showed that the majority of cells in a BOR1 deletant strain have fragmented vacuoles that lack several proteins normally associated with vacuoles. This finding suggests that Bor1p has a subcellular function that is distinct from its role as a plasma membrane transport protein. To investigate further a possible role of Bor1p in vacuolar dynamics, we used FM 4-64 fluorescence (10, 34) to examine vacuolar morphology in control and BOR1 deletant strains. For micrographs shown in Fig. 8, A and C, slides were prepared directly from suspensions in YPD. In these micrographs, the FM 4-64 fluorescence in most cells was mainly in one to three medium-sized vacuoles, very similar to the FM 4-64 pattern originally shown by Vida and Emr (34). Vacuolar morphologies in YPD were similar in BOR1 deletant and wild-type strains (Fig. 8, A and C), although there appeared to be slightly more cells with multiple vacuoles in the deletant strain. Because of the heterogeneity of vacuolar morphology in both wild-type and deletant strains, it is difficult to quantify the difference between the two strains in YPD medium.

It is known that suspending either Schizosaccharomyces pombe (4, 6) or Saccharomyces cerevisiae (35) in hyposmotic medium causes a rapid fusion of vacuoles into a single large organelle in most cells. Figure 8, B and D, shows vacuolar morphology of control and deletant strains within 30 min following resuspension in distilled water. The morphology is clearly distinct from that observed in YPD medium, with many cells showing single large vacuoles. Blind scoring of full fields indicated that the most common morphology in both strains was the single large vacuole but that the deletant strain had a higher percentage of cells (~25%) with multiple vacuoles than did the wild-type strain (~10%).

To ensure that the deletant strain used for microscopy was authentic, we measured cellular boron contents (following 60 min of incubation in 2 mM extracellular boron in YPD) in aliquots of the same cultures used for microscopy. As expected, the intracellular boron concentration in the contents of the wild-type strain were sevenfold lower than in the deletant strain. Our data indicate that there does appear to be an abnormal vacuolar morphology or a vacuolar fusion defect in the BOR1 deletant strain used, but the abnormality is not nearly as pronounced as that described by Decker and Wickner (10).


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Active efflux of boron driven by electrochemical H+ gradient. The transport experiments described provide direct demonstration of uphill boron efflux mediated by S. cerevisiae Bor1p (Fig. 4). The most likely mechanism for this efflux is a coupled exchange of intracellular H3BO3 for extracellular H+, as indicated by the fact that the steady-state boron gradient was steeper at more acid extracellular pH and net efflux was accelerated by lowering the extracellular pH (Fig. 5). In glucose-fed S. cerevisiae in the presence of extracellular K+ (in our experiments as K-citrate buffer), the cytoplasmic pH is near neutrality (7.0 ± 0.5) over a wide range (pH 4–8) of extracellular pH values (5, 25). It is reasonable to assume, therefore, that the cytoplasmic pH in our experiments was neutral and that the inward H+ gradient decreased as the extracellular pH was raised. Accordingly, the observed effect of extracellular pH on both the boron efflux and the steady-state distribution (Fig. 5) are consistent with the idea that Bor1p catalyzes a 1:1 exchange of H+ for H3BO3. A coupled H+/H3BO3 exchange through Bor1p is certainly consistent with the fact that other members of the bicarbonate transporter family are coupled exchangers or cotransporters (1, 18, 26). It is also worth noting that at least one member of the family, the anion exchanger AE1, can transport H+ under some circumstances (16, 19).

Lack of apparent interaction with bicarbonate. We found that there was no effect of 25–30 mM HCO3 on boron distribution or H3BO3 efflux mediated by Bor1p in the extracellular pH range 6.2–7.0 (Fig. 5). It has been known for many years that bubbling a yeast suspension with CO2 causes major buildup of intracellular HCO3 (5, 7). Therefore, intracellular and extracellular HCO3, CO2, and H2CO3H concentrations were all elevated in the experiments in Fig. 5, with no detectable effect on either boron distribution or efflux. The simplest interpretation of this finding is that HCO3 is not a substrate for yeast Bor1p. This is perhaps not surprising, given that H3BO3 is transported outward by Bor1p and that, under most conditions, there is an outward bicarbonate gradient in yeast [cytoplasmic pH higher than extracellular pH (5, 25)]. Accordingly, Bor1p clearly does not catalyze an exchange of HCO3 for H3BO3.

Takano et al. (32) measured the effect of neutral pH and HCO3 on boron distribution in wild-type yeast. In agreement with our data, they found that the boron distribution at neutral pH is much more symmetrical than at acid pH. They also found that addition of 30 mM NaHCO3 doubles the boron contents of yeast cells incubated in a medium containing 0.5 mM H3BO3 and buffered at pH 7 with MES-Tris. This result is clearly different from those of the experiment shown in Fig. 5, in which we found no effect of a similar HCO3 concentration. The final pH (after 1 h of incubation) of the suspensions used by Takano et al. (32) was not specified; it is possible that pH differences caused by the presence or absence of HCO3 could contribute to the observed effect of 30 mM HCO3 on boron distribution.

Other transport pathways for H3BO3. The present data can be explained nearly quantitatively without postulating any boron transport pathways other than efflux through Bor1p and passive diffusion across the lipid bilayer. The rate constant for boron efflux in the deletant strain is ~0.05/min (Fig. 3). For a cell with a volume-to-surface ratio of ~0.8 x 10–4 cm (29), this rate constant corresponds to a permeability coefficient of ~6 x 10–8 cm/s. This value is toward the lower end of the range (9.5 x 10–9 to 7 x 10–6 cm/s) determined by Dordas and Brown (11) for the passive permeability of lipid bilayer membranes to B(OH)3. This permeability coefficient is about fivefold lower than the H3BO3 permeability of squash root plasma membrane vesicles, where proteins of the aquaporin family may contribute to the H3BO3 flux (12). In S. cerevisiae the passive H3BO3 permeability is sufficiently low that there is no reason to postulate a role for aquaporins, and the recent data of Nozawa et al. (20) indicate that neither aquaporin AQY1 nor AQY2 has a measurable effect on boron distribution.

Nozawa et al. (20) also showed that deletion of the urea transporter DUR3 causes a decrease in the cellular boron level, suggesting that this transporter can drive boron into the cell or inhibit the efflux driven by Bor1p. Under the conditions we used, we did not find any evidence for uphill inward transport of boron; further work is needed to determine the mechanism by which DUR1 deletion causes a decrease in cellular boron.

Role of Bor1p in protecting yeast from boron toxicity. Our data on the effects of boron on growth are similar to those of Takano et al. (30), although they are presented in a somewhat different way. Our data are given as growth rates in exponential cultures, whereas Takano et al. (30) plotted cumulative growth after 11 h. Takano et al. found that cumulative growth of the deletant strain in 5 mM boron is 25% lower than that of the wild-type strain. In terms of growth rate of an exponential culture, this amounts to a difference of about 15%. We did not observe a detectable difference between wild-type and deletant strains regarding the effects of boron on growth rates, but it is possible that an effect of 15% would be within the error of our measurements.

Nozawa et al. (20) showed that in medium containing 90 mM boron, the deletion strain has about 10% more cellular boron than the wild-type strain (20). We did not examine concentrations this high, but a 10% difference is certainly compatible with the data we obtained at lower concentrations (Fig. 2). At high boron concentrations, the efflux driven by Bor1p is sufficient to cause a significant difference in growth on plates (20), although the cellular boron levels are decreased by only 10%.

Although it is quite clear from this study and the work of Takano et al. (32) that Bor1p catalyzes the uphill extrusion of boron across the plasma membrane of S. cerevisiae, it is also true that some of the characteristics of yeast boric acid transport described presently would not be expected if the main purpose of Bor1p were to protect cells from the toxic effects of boric acid/borate. Bor1p is constitutively expressed in cells grown in YPD medium, which contains boric acid at concentrations far below toxic levels, and the BOR1 gene is not induced by exposure of cell to boron (Fig. 6; see also Ref. 30). If the purpose of Bor1p were to extrude boric acid as a detoxification mechanism, then it would be surprising that the protein is produced under conditions in which it would not be needed and not strongly induced by conditions that would seem to require it.

Oxyanion transport by Bor1p? Zhao and Reithmeier (37) showed that a variety of inorganic anions, including some oxyanions, can compete for stilbenedisulfonate binding to Bor1p, and it is possible that Bor1p is a H+-coupled exchanger that can extrude not only boric acid but other inorganic species. Boron is a metalloid, along with silicon, germanium, arsenic, antimony, tellurium, and polonium. S. cerevisiae has separate mechanisms for arsenic and antimony resistance that are unrelated to BOR1 (33). Arsenite exposure has an approximately twofold stimulatory effect on transcription of BOR1 (15), and it is possible that Bor1p can transport arsenite or arsenate. There are many other possible oxides or oxyanions that could be substrates. In addition to determining the boron content of the control and BOR1 deletant strains, the cellular contents of 20 other metals and metalloids was determined by ICP-MS (data not shown). There were no consistent differences in the cellular contents of any of these elements in the deletant and control strains under the conditions tested. A systematic study using media containing specific additions of other metalloids is necessary to determine whether there are other substrates for Bor1p.

Possible effect on vacuolar morphology. The micrographs in Fig. 8 show that vacuolar morphology, in either YPD or hyposmotic medium, is similar in control and BOR1 deletant strains. There are slightly more cells with multiple vacuoles in the deletant strain, but the difference is much less dramatic than that found by Decker and Wickner (10), who showed that 95% of BOR1 deletant cells have fragmented vacuoles. We have no explanation for the difference between the two studies, and further work is needed to determine the extent of the vacuolar abnormality in BOR1 deletant strains under various growth conditions.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Institute of General Medical Sciences Grant R01 GM026861-25 (J. Evans was supported by National Institutes of Health Supplement GM026861-23S1).


    ACKNOWLEDGMENTS
 
We are grateful to Kernesha Townsend and Jonathan Evans for assistance in performing some of the boric acid transport experiments. We are also grateful to Vladimir Lupashin (University of Arkansas for Medical Sciences) and Bob Farley (University of Southern California) for providing yeast strains and helpful advice, to Brian Storrie (University of Arkansas for Medical Sciences) for assistance with microscopy, and to Clifford Slayman (Yale University) for helpful information about yeast cell water.


    FOOTNOTES
 

Address for reprint requests and other correspondence: M. L. Jennings, Dept. of Physiology and Biophysics, Univ. of Arkansas for Medical Sciences, 4301 W. Markham St., Mail Slot 505, Little Rock, AR 72205 (e-mail: jenningsmichaell{at}uams.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 For brevity, the word boron and its symbol B is used to denote boric acid [H3BO3; B(OH)3]. Whenever boric acid is present, its conjugate base borate [H4BO4 B(OH)4] will also be present in proportions dictated by the pKA (9.25) and the pH. When specific chemical species are discussed, the terms boric acid and borate are used, but otherwise, boron is used to mean boric acid/borate. We assume that the only chemical form of boron present is boric acid/borate, i.e., that boric acid is not chemically transformed to other compounds. Back

2 Following the work of Takano et al. (32), the ORF YNL275w has been designated BOR1 in the Saccharomyces Genome Database and National Institutes of Health database. Accordingly, BOR1 is used in this article to refer to this gene, and Bor1p is used to refer to the protein. Back


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Alper SL, Darman RB, Chernova MN, Dahl NK. The AE gene family of Cl/HCO3 exchangers. J Nephrol 15: S41–S53, 2002.[Web of Science][Medline]

2. Banuelos MA, Sychrova H, Bleykasten-Grosshans C, Souciet J, Potier S. The Nha1 antiporter of Saccharomyces cerevisiae mediates sodium and potassium efflux. Microbiology 144: 2749–2758, 1998.[Abstract/Free Full Text]

3. Bennett A, Rowe RI, Soch N, Eckhert CD. Boron stimulates yeast (Saccharomyces cerevisiae) growth. J Nutr 129: 2236–2238, 1999.[Abstract/Free Full Text]

4. Bone N, Millar JB, Toda T, Armstrong J. Regulated vacuole fusion and fission in Schizosaccharomyces pombe: an osmotic response dependent on MAP kinases. Curr Biol 8: 135–144, 1998.[CrossRef][Web of Science][Medline]

5. Calahorra M, Martinez GA, Hernandez-Cruz A, Pena A. Influence of monovalent cations on yeast cytoplasmic and vacuolar pH. Yeast 14: 501–515, 1998.[CrossRef][Web of Science][Medline]

6. Cheng H, Sugiura R, Wu W, Fujita M, Lu Y, Sio S, Kawai R, Takegawa K, Shuntoh H, Kuno T. Role of the Rab GTP-binding protein Ypt3 in the fission yeast exocytic pathway and its connection to calcineurin function. Mol Biol Cell 13: 2963–2976, 2002.[Abstract/Free Full Text]

7. Conway EJ, Brady TG. Biological production of acid and alkali. 1. Quantitative relations of succinic and carbonic acids to the potassium and hydrogen ion exchange in fermenting yeast. Biochem J 47: 360–369, 1950.[Web of Science][Medline]

8. Conway EJ, Downey M. An outer metabolic region of the yeast cell. Biochem J 47: 347–355, 1950.[Web of Science][Medline]

9. Coury LA, McGeoch JEM, Guidotti G, Brodsky JL. The yeast Saccharomyces cerevisiae does not sequester chloride but can express a functional mammalian chloride channel. FEMS Microbiol Lett 179: 327–332, 1999.[CrossRef][Web of Science][Medline]

10. Decker BL, Wickner WT. Enolase activates homotypic fusion and protein transport to the vacuole in yeast. J Biol Chem 281: 14523–14528, 2006.[Abstract/Free Full Text]

11. Dordas C, Brown PH. Permeability of boric acid across lipid bilayers and factors affecting it. J Membr Biol 175: 95–105, 2000.[CrossRef][Web of Science][Medline]

12. Dordas C, Chrispeels MJ, Brown PH. Permeability and channel-mediated transport of boric acid across membrane vesicles isolated from squash roots. Plant Physiol 124: 1349–1361, 2000.[Abstract/Free Full Text]

13. Grippo AA, Hamilton B, Hannigan R, Gurley BJ. Metal content of ephedra-containing dietary supplements and select botanicals. Am J Health Syst Pharm 63: 635–644, 2006.[Abstract/Free Full Text]

14. Groves JD, Falson P, LeMaire M, Tanner MJA. Functional cell surface expression of the anion transport domain of human red cell band 3 (AE1) in the yeast Saccharomyces cerevisiae. Proc Natl Acad Sci USA 93: 12245–12250, 1996.[Abstract/Free Full Text]

15. Haugen AC, Kelley R, Collins JB, Tucker CJ, Deng C, Afshari CA, Brown JM, Ideker T, Van Houten B. Integrating phenotypic and expression profiles to map arsenic-response networks. Genome Biol 5: R95, 2004.[CrossRef][Medline]

16. Jennings ML. Proton fluxes associated with erythrocyte membrane anion exchange. J Membr Biol 28: 187–205, 1976.[CrossRef][Web of Science][Medline]

17. Kuroda T, Bihler H, Bashi E, Slayman CL, Rivetta A. Chloride channel function in the yeast TRK-potassium transporters. J Membr Biol 198: 177–192, 2004.[CrossRef][Web of Science][Medline]

18. Kurtz I, Petrasek D, Tatishchev S. Molecular mechanisms of electrogenic sodium bicarbonate cotransport: structural and equilibrium thermodynamic considerations. J Membr Biol 97: 77–90, 2004.

19. Milanick MA, Gunn RB. Proton-sulfate cotransport: external proton activation of sulfate influx into human red blood cells. Am J Physiol Cell Physiol 247: C247–C259, 1984.[Abstract/Free Full Text]

20. Nozawa A, Takano J, Kobayashi M, von Wirén N, Fujiwara T. Roles of BOR1, DUR3, and FPS1 in boron transport and tolerance in Saccharomyces cerevisiae. FEMS Microbiol Lett 262: 216–222, 2006.[Web of Science][Medline]

21. Otero L, Fleites A, Mendez FJ, Palacio V, Vazquez F. Susceptibility of Candida species isolated from female prostitutes with vulvovaginitis to antifungal agents and boric acid. Eur J Clin Microbiol Infect Dis 18: 59–61, 1999.[CrossRef][Web of Science][Medline]

22. Otero L, Palacio V, Mendez FJ, Vazquez F. Boric acid susceptibility testing of non-C. albicans Candida and Saccharomyces cerevisiae: comparison of three methods. Med Mycol 40: 319–322, 2002.[Web of Science][Medline]

23. Park M, Li Q, Shcheynikov N, Zeng W, Muallem S. NaBC1 is a ubiquitous electrogenic Na+-coupled borate transporter essential for cellular boron homeostasis and cell growth and proliferation. Mol Cell 16: 331–341, 2004.[CrossRef][Web of Science][Medline]

24. Parker MD, Ourmozdi EP, Tanner MJA. Human BTR1, a new bicarbonate transporter superfamily member and human AE4 from kidney. Biochem Biophys Res Commun 282: 1103–1109, 2001.[CrossRef][Web of Science][Medline]

25. Pena A, Ramirez J, Rosas R, Calahorra M. Proton pumping and the internal pH of yeast cells, measured by pyranine introduced by electroporation. J Bacteriol 177: 1017–1022, 1995.[Abstract/Free Full Text]

26. Romero MF, Fulton CM, Boron WF. The SLC4 family of HCO3 transporters. Pflügers Arch 447: 495–509, 2004.[CrossRef][Web of Science][Medline]

27. Romero MF, Henry D, Nelson S, Harte PJ, Dillon AK, Sciortino CM. Cloning and characterization of a Na+-driven anion exchanger (NDAE). J Biol Chem 275: 24552–24559, 2000.[Abstract/Free Full Text]

28. Saier MH Jr. Families of proteins forming transmembrane channels. J Membr Biol 175: 165–180, 2000.[CrossRef][Web of Science][Medline]

29. Sherman F. Getting started with yeast. Methods Enzymol 194: 3–21, 1991.[CrossRef][Web of Science][Medline]

30. Takano J, Kobayashi M, Noda Y, Fujiwara T. Saccharomyces cerevisiae Bor1 is a boron exporter and a key determinant of boron tolerance. FEMS Microbiol Lett 267: 230–235, 2007.[Web of Science][Medline]

31. Takano J, Miwa K, Yuan L, von Wirén N, Fujiwara T. Endocytosis and degradation of BOR1, a boron transporter of Arabidopsis thaliana, regulated by boron availability. Proc Natl Acad Sci USA 102: 12276–12281, 2005.[Abstract/Free Full Text]

32. Takano J, Noguchi K, Yasumori M, Kobayashi M, Gajdos Z, Miwa K, Hayashi H, Yoneyama T, Fujiwara T. Arabidopsis boron transporter for xylem loading. Nature 420: 337–340, 2002.[CrossRef][Medline]

33. Tamas MJ, Wysocki R. Mechanisms involved in metalloid transport and tolerance acquisition. Curr Genet 40: 2–12, 2001.[CrossRef][Web of Science][Medline]

34. Vida TA, Emr SD. A new vital stain for visualizing vacuolar membrane dynamics and endocytosis in yeast. J Cell Biol 128: 779–792, 1995.[Abstract/Free Full Text]

35. Wang YX, Kauffman EJ, Duex JE, Weisman LS. Fusion of docked membranes requires the armadillo repeat protein Vac8p. J Biol Chem 276: 35132–35140, 2001.

36. Wieth JO. Bicarbonate exchange through the red cell membrane determined with [14C]bicarbonate. J Physiol 294: 521–539, 1979.[Abstract/Free Full Text]

37. Zhao R, Reithmeier RAF. Expression and characterization of the anion transporter homologue YNL275w in Saccharomyces cerevisiae. Am J Physiol Cell Physiol 281: C33–C45, 2001.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
A. Kaya, H. C. Karakaya, D. E. Fomenko, V. N. Gladyshev, and A. Koc
Identification of a Novel System for Boron Transport: Atr1 Is a Main Boron Exporter in Yeast
Mol. Cell. Biol., July 1, 2009; 29(13): 3665 - 3674.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
S. L. Alper
Molecular physiology and genetics of Na+-independent SLC4 anion exchangers
J. Exp. Biol., June 1, 2009; 212(11): 1672 - 1683.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
F. De Seta, M. Schmidt, B. Vu, M. Essmann, and B. Larsen
Antifungal mechanisms supporting boric acid therapy of Candida vaginitis
J. Antimicrob. Chemother., February 1, 2009; 63(2): 325 - 336.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
M. L. Jennings and J. Cui
Chloride Homeostasis in Saccharomyces cerevisiae: High Affinity Influx, V-ATPase-dependent Sequestration, and Identification of a Candidate Cl- Sensor
J. Gen. Physiol., March 31, 2008; 131(4): 379 - 391.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
R. Reid
Identification of Boron Transporter Genes Likely to be Responsible for Tolerance to Boron Toxicity in Wheat and Barley
Plant Cell Physiol., December 1, 2007; 48(12): 1673 - 1678.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/1/C468    most recent
00286.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jennings, M. L.
Right arrow Articles by Hannigan, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jennings, M. L.
Right arrow Articles by Hannigan, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.