Am J Physiol Cell Physiol Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 293: C401-C410, 2007. First published May 2, 2007; doi:10.1152/ajpcell.00433.2006
0363-6143/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/1/C401    most recent
00433.2006v2
00433.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jain, S.
Right arrow Articles by Kumar, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jain, S.
Right arrow Articles by Kumar, A.

VASCULAR BIOLOGY

HNF-1{alpha} plays an important role in IL-6-induced expression of the human angiotensinogen gene

Sudhir Jain, Yanna Li, Sai Patil, and Ashok Kumar

Department of Pathology, New York Medical College, Valhalla, New York

Submitted 11 August 2006 ; accepted in final form 26 April 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Angiotensinogen (AGT) is the precursor of one of the most important vasoactive hormone angiotensin II and this gene locus is associated with human essential hypertension. AGT is an acute phase protein and its gene expression is regulated by IL-6. Previous studies have identified three potential STAT-3 binding sites (APREs) located between –160 and –280 of the hAGT gene promoter but only APRE-1 (located between –271 and –279) was shown to be a bonafide enhancer for IL-6-induced promoter activity. We show here that APRE-2, located between –236 and –247, is indeed an HNF-1{alpha}-binding site and plays an important role in basal and IL-6 induced promoter activity of this gene. Our chromatin immunoprecipitation (ChIP) assay shows that HNF-1{alpha} binds to this region of the hAGT gene promoter and its recruitment is increased in the presence of IL-6 in Hep3B cells. We also show that the promoter activity of a deletion construct containing only 223 bp of the hAGT gene promoter (that contains only APRE-3) is increased after IL-6 treatment. Our ChIP assay shows that IL-6 treatment recruits STAT-3 to APRE-3 and suggests that this is also an IL6 responsive element. We have previously shown that GR binds to the proximal promoter of the hAGT gene. Since GR physically interacts with STAT-3, we propose that transcription factors GR, STAT-3, and HNF-1{alpha} that bind to the nucleotide sequence located between –160 and –280 of the hAGT gene promoter are responsible for IL-6 induced promoter activity of this gene.

hypertension; inflammation; STAT-3 binding sites; chromatin immunoprecipitation; transcription


HYPERTENSION is a serious risk factor for cardiovascular disease (5, 21, 25). The renin-angiotensin system plays an important role in the regulation of blood pressure and the octapeptide, angiotensin II, is one of the most active vasopressor agents (10, 11). Angiotensin II is obtained from its precursor molecule, angiotensinogen (AGT), which is primarily synthesized in the liver and adipose tissue, and to a lesser extent in the kidney, brain, heart, adrenal, and vascular walls (6, 7). AGT is first converted by renin to produce a decapeptide, angiotensin I, which is then converted to angiotensin II by the removal of a COOH-terminal dipeptide by angiotensin-converting enzyme (ACE). In experimental, as well as clinical studies, administration of renin-angiotensin inhibitors is effective in reducing blood pressure and end organ damage (8).

The plasma concentration of AGT is close to the Michaelis constant of the enzymatic reaction between renin and AGT (15). For this reason, a rise in plasma AGT levels can lead to a parallel increase in the formation of angiotensin-II that may ultimately result in hypertension. Recent studies have suggested a direct correlation between AGT and blood pressure. These studies include the following: 1) a highly significant relationship between plasma concentration of AGT and blood pressure in human subjects (35), 2) higher plasma AGT levels in hypertensive subjects and in offspring of hypertensive parents compared with normotensives (14, 36), 3) elevation of blood pressure in transgenic animals that overexpress AGT gene (23), and 4) reduction of blood pressure in AGT gene knockout mice (32). In addition, Kim et al. (22) have introduced up to four copies of the AGT gene in mice with each copy of the gene resulting in a successive increase in blood pressure. These experiments show that small increases in plasma AGT level can quantitatively influence the fine control of renal vascular resistance and increase blood pressure in a gene dose dependent manner.

AGT is an acute phase protein and its expression is increased in liver due to inflammation (4). Acute phase reactants have been divided into two subclasses based on the activators of their expression (1). Class I acute phase proteins are dependent on the IL-1 and TNF like cytokines, and are activated through NF-{kappa}B pathway. On the other hand, class II acute phase proteins are regulated by IL-6 and glucocorticoids through two distinct pathways: signal transduducers and activators of transcription (STATs) and NF-IL-6 (C/EBPbeta and C/EBP{delta}) (28, 29). After binding IL-6, the IL-6 receptor activates the tyrosine specific Janus kinases JAK1, JAK2, and Tyk-2. This results in tyrosine phosphorylation of STATs followed by their homo- and hetero-dimerization, nuclear translocation, and DNA binding (16). In a separate pathway, IL-6 binding activates Ras, mitogen-activated protein (MAP) kinase, and phosphorylation of the transcription factor C/EBPbeta. In addition, IL-6 treatment increases the expression of C/EBP{delta} that activates the expression of an AP protein through C/EBP binding site (29).

An acute phase response unit, located between –470 and –554, has been identified in the rat AGT gene (3). This region of the promoter contains a composite NF-{kappa}B and C/EBP binding site located between –531 and –557, one full GRE located between –570 and –584 and a half GRE located between –470 and –477. All of these sites are required for maximum acute phase response of this gene. Glucocorticoids play a permissive role in the expression of rat AGT gene during acute phase reaction and mutation of GRE abolishes the induction of gene expression by acute phase reactants.

Although expression of both rat and human AGT genes is increased in response to acute phase reaction, the acute phase response unit observed in the rat gene is absent in the human gene. Sherman and Brasier have shown that expression of the hAGT gene is down-regulated by IL-1 and TNF-{alpha} and thus differs from the rodent gene (31). Sherman and Brasier (31) have shown that IL-6 increases the expression of human AGT gene in liver cells through signal transducers and activators of transcription (STAT) family of transcription factors. Sherman et al. have identified three STAT-3 binding sites (APRE1 located between –269 and –278; APRE2 located between –237 and –246; and APRE3 located between –162 and –171) based on the sequence homology with STAT consensus binding site in the promoter of human AGT gene. These workers have shown that STAT3 primarily mediates IL-6 induced promoter activity of the hAGT gene through APRE1 and suggested that this is the only bona fide IL-6 inducible enhancer (31). Since glucocorticoid receptor binds with STAT-3 and increases IL-6 induced expression of rat {gamma}-fibrinogen gene (38) and we have shown that SNP at –217 affects the binding of GR to the hAGT gene promoter, we were interested in understanding the regulation of hAGT gene expression by IL-6. We show here that APRE-2 (located between –245 and –230) is in fact a HNF-1{alpha} binding site and plays an important role in basal and IL-6 induced promoter activity of the hAGT gene in liver cells. We also show that APRE-3 is a bona fide STAT3 binding site and promoter activity of a deletion construct containing only APRE-3 is induced by IL-6 treatment in human liver cells. Our gel shift and ChIP assays confirm that STAT-3 binds to APRE-1 and APRE-3 of the hAGT gene promoter.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell culture. Human hepatoma cells (Hep3B) were grown as monolayer in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum, 100 U/ml penicillin, and 100 µg/ml streptomycin in an atmosphere of 5% CO2 at 37°C. Hep3B cells were grown to 80% confluence in six well plates for transient transfections. After transfections, cells were washed twice with phosphate-buffered saline, replenished with serum-free medium and then exposed to the IL-6 (10 ng/ml).

Plasmid construction. The reporter construct pHAGT1.3luc, and its deletion constructs pHAGT303luc, pHAGT223luc and pHAGT103luc were synthesized by PCR amplification of human AGT gene using TATGCTAGCGAGGAGTCCCTATCTATAGGAACA, TATGCTAGCACACACCTAGGGAGATGCTCCCGTTTCTGG, TATGCTAGCGCTCACTCTGTTCAGCAGTGAAACTC and TATGCTAGCCAAGTGATGTAACCCTCCTCTCCAG as the respective forward primers and CCGGCTCGAGATACCCTTCTGCTGTAGTAC as the reverse primer. The amplified fragments contained the nucleotide sequence –1206 to +37, –303 to +37, –223 to +37, and –103 to +37, respectively. The forward primer had the NheI restriction site and the reverse primer had HindIII restriction site so that amplified fragments could be subcloned in the pGL3 basic vector that lacks eukaryotic promoter and enhancer sequences (Promega, Madison, WI). The plasmid pHAGT1.3lucmutHNF1, pHAGT303lucmutHNF1, pHAGT223lucmutAPRE3 were obtained by site specific mutagenesis using Stratagene site directed mutagenesis kit (Stratagene, TX). The nucleotide sequence of oligonucleotides used for mutation of the HNF-1{alpha} site was TGCAAACTTCGATAAATGTGCATCTCGA, and for the mutation of APRE3 was ACTAAGACTGCCTGTAATAGGTCCCA (mutated nucleotides are bold and italicized).

Transient transfections. Transfections in Hep3B cell cultures in 6-well plates were carried out using the LipofectAMINE reagent (Polyfect; Qiagen, Valencia, CA) using the manufacturer's protocol. Briefly, 250 ng of reporter constructs and 50 ng of RSV beta-gal was used in each experiment. pCMV-HNF1 and pCMV-STAT3 were cotransfected to increase the expression of HNF-1{alpha} or IL6. 200ng of Pre-designed Silencer RNAs (SiRNA) for HNF-1(TCF1)(catalog no. 16708), STAT3 (catalog no. AM16708), and control SiRNA (catalog no. AM4611) (all purchased from Ambion, Austin, TX) were used for cotransfection in gene silencing studies. After 4 h of transfection, the media was changed to the serum free media and after 24 h of transfection, cells were treated for an additional 24 h with IL-6 (10 ng/ml). In experiments involving measurement of endogenous hAGT expression levels the Hep3B cells were transfected with SiRNAs alone followed by IL-6 treatment as described previously. The whole cell extracts were prepared by extraction of cells with 200 µl of lysis buffer (Promega). An aliquot of the cell extract was used to measure luciferase activity by Turners Design Luminometer TD 20/20 using a luciferase assay system (Promega) as described by the manufacturer. Luciferase activity was normalized with the beta-gal activity. The beta-gal activity was determined as described previously (26).

Western blot analysis. Proteins were fractionated by SDS-PAGE (12.5% polyacrylamide) and transferred to Immobilon-P transfer membranes (Millipore). Membranes were blocked in 10% nonfat dry milk (Bio-Rad Laboratories) and immunoblotted with commercially available monoclonal antibodies for hAGT (catalog no. H00000183-M01, Abnova, Taiwan) and beta-actin (catalog no. sc47778, Santa Cruz Biotechnology, Santa Cruz, CA). Immune complexes were detected by HRP conjugated antimouse IgG (catalog no. I1904-25C, US Biologicals) using SuperSignal West Pico chemiluminisence assay (Pierce Chemical, Rockford, IL) according to the manufacturer protocol. Densitometric analysis of protein bands was performed by Quantity One quantitation software from Bio-Rad.

Gel mobility shift assay. The probes for electrophoretic mobility shift assay (EMSA) were chemically synthesized, annealed and radiolabeled at the 5'-ends by polynucleotide kinase using [{gamma}-32P]ATP. DNA fragments (20,000–50,000 cpm), 1–2 µg of poly(dI-dC), and 5–10 µg of the nuclear extracts were incubated in a solution containing the following: 10 mM HEPES (pH 7.5), 50 mM KCl, 5 mM MgCl2, 0.5 mM EDTA, 1 mM DTT, and 12.5% glycerol in ice for 20 min and separated on a 4.5% polyacrylamide gel in a cold room. After 2–3 h, the gel was dried under vacuum and protein-nucleic acid complexes were identified by autoradiography. For super shift assay, 1 µl of antibody was added to the reaction mixture that was incubated for 20 min and analyzed by EMSA. Radioactive oligonucleotides were purified by Chroma spin columns (BD Biosciences). Nuclear extracts for gel mobility shift assays were prepared by modification of a previously described method (13). Antibodies against STAT-3 and HNF-1{alpha} were purchased from Santa Cruz Biotechnologies.

Oligonucleotides. Double-stranded oligonucleotides containing APRE-2, APRE-2mut, APRE-3, APRE-3mut, consensus HNF-1{alpha}, HNF-1{alpha}mut, STAT-3 consensus, and STAT-3 mut binding sites were obtained by annealing TGCAAACTTCGGTAAATGTGTAACTCGA, TGCAAACTTCGATAAATGTGCATCTCGA ACTAAGACTTCCTGGAAGAGGTCCCA, ACTAAGACTGCCTGTAATAGGTCCCA, CCAGGTTAATGATTAACCCA, CCAGGTTAGTGATGTACCCA, GATCCTTCTGGGAATTCCTAGATC, and GATCCTTCTGGGCCGTCCTAGATC with their respective complementary oligonucleotides.

ChIP assays. The chromatin immunoprecipitation (ChIP) assay was performed using the ChIP assay kit from Upstate Biotechnology (Lake Placid, NY). Cells (3–4 million) were plated in 100 mm plates. After 24 h, cells were treated with IL-6 for 15–20 min in serum free media. They were then fixed with 1% formaldehyde for 30 min, washed with chilled PBS, scrapped and collected in 1.5 ml Eppendorf tube followed by their lysis. The DNA was fragmented by sonication and 10 µl of the chromatin solution was saved as input. A 1 µg amount of anti-STAT-3 or HNF-1{alpha} antibody or rabbit immunoglobulin G was added to the tubes containing 900 µl of chromatin solution, and the mixture was incubated overnight at 4°C. The antibody complexes were captured with protein A-agarose beads and subjected to serial washes (as described in manufacturer's protocol). The chromatin fraction was extracted with SDS buffer and reverse cross-linked at 65°C for 4–6 h. The DNA was then purified using Qiagen miniprep column. The immuno-precipitated DNA (5 µl) and the input DNA (5 µl) were subjected to 35 cycles of PCR amplification using –314AGT For (5'-CTCAGGCTGTCACACACCTA-3') as a forward and –82AGT Rev. (5'-GAGAGGAGGGTTACATCA-3') as a reverse primer when HNF-1{alpha} antibody was used for immunoprecipitation. This amplified 234-bp fragment spanning the HNF-1{alpha} binding site (–314 to –82) of the human AGT gene promoter. In another set of experiments, cultured cells were transiently transfected using phAGT223luc or phAGT303luc, treated in the absence and presence of IL-6 and immunoprecipitated with STAT-3 antibody. Immuno-precipitated DNA was then amplified using CTCAGGCTGTCACACACCTA as a forward primer and oligonucleotide GL2 (CTTTATGTTTTTGGCGTCTTCCA) (Promega Biotec) (corresponding to the luciferase gene) as a reverse primer to amplify APRE-1 region in phAGT303luc transfected cells. Oligonucleotide TATGCTAGGGCTCACTCTGTTCAGCAGTGAAACTC was used as a forward primer and GL2 as the reverse primer for amplification of APRE-3 region in phAGT223luc-transfected cells. Oligonucleotide GAGGTATTTGTGTGTTTGTTGATTGT and ACAGGGCATGACAGAGACCTTGG were used as forward and reverse primers to amplify 320 bp (located between –770 and –1,093) of the upstream region of the promoter.

Statistical analysis. The unpaired t-test was used to compare relative luciferase activities of reporter constructs in transient transfection experiments. All experiments were conducted in triplicate in three independent transfections.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
IL-6 treatment increases the promoter activity of a reporter construct containing 1.2 Kb of the 5' flanking region of hAGT gene promoter and its deletion constructs. To identify the hAGT gene promoter sequence that is responsible for IL-6 induced promoter activity, we synthesized a reporter construct containing 1,206 bp of the hAGT gene promoter (phAGT1.3luc) and used it in transient transfections in Hep3B cells in the absence and presence of IL-6. Results of this experiment (Fig. 1) showed that IL-6 treatment increased the promoter activity of phAGT1.3luc by about 5–6 fold. We then synthesized deletion constructs containing 303, 223, and 103 bp of the hAGT gene promoter and used them in transient transfections. Results of this experiment suggested that IL-6 treatment increased the promoter activity of phAGT303luc by 6–7 fold and of phAGT223luc by 5–6 fold. However, IL-6 treatment did not increase the promoter activity of phAGT103luc. These results suggest that 303 bp of the hAGT gene promoter are responsible for IL-6 induced promoter activity of this gene.


Figure 1
View larger version (16K):
[in this window]
[in a new window]

 
Fig. 1. Identification of interleukin-6 (IL-6) responsive elements in –1,206 bp of the hAGT gene promoter. Hep3B cells were transiently transfected with reporter construct phAGT1.3luc or deletion constructs phAGT303luc, phAGT223luc, phAGT103luc. After 24 h, cells were treated in the absence or presence of 10 ng/ml of IL-6 for 24 h before the luciferase assay. Data are means ± SD of three experiments. *P < 0.05, significance level of IL-6 treated vs. control experiments (Student's t-test). Crossed bars show IL-6-induced activity while striped bars show the basal promoter activity.

 
Nucleotide sequence located between –236 and –247 bp (APRE-2) of the hAGT gene promoter contains an HNF-1{alpha} binding site. Sherman and Brasier (31) have noted that nucleotide sequence located between –237 and –246 of the hAGT gene promoter (APRE-2) also has homology with STAT-3 binding site but this sequence does not bind to STAT-3. A closer examination of this sequence reveals that it also has homology with HNF-1{alpha} binding site (Fig. 2, panel 1). The nucleotide sequence of APRE-2 is highly conserved and a similar sequence is present in the rat and human AGT gene promoters (Fig. 2, panel 2). This conservation of the sequence between promoters of human and rat AGT genes suggests an important role of this sequence in transcriptional regulation of this gene. To demonstrate that transcription factor HNF-1{alpha} binds to APRE2, we performed a gel shift assay using radio-labeled oligonucleotide HNF-1 and APRE2 in the presence of Hep3B nuclear extract. Results of this experiment (Fig. 3) showed that radio-labeled oligonucleotide APRE-2 formed a complex (shown by arrow) (lane 1), which was competed out in the presence of 40- to 80-fold excess of cold APRE-2 [lane 2 (x40), lane 3 (x80)] or 20- to 30-fold excess of cold HNF-1 [lane 4 (x20), lane 5 (x30)]. Cold mutated oligonucleotides APRE-2mut or HNF-1mut do not compete with this complex (lane 6 and lane 7). This band was supershifted in the presence of HNF-1{alpha} antibody (lane 9) but not in the presence of preimmune serum (lane 8). To further confirm that APRE2 binds to HNF-1{alpha} we performed another gel shift assay using radio-labeled HNF-1 consensus oligonucleotide. The result of this experiment showed the appearance of a similar complex as seen with APRE2 (lane 12). This complex was competed out with 40–80 fold excess of APRE-2 [lane 13 (x40), 14 (x60), and 15 (x80)] and self-competed with 30-fold excess of consensus HNF-1 oligonucleotide (lane 18) but not with an 80 fold excess of either of the cold mutated oligonucleotides APRE2mut or HNF-1mut (lane 16 and lane 17). This complex was super shifted in the presence of HNF-1{alpha} antibody (lane 19), but not in the presence of PIS (lane 20). Lane 10 and lane 1, respectively, shows free radiolabeled APRE2 and HNF-1 oligonucleotides (untreated with nuclear extract). Taken together, results of these gel shift experiments suggested the presence of an HNF-1{alpha} binding site between –236 and –247 bp (APRE2) in the hAGT gene promoter.


Figure 2
View larger version (11K):
[in this window]
[in a new window]

 
Fig. 2. Sequence homology between APRE-2 of the hAGT gene and HNF-1{alpha} binding site (panel I), and conservation of HNF-1{alpha} and APRE-3 sites in human and rat AGT genes (panel II).

 

Figure 3
View larger version (32K):
[in this window]
[in a new window]

 
Fig. 3. Nucleotide sequence located between –236 and –247 bp of the hAGT gene promoter (APRE-2) contains an HNF-1{alpha} binding site. EMSA was performed using radiolabeled APRE-2 and an oligonucleotide containing consensus HNF-1{alpha} binding site in the presence of Hep3B nuclear extract. Ab, antibody; PIS, preimmune serum. Lane 1, radiolabeled APRE-2 alone; lane 2 and 3, self competition with 40- and 80-fold excess of cold APRE-2; lanes 4 and 5, competition in the presence of 20- and 30-fold excess of cold HNF-1{alpha} consensus oligonucleotide; lanes 6 and 7, reaction in the presence of mutated APRE-2 and mutated HNF-1 oligonucleotides; lane 8: reaction in the presence of preimmune serum; lane 9, HNF-1{alpha} antibody; lanes 10 and 11: radiolabeled APRE-2 and HNF-1 oligonucleotides without nuclear extract; lane 12: radiolabeled HNF-1{alpha} consensus oligonucleotide in the presence of Hep3B extract; lanes 13–15: competition with 40-, 60-, and 80-fold excess of cold APRE-2 oligonucleotide; lanes 16 and 17: competition in the presence of mutated APRE-2 and mutated HNF-1 oligonucleotides; lane 18: self competition with 30-fold excess of HNF-1 oligonucleotide; lane 19: HNF-1{alpha} antibody; lane 20: reaction in the presence of preimmune serum.

 
Chromatin immunoprecipitation assay shows that HNF-1{alpha} binds to APRE-2 sequence in the hAGT gene promoter and its recruitment is increased after IL-6 treatment. To examine whether HNF-1{alpha} binds to the APRE-2 site in the hAGT gene promoter in an in vivo situation, we performed a chromatin immunoprecipitation (ChIP) in Hep3B cells. The primers were selected so that APRE-2 region of the hAGT gene promoter (located between –314 and –82 bp) could be amplified after immunoprecipitation with HNF-1{alpha} antibody. Results of this experiment (Fig. 4) showed that HNF-1{alpha} binds to the APRE-2 region of the hAGT gene promoter (lane 1). In the next set of experiment, we wanted to examine whether IL-6 treatment increases the recruitment of HNF-1{alpha} to this region of the promoter of the hAGT gene in Hep3B cells. We therefore performed a ChIP assay using IL-6-treated Hep3B cells in the presence of HNF-1{alpha} antibody. Results of this experiment showed that IL-6 treatment indeed increased the recruitment of HNF-1{alpha} to the APRE-2 site that resulted in an increased amount of PCR product (Fig. 4, lane 2). Another PCR (negative control) was performed using primers from the upstream region of the hAGT gene promoter to show that HNF-1{alpha} antibody did not precipitate DNA from this region of the promoter (lanes 3 and 4). A positive control PCR was also performed using DNA from pHAGT1.3luc to show that a correct size amplified product was obtained using these primers (lane 5). An equal amount of input DNA was used from IL-6 treated and untreated Hep3B cells for amplification (input) to show that equal amount of amplification occurred (lanes 6 and 7). Another control was performed to show that no-amplification of DNA occurred when immunoprecipitation of the DNA was performed in the absence of HNF-1{alpha} antibody (lanes 8 and 9). Overall, results of this ChIP assay suggested that liver enriched transcription factor HNF-1{alpha} binds to the APRE-2 site in Hep3B cells and the recruitment of HNF-1{alpha} is increased after IL-6 treatment of the cells.


Figure 4
View larger version (5K):
[in this window]
[in a new window]

 
Fig. 4. Chromatin immunoprecipitation (ChIP) assay shows that HNF-1{alpha} binds to the APRE-2 site of the hAGT gene promoter in Hep3B cells and its recruitment increases on IL-6 treatment. ChIP assay was performed to examine the binding of HNF-1{alpha} to the APRE-2 of the hAGT gene promoter as described in MATERIALS AND METHODS. Immunoprecipitated DNA from untreated and IL-6 treated Hep3B cells was used to amplify nucleotide sequence located between –314 and –82 bp of the hAGT gene promoter. C, control. Lane 1: PCR-amplified product obtained from untreated Hep3B cells; lane 2: PCR-amplified product obtained from IL-6 treated Hep3B cells; lanes 3 and 4: PCR-amplified product using primers from up-stream region of the hAGT gene promoter using untreated and IL-6 treated Hep3B cells; lane 5: PCR-amplified product obtained from Hep3B cell DNA without immunoprecipitation; lanes 6 and 7: PCR-amplified product using equal amount of input DNA from Hep3B cells; lanes 8 and 9: PCR-amplified product obtained from untreated and IL-6-treated Hep3B cells captured by protein A-agarose beads but in the absence of HNF-1{alpha} antibody. ChIP assays were performed in triplicates.

 
Co-transfection of HNF-1{alpha} upregulates the promoter activity of phAGT1.3luc and phAGT303luc. Since our gel shift and ChIP assays suggested the presence of a HNF-1{alpha} binding site located between –236 and –247 bp region of the hAGT gene promoter, we wanted to examine whether HNF-1{alpha} indeed regulates the expression of this gene in human liver cells. For this purpose, we performed transient transfection where either reporter construct phAGT1.3luc or phAGT303luc was co-transfected in the presence and absence of an expression vector containing HNF-1{alpha} coding sequence and promoter activity was analyzed by luciferase assay. Results of this experiment (Fig. 5) showed that co-transfection of HNF-1{alpha} increased the promoter activity of reporter constructs containing either 1,206 or 303 bp of the hAGT gene promoter. We also performed transient transfections using reporter constructs where HNF-1{alpha} binding site was mutated by site specific mutagenesis. Results of this experiment (also shown in Fig. 5) showed that mutation of HNF-1{alpha} site abolished HNF-1 induced promoter activity.


Figure 5
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 5. Cotransfection of HNF-1{alpha} upregulates the promoter activity of phAGT1.3luc and phAGT303luc. Reporter constructs phAGT1.3luc and phAGT1.3luc-mut HNF-1 as well as phAGT303luc and phAGT303lucmutHNF-1 were transfected in the absence and presence of an expression vector containing coding sequence of HNF-1{alpha} in Hep3B cells and promoter activity was analyzed by the luciferase assay. WT, wild type. Data are means ± SD of three experiments done in triplicate. *P < 0.05 denotes significant difference from basal (untreated) promoter activity.

 
Mutation of APRE-2 site in reporter constructs phAGT1.3luc and phAGT303luc downregulates IL-6 induced promoter activity. Since previous experiments showed that APRE-2 site of the hAGT gene promoter binds to HNF-1{alpha} and co-transfection of HNF-1{alpha} upregulated the promoter activity of reporter constructs containing hAGT gene promoter, we wanted to examine whether mutation of APRE-2 affects the IL-6 induced promoter activity of the hAGT gene. We therefore transfected reporter construct phAGT1.3luc either with the wild type APRE-2 or mutated APRE-2 in Hep3B cells and determined promoter activity in the presence or absence of IL-6 and cotransfected pCMVSTAT3. Results of these experiments (Fig. 6) showed that IL-6 treatment increases the promoter activity of the reporter construct containing wild type APRE-2 which was further upregulated by STAT3 cotransfection but mutation of the HNF-1{alpha} binding site significantly reduces IL-6 and STAT3 induced promoter activity. Similar results were obtained when reporter constructs phAGT303luc either with the wild type APRE-2 or mutated APRE-2 was used in transient transfections (data not shown). Taken together results of this experiment confirmed that nucleotide sequence located between –236 and –247 bp of hAGT promoter (APRE-2) is a HNF-1{alpha} binding site and plays a crucial role in IL-6 induced promoter activity of this gene. Mutation of this APRE-2 site drastically reduces IL-6 induced promoter activity of the hAGT gene.


Figure 6
View larger version (10K):
[in this window]
[in a new window]

 
Fig. 6. Mutation of APRE-2 in the reporter constructs phAGT1.3luc downregulates IL-6 induced promoter activity. Reporter constructs phAGT1.3luc and phAGT1.3lucmut HNF-1 were treated in the absence and presence of IL-6 in Hep3B cells as described and promoter activity was analyzed by the luciferase assay. Data are means ± SD of three experiments done in triplicate. *P < 0.05, significant difference from basal (untreated) promoter activity.

 
Nucleotide sequence located between –162 and –171 bp of the hAGT gene promoter contains a STAT-3 binding site. Sherman and Brasier (31) also noted that nucleotide sequence located between –162 and –171 of the hAGT gene promoter has homology with STAT-3 binding site (APRE-3) but is not involved in IL-6 induced promoter activity of this gene. However, our transfection assay had shown that the promoter activity of the reporter construct phAGT223luc (that contains only APRE-3 site) is also increased after IL-6 treatment (Fig. 1). Since nucleotide sequence located between –162 and –171 bp of the hAGT gene promoter (APRE-3) has homology with the STAT-3 binding site, we performed a gel shift assay using radiolabeled oligonucleotide APRE-3 in the presence of Hep3B nuclear extract (with or without IL-6 treatment). Results of this experiment (Fig. 7A) showed that APRE-3 forms a complex in the presence of IL-6 treated Hep3B nuclear extract (lane 4) but not in the presence of untreated Hep3B nuclear extract (lane 3). This complex was competed out with a 20- to 40-fold excess of cold APRE-3 (self competition, lane 5 and 6) and STAT-3 consensus oligonuleotide (lane 7) but not in the presence of either of the mutated cold APRE-3 or STAT-3 oligonucleotide (lane 8 and 9). The intensity of this band was reduced in the presence of STAT-3 antibody (lane 11) but not in the presence of preimmune serum (lane 10). Position of IL-6-specific complex was further confirmed by using radiolabeled STAT3 consensus oligonucleotide in the presence of nuclear extract from IL-6-treated Hep3B cells (lane 12). Lanes 1 and 2, respectively, show free radiolabeled STAT3 and APRE3 oligonucleotides (in the absence of nuclear extract). Taken together, results of this experiment suggested that the nucleotide sequence located between –162 and –171 bp of 5'-flanking region of hAGT gene promoter contains a STAT-3 binding site. Similar results were obtained by Sherman and Brasier (31).


Figure 7
View larger version (35K):
[in this window]
[in a new window]

 
Fig. 7. A: Nucleotide sequence located between –162 and –171 bp of the hAGT gene promoter (APRE-3) contains a STAT-3 binding site. EMSA was performed using radio-labeled APRE-3 in the presence of control and IL-6-treated Hep3B nuclear extract. Lanes 1 and 2: free radiolabeled APRE-3 and STAT-3 oligonucleotides; lane 3: control Hep3B cell extract; lane 4: IL-6 treated Hep3B cell extract in the absence of competitor DNA; lanes 5 and 6: competition in the presence of 20- and 40-fold excess of cold APRE-3; lane 7: competition in the presence of 20-fold excess of a cold oligonucleotide containing consensus STAT-3 binding site; lanes 8 and 9: competition in the presence of mutated APRE-3 and mutated STAT-3 oligonucleotides; lane 10: reaction in the presence of preimmune serum; lane 11: reaction in the presence of STAT-3 antibody; lane 12: reaction of radiolabeled consensus STAT-3 binding site in the presence of nuclear extract from IL6 treated Hep3B cells. B: mutation of APRE-3 in reporter constructs phAGT223luc downregulates IL-6 induced promoter activity. IL-6 treatment increased the promoter activity in phAGT223luc (open bars), which is strongly downregulated in phAGT223mutAPRE3 (striped bars). Data are means ± SD of three experiments done in triplicate. *P < 0.05, significant difference from basal (untreated) promoter activity.

 
Mutation of APRE-3 in reporter constructs phAGT223luc downregulates IL-6 induced promoter activity. To further confirm the role of APRE-3 in IL6 induced promoter activity we mutated APRE-3 in phAGT223luc to generate phAGT223mutAPRE3. These constructs were used for the transfections in Hep3B cells in the presence or absence of IL6. Results of this experiment (Fig. 7B) showed that IL-6 treatment increased the promoter activity in phAGT223luc (empty bars), which is strongly downregulated in phAGT223mutAPRE3 (striped bars). Taken together, results of these experiments suggested that APRE-3 is involved in IL-6 induced promoter activity.

Chromatin immunoprecipitation assay shows that STAT-3 binds to the nucleotide sequence located between –164 and –172 (APRE-3) of the hAGT gene. Since gel shift assay suggested that STAT-3 binds to APRE-3 and reporter construct phAGT223luc was transactivated in the presence of IL-6, we were interested to find whether STAT-3 binds to APRE-3 of the hAGT gene promoter in an in vivo situation. Since APRE-1 and APRE-3 are located close by in the promoter, we performed transient transfection with phAGT223luc (that contains APRE-3 but not APRE-1) in Hep3B cells and performed a ChIP assay using STAT-3 antibody. For amplification of the immunoprecipitated DNA, we used forward primer from the hAGT gene promoter and for reverse primer we used a sequence from the luciferase gene. We argued that since this reporter construct does not contain the APRE-1 sequence, amplification of the immunoprecipitated DNA will occur only from the transfected DNA and will therefore confirm the binding of STAT-3 to APRE-3 in an in vivo situation. As a positive control, we performed similar experiment using reporter construct phAGT303luc which contains APRE-1 as well as APRE-3. Results of this experiment (Fig. 8) showed that IL-6 treatment increased the recruitment of STAT-3 when either phAGT223luc or phAGT303luc are used for transfection (lanes 2 and 4) compared with untreated cells (lanes 1 and 3), although amplification was a little more in lane 4 compared with lane 2. PCR amplification from input DNA suggested that we have used equal amount of DNA for amplification from IL-6 treated or untreated cells (see input lane). No amplification was observed when immunoprecipitated DNA in the absence of STAT-3 antibody was used for amplification (no antibody lane). Taken together, results of these experiments suggested that IL-6 treatment induced STAT-3 which binds to APRE-3 in transfected Hep3B cells.


Figure 8
View larger version (50K):
[in this window]
[in a new window]

 
Fig. 8. ChIP assay shows binding of STAT-3 to APRE-3 on transient transfection of reporter construct phAGT223luc in IL-6 treated Hep3B cells. ChIP assay was performed to examine the binding of STAT-3 to the APRE-3 site of the hAGT gene promoter after transient transfection of reporters constructs phAGT303luc and phAGT223luc in Hep3B cells. Immunoprecipitated DNA in the presence of STAT-3 antibody from untreated and IL-6-treated Hep3B cells was used to amplify nucleotide sequence containing APRE-1 and APRE-3. Lane 1: PCR-amplified product obtained from untreated Hep3B cells after transfection with phAGT223luc; lane 2: PCR-amplified product obtained from IL-6 treated Hep3B cells after transfection with phAGT223luc; lane 3: PCR-amplified product obtained from untreated Hep3B cells after transfection with phAGT303luc; lane 4: PCR-amplified product obtained from IL-6-treated Hep3B cells after transfection with phAGT303luc. Amplification using same amount of input DNA and in the absence of STAT-3 antibody are also shown for each experiment. ChIP assays were performed in triplicates.

 
SiRNAs for HNF-1 and STAT-3 downregulate IL6 induced promoter activity of pHAGT303luc and endogenous AGT protein levels. To further examine the potential role of HNF-1 and STAT-3 in regulation of IL6 induced AGT promoter activity we cotransfected Hep3B cells with their SiRNAs along with pHAGT303luc promoter vector which contains both APRE-2 and APRE-3 binding sites. Results from this experiment (Fig. 9A) suggest that the IL6 induced promoter activity (bar 2) was significantly downregulated by HNF-1 and STAT-3 Si-RNAs (bars 4 and 5). Negative control SiRNA was also used to show the specificity of HNF-1 and STAT3 SiRNA. Their was no effect of control SiRNA on IL6 induced pHAGT303luc activity (bar 3). To study the effect of SiRNAs on IL-6 induced endogenous protein levels of AGT we performed Western blots on cellular extracts prepared from Hep3B cells transfected with either HNF-1 or STAT-3 SiRNAs followed by IL-6 treatment. Figure 9B shows the Western blot using monoclonal hAGT and beta-actin antibodies. Results from this experiment suggest that endogenous AGT protein expression was upregulated by IL-6 treatment (campare lane 1 and lane 2). This induction by IL-6 treatment was significantly reduced by HNF-1 or STAT3 SiRNA (lane 4 and 5). On the other hand control SiRNA did not alter IL-6 induced AGT expression (lane 3). Figure 9C is the histographical representation of Fig. 9B after normalizing hAGT band intensities with beta-actin. Together, these results demonstrate the role of HNF-1 and STAT-3 sites in the regulation of AGT promoter activity and endogenous AGT expression in liver cells (see Fig. 10).


Figure 9
View larger version (10K):
[in this window]
[in a new window]

 
Fig. 9. Effect of HNF-1 Si-RNA and STAT-3 Si-RNA on IL6 induced promoter activity of pHAGT303luc and endogenous AGT protein levels. A: the reporter construct phAGT303 luc was treated in absence or presence of IL-6 in Hep3B cells and promoter activity was analyzed by the luciferase assay as described in materials and method section. B: Western blot analysis of AGT protein from IL-6 treated or untreated Hep3B cells that were cotransfected either with HNF-1 or STAT-3 Si-RNA. C shows the densitometric quantification of AGT expression normalized to beta-actin. Data are means ± SD of three experiments done in triplicate. *P < 0.05, significant difference from the control group.

 

Figure 10
View larger version (9K):
[in this window]
[in a new window]

 
Fig. 10. Transcription factor binding sites in 303 bp promoter region of the hAGT gene that play an important role in IL-6 induced promoter activity.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Recent studies have suggested that AGT gene locus is associated with human essential hypertension (20). The human AGT gene has an A/G polymorphism at –6 in its promoter and it has been shown recently that: 1) molecular variant –6A is associated with hypertension in Caucasian and Japanese populations and 2) reporter constructs containing human AGT gene promoter with nucleoside A at –6 have increased promoter activity on transient transfection in human liver derived HepG2 cells compared with reporter constructs containing nucleoside G at –6 (17). The human AGT gene promoter also contains an A/G polymorphic site at –217. We have recently shown that –217A allele of the AGT gene is associated with hypertension in African-American population (19). We have further shown that an oligonucleotide containing human AGT gene promoter with nucleoside A at –217 binds more strongly to C/EBP family of transcription factors and glucocorticoid receptor (18, 19). In addition, reporter constructs containing human AGT gene promoter with nucleoside A at –217 have increased basal promoter activity on transient transfection in human liver cells. Recent studies have shown that –217A allele is also an independent risk factor for hypertension in Chinese population (37). Since polymorphisms in the promoter region can affect the transcription of hAGT gene that can modulate its protein level, it is important to understand factors involved in transcriptional regulation of this gene.

AGT is an acute phase protein and its expression is increased during inflammation. Sherman and Brasier (31) have shown that IL-6 increases the expression of human AGT gene in liver cells through signal transducers and activators of transcription (STAT) family of transcription factors. Sherman et al. have identified three STAT-3 binding sites (APRE1 located between –269 and –278; APRE2 located between –237 and –246; and APRE3 located between –162 and –171) based on the sequence homology with STAT consensus binding site in the promoter of human AGT gene. These workers have shown that STAT3 primarily mediates IL-6 induced promoter activity of the hAGT gene through APRE1 and suggested that this is the only bona fide IL-6 inducible enhancer (31).

We have shown here that APRE2 site in the hAGT gene promoter is in fact a HNF-1{alpha} binding site and this site plays a crucial role in basal and IL-6 induced expression of the hAGT gene. Although there is only ~35% sequence homology between rat and human AGT gene promoters, the HNF-1{alpha} site is highly conserved (Fig. 2). This conservation of sequence suggests an important role of this site in transcriptional regulation of the AGT gene during evolution. Our ChIP assay shows that HNF-1{alpha} binds to the APRE2 of the hAGT gene promoter. Previous studies have suggested that HNF-1{alpha} binding sites are present in more than 100 liver-specific genes and HNF-1 family of proteins plays an important role in the expression of liver specific genes (12, 27, 33). It has been shown that a highly efficient liver specific promoter can be obtained with only a TATA box and an HNF-1 site (2, 12). HNF-1{alpha} is a homeo-domain protein that binds to DNA either as a homodimer or as a heterodimer with HNF-1beta (9). Whereas HNF-1{alpha} contains DNA binding domain and an activation domain, HNF-1beta contains the DNA binding domain but lacks the activation domain (12, 34). Therefore, the amount of HNF-1{alpha} and HNF-1beta in a particular cell regulate HNF-1-dependent expression of a gene.

Our ChIP assay also shows that recruitment of HNF-1{alpha} to the APRE2 site in the hAGT gene promoter is increased after IL-6 treatment. Recent studies have shown that STAT-3 can physically interact with HNF-1{alpha} and this interaction may be responsible for the formation of initiation complex (24). Since STAT-3 also physically interacts with CBP (30), interaction of STAT-3, HNF-1{alpha}, and CBP may be responsible for IL-6 induced expression of liver specific genes in general and hAGT gene in particular.

Our transient transfections have suggested that a reporter construct containing only 223 bp of the 5'-flanking region of the hAGT gene (which contains the APRE3 site) is transactivated by IL-6 treatment. In addition, our ChIP assay in transient transfected cells using reporter construct containing 223 bp of the promoter showed that STAT-3 binds to the APRE3 site. This observation is in contrast with the observation of Sherman et al. who showed that a deletion construct containing 203 bp of the promoter (which contains the APRE3 site) was not transactivated by IL-6. On the basis of these experiments, these authors suggested that APRE3 probably is not a bonafide IL-6 responsive element. One possibility to explain this controversy may be that our reporter construct contains a GRE located at –220 position whereas reporter construct used by Sherman et al. does not contain this GRE. It is possible that binding of GR to this site stabilizes the binding of STAT-3 to the APRE-3 in the hAGT gene promoter. It is also important to note that APRE-3 site is conserved between rat and human AGT genes suggesting an important role of this site in transcriptional regulation during evolution.

Taken together, our data show that IL-6 induces the expression of hAGT gene through two APREs and a HNF-1{alpha} binding site. Since a GRE is also located at –210 in the hAGT gene promoter (18), we propose that transcription factors GR, STAT-3 and HNF-1{alpha} that bind to the nucleotide sequence located between –160 and –280 of the hAGT gene promoter are responsible for IL-6 induced promoter activity of this gene.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Heart, Lung, and Blood Institute Research Grants HL-49884 and HL-59547 and a grant from Philip-Morris Incorporated (to A. Kumar).


    FOOTNOTES
 

Address for reprint requests and other correspondence: S. Jain, Rm. 455, Basic Science Bldg., Pathology Dept., New York Medical College, Valhalla, NY 10595 (e-mail: sudhir_jain{at}nymc.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Akira S, Nishio Y, Tanaka T, Inoue M, Matsusaka T, Wang XJ, Wei S, Yoshida N, Kishimoto T. Transcription factors NF-IL6 and APRF involved in gp130-mediated signaling pathway. Ann NY Acad Sci 762: 15–27, 1995.[Medline]

2. Baumhueter S, Courtois G, Morgan JG, Crabtree GR. The role of HNF-1 in liver-specific gene expression. Ann NY Acad Sci 557: 272–278, 1989.[ISI][Medline]

3. Brasier AR, Han Y, Sherman CT. Transcriptional regulation of angiotensinogen gene expression. Vitam Horm 57: 217–247, 1999.[ISI][Medline]

4. Brasier AR, Li J. Mechanisms for inducible control of angiotensinogen gene transcription. Hypertension 27: 465–475, 1996.[Abstract/Free Full Text]

5. Burt VL, Whelton P, Roccella EJ, Brown C, Cutler JA, Higgins M, Horan MJ, Labarthe D. Prevalence of hypertension in the US adult population. Results from the Third National Health and Nutrition Examination Survey, 1988–1991. Hypertension 25: 305–313, 1995.[Abstract/Free Full Text]

6. Campbell DJ, Habener JF. Angiotensinogen gene is expressed and differentially regulated in multiple tissues of the rat. J Clin Invest 78: 31–39, 1986.[ISI][Medline]

7. Campbell DJ, Habener JF. Cellular localization of angiotensinogen gene expression in brown adipose tissue and mesentery: quantification of messenger ribonucleic acid abundance using hybridization in situ. Endocrinology 121: 1616–1626, 1987.[Abstract]

8. Carson P, Giles T, Higginbotham M, Hollenberg N, Kannel W, Siragy HM. Angiotensin receptor blockers: evidence for preserving target organs. Clin Cardiol 24: 183–190, 2001.[ISI][Medline]

9. Cereghini S. Liver-enriched transcription factors and hepatocyte differentiation. FASEB J 10: 267–282, 1996.[Abstract]

10. Corvol P, Jeunemaitre X. Molecular genetics of human hypertension: role of angiotensinogen. Endocr Rev 18: 662–677, 1997.[Abstract/Free Full Text]

11. Corvol P, Jeunemaitre X, Charru A, Kotelevtsev Y, Soubrier F. Role of the renin-angiotensin system in blood pressure regulation and in human hypertension: new insights from molecular genetics. Recent Prog Horm Res 50: 287–308, 1995.[ISI][Medline]

12. Courtois G, Baumhueter S, Crabtree GR. Purified hepatocyte nuclear factor 1 interacts with a family of hepatocyte-specific promoters. Proc Natl Acad Sci USA 85: 7937–7941, 1988.[Abstract/Free Full Text]

13. Dignam JD, Lebovitz RM, Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 1475–1489, 1983.[Abstract/Free Full Text]

14. Fasola AF, Martz BL, Helmer OM. Renin activity during supine exercise in normotensives and hypertensives. J Appl Physiol 21: 1709–1712, 1966.[Free Full Text]

15. Gould AB, Green D. Kinetics of the human renin and human substrate reaction. Cardiovasc Res 5: 86–89, 1971.[Abstract/Free Full Text]

16. Ihle JN, Stravapodis D, Parganas E, Thierfelder W, Feng J, Wang D, Teglund S. The roles of Jaks and Stats in cytokine signaling. Cancer J Sci Am 4, Suppl 1: S84–S91, 1998.[Medline]

17. Inoue I, Nakajima T, Williams CS, Quackenbush J, Puryear R, Powers M, Cheng T, Ludwig EH, Sharma AM, Hata A, Jeunemaitre X, Lalouel JM. A nucleotide substitution in the promoter of human angiotensinogen is associated with essential hypertension and affects basal transcription in vitro. J Clin Invest 99: 1786–1797, 1997.[ISI][Medline]

18. Jain S, Li Y, Patil S, Kumar A. A single-nucleotide polymorphism in human angiotensinogen gene is associated with essential hypertension and affects glucocorticoid induced promoter activity. J Mol Med 83: 121–131, 2005.[CrossRef][ISI][Medline]

19. Jain S, Tang X, Narayanan CS, Agarwal Y, Peterson SM, Brown CD, Ott J, Kumar A. Angiotensinogen gene polymorphism at –217 affects basal promoter activity and is associated with hypertension in African-Americans. J Biol Chem 277: 36889–36896, 2002.[Abstract/Free Full Text]

20. Jeunemaitre X, Soubrier F, Kotelevtsev YV, Lifton RP, Williams CS, Charru A, Hunt SC, Hopkins PN, Williams RR, Lalouel JM, et al. Molecular basis of human hypertension: role of angiotensinogen. Cell 71: 169–180, 1992.[CrossRef][ISI][Medline]

21. Kannel WB. Elevated systolic blood pressure as a cardiovascular risk factor. Am J Cardiol 85: 251–255, 2000.[CrossRef][ISI][Medline]

22. Kim HS, Krege JH, Kluckman KD, Hagaman JR, Hodgin JB, Best CF, Jennette JC, Coffman TM, Maeda N, Smithies O. Genetic control of blood pressure and the angiotensinogen locus. Proc Natl Acad Sci USA 92: 2735–2739, 1995.[Abstract/Free Full Text]

23. Kimura S, Mullins JJ, Bunnemann B, Metzger R, Hilgenfeldt U, Zimmermann F, Jacob H, Fuxe K, Ganten D, Kaling M. High blood pressure in transgenic mice carrying the rat angiotensinogen gene. EMBO J 11: 821–827, 1992.[ISI][Medline]

24. Leu JI, Crissey MA, Leu JP, Ciliberto G, Taub R. Interleukin-6-induced STAT3 and AP-1 amplify hepatocyte nuclear factor 1-mediated transactivation of hepatic genes, an adaptive response to liver injury. Mol Cell Biol 21: 414–424, 2001.[Abstract/Free Full Text]

25. Mosterd A, D'Agostino RB, Silbershatz H, Sytkowski PA, Kannel WB, Grobbee DE, Levy D. Trends in the prevalence of hypertension, antihypertensive therapy, and left ventricular hypertrophy from 1950 to 1989. N Engl J Med 340: 1221–1227, 1999.[Abstract/Free Full Text]

26. Narayanan CS, Cui Y, Kumar A. DBP binds to the proximal promoter and regulates liver-specific expression of the human angiotensinogen gene. Biochem Biophys Res Commun 251: 388–393, 1998.[CrossRef][ISI][Medline]

27. Odom DT, Zizlsperger N, Gordon DB, Bell GW, Rinaldi NJ, Murray HL, Volkert TL, Schreiber J, Rolfe PA, Gifford DK, Fraenkel E, Bell GI, Young RA. Control of pancreas and liver gene expression by HNF transcription factors. Science 303: 1378–1381, 2004.[Abstract/Free Full Text]

28. Poli V. The role of C/EBP isoforms in the control of inflammatory and native immunity functions. J Biol Chem 273: 29279–29282, 1998.[Free Full Text]

29. Poli V, Mancini FP, Cortese R. IL-6DBP, a nuclear protein involved in interleukin-6 signal transduction, defines a new family of leucine zipper proteins related to C/EBP. Cell 63: 643–653, 1990.[CrossRef][ISI][Medline]

30. Ray S, Sherman CT, Lu M, Brasier AR. Angiotensinogen gene expression is dependent on signal transducer and activator of transcription 3-mediated p300/cAMP response element binding protein-binding protein coactivator recruitment and histone acetyltransferase activity. Mol Endocrinol 16: 824–836, 2002.[Abstract/Free Full Text]

31. Sherman CT, Brasier AR. Role of signal transducers and activators of transcription 1 and –3 in inducible regulation of the human angiotensinogen gene by interleukin-6. Mol Endocrinol 15: 441–457, 2001.[Abstract/Free Full Text]

32. Tanimoto K, Sugiyama F, Goto Y, Ishida J, Takimoto E, Yagami K, Fukamizu A, Murakami K. Angiotensinogen-deficient mice with hypotension. J Biol Chem 269: 31334–31337, 1994.[Abstract/Free Full Text]

33. Tronche F, Ringeisen F, Blumenfeld M, Yaniv M, Pontoglio M. Analysis of the distribution of binding sites for a tissue- specific transcription factor in the vertebrate genome. J Mol Biol 266: 231–245, 1997.[CrossRef][ISI][Medline]

34. Tronche F, Yaniv M. HNF1, a homeoprotein member of the hepatic transcription regulatory network. Bioessays 14: 579–587, 1992.[CrossRef][ISI][Medline]

35. Walker WG, Whelton PK, Saito H, Russell RP, Hermann J. Relation between blood pressure and renin, renin substrate, angiotensin II, aldosterone and urinary sodium and potassium in 574 ambulatory subjects. Hypertension 1: 287–291, 1979.[Abstract/Free Full Text]

36. Watt GC, Harrap SB, Foy CJ, Holton DW, Edwards HV, Davidson HR, Connor JM, Lever AF, Fraser R. Abnormalities of glucocorticoid metabolism and the renin-angiotensin system: a four-corners approach to the identification of genetic determinants of blood pressure. J Hypertens 10: 473–482, 1992.[ISI][Medline]

37. Wu SJ, Chiang FT, Chen WJ, Liu PH, Hsu KL, Hwang JJ, Lai LP, Lin JL, Tseng CD, Tseng YZ. Three single-nucleotide polymorphisms of the angiotensinogen gene and susceptibility to hypertension: single locus genotype vs. haplotype analysis. Physiol Genomics 17: 79–86, 2004.[Abstract/Free Full Text]

38. Zhang Z, Jones S, Hagood JS, Fuentes NL, Fuller GM. STAT3 acts as a co-activator of glucocorticoid receptor signaling. J Biol Chem 272: 30607–30610, 1997.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
R. Satou, R. A. Gonzalez-Villalobos, K. Miyata, N. Ohashi, A. Katsurada, L. G. Navar, and H. Kobori
Costimulation with angiotensin II and interleukin 6 augments angiotensinogen expression in cultured human renal proximal tubular cells
Am J Physiol Renal Physiol, July 1, 2008; 295(1): F283 - F289.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/1/C401    most recent
00433.2006v2
00433.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jain, S.
Right arrow Articles by Kumar, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jain, S.
Right arrow Articles by Kumar, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.