|
|
||||||||
MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS
1Department of Biological Sciences, Graduate School of Science, Osaka University, Toyonaka, Osaka; and 2Department of Biotechnology, Faculty of Engineering, Okayama University, Okayama, Japan
Submitted 30 August 2006 ; accepted in final form 24 March 2007
| ABSTRACT |
|---|
|
|
|---|
membrane protein; transporter; antiporter; quality control; degradation
NHEs are composed of two major domains, the amino-terminal transmembrane (
500 amino acids) domain and the hydrophilic carboxy-terminal domain (
300 amino acids). The transmembrane domain is involved in the antiport of Na+/K+ and H+. The hydrophilic domain is believed to regulate ion transport and associate with cytoskeletal components (11, 41). These regulatory functions are mediated by multiple factors, including phosphorylation and protein-protein interactions (46, 47).
Calcineurin homologous protein-1 (CHP1), a Ca+-binding 22-kDa protein similar to a regulatory subunit of calcineurin, binds to the juxtamembrane region in the hydrophilic domain of NHE15 (5, 19, 34). A closely related isoform, CHP2 (77% similarity), is expressed in a limited range of tissues and cells, including the small and large intestines and some cancer cell lines (15, 35), and is also capable of interacting with NHE15. CHP1 is ubiquitously expressed and interacts with several proteins aside from NHE15, such as the kinesin motor KIF1B (22, 24), protein kinase DRAK2 (18, 21), protein phosphatase calcineurin (20), and glyceraldehyde-3-phosphate dehydrogenase (1). Therefore, CHP1 is thought to be a multipotent regulatory protein. However, NHEs are important partners for CHP1 in cellular functions, because NHEs maintain intracellular ion environments, which affect virtually all biochemical reactions.
Although several groups report interactions between CHP1 and NHE1 (19, 34), the functional relationship between these proteins is controversial. Lin and Barber (19) reported that overexpression of CHP1 in CCL39 cells caused inhibition of NHE1 activation induced by serum or small G proteins. Pang et al. (34) demonstrated that PS120 cells expressing NHE1 incapable of interacting with CHP1 exhibited extensive loss of NHE1 activities. They also showed that injection of an excessive amount of peptides corresponding to the CHP-binding region in NHE1 inhibits NHE1 activities in Xenopus oocytes. Therefore, they concluded that CHP1 is an essential cofactor for the exchange activity of NHE1.
Because previous results were based largely on CHP1 overexpression and dominant-negative approaches, we took a loss-of-function approach to assess the function of CHP1 in relationship to NHE1. Here we establish CHP1-deficient cells by gene targeting in chicken B lymphoma DT40 cells (3, 48). We show that in CHP1-deficient cells, the cellular Na+/H+ exchange activities were totally lost because of significant loss of NHE1 protein, which is potentially destabilized in the absence of CHP1. These observations suggest a novel activity of CHP1 relevant to NHE1.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Vector construction and gene targeting. The chicken CHP1 fragment was amplified from a DT40 cDNA library with PCR using primers containing flanking EcoRI sites (cggaattcATGGGTTCCCGAGCGTCTAC and cggaattcTCAGTGAAGAAATCGAATGC) and cloned into pBluesciptII KS(+) vector. A CHP1 expression vector (pApuro II-CHP1) was constructed by introducing the cloned CHP1 fragment into the EcoRI site downstream of the actin promoter in the pApuro II vector (42). A chicken CHP1 genomic clone was isolated from a DT40 genomic library using the entire CHP1 cDNA as a probe. The isolated genomic clone contained exons 13. To construct the targeting vector, a 4.75-kbp fragment containing exon 3 was excised with HindIII and NotI and cloned into pBluescriptII KS(+) vector. Then, histidinol or blasticidin resistance cassette was inserted into the BamHI site in exon 3. Thirty micrograms of NotI-linearized targeting vector were introduced into 107 DT40 cells in 0.5 ml of ice-cold PBS in a 0.4-cm cuvette by electroporation at 550 V, 250 µF, using the Gene Pulser (Bio-Rad, Hercules, CA). After 10 min on ice, cells were suspended in 20 ml of growth medium and incubated for 24 h. Cells were then suspended in 40 ml of medium containing either 1 mg/ml histidinol or 50 mg/ml blasticidin and dispensed to each well of 96-well culture plates. After 710 days, drug-resistant colonies were obtained. The drug-resistant cells were cultured, and gene targeting was confirmed by Southern blotting using the 0.55-kbp probe corresponding to a HindIII fragment between exon 2 and exon 3. Southern blotting and other gene manipulations were performed according to published protocols (25, 39).
Vector construction of mutant CHP1. CHP1 expression vectors containing mutant EF-hand motifs (E134A, E175A) were generated by site-specific mutagenesis using PCR with overlapped primers and pApuro II-CHP1 as the template (39). Overlapping primers containing Glu-to-Ala substitutions were as follows: TAACACCTGAAGAAGCgCATCCCTGGAAATCTT and AAGATTTCCAGGGATGcGCTTCTTCAGGTGTTA for E134A, and TCCAAAACCTTTACAAACgCTGCAAAGGAGATGGCA and TGCCATCTCCTTTGCAGcGTTTGTAAAGGTTTTGGA for E175A.
The E134A/E175A mutant was generated by repeated mutagenesis using the above primers. The myristoylation-defective G2A mutant was generated by one-step PCR using primers containing a Gly-to-Ala substitution (GGGGTACCCCTCAGTGAAGAAATCGAAT and GGAATTCCATGGCTTCCCGAGCGTCTACGCT). All PCR-amplified fragments were introduced into pApuro II vector, and the entire sequence was verified using an automated DNA sequencer ABI3100 (Applied Biosystems, Foster City, CA).
Analysis of NHE1 mRNA.
Total RNA was isolated from 107 DT40 cells with the Sepasol RNA isolation solution (Nacalai Tesque, Kyoto, Japan), following the manufacturer's instruction. RT and PCR were performed with an RNA PCR kit (AMV), version 3.0 (Takara, Otsu, Japan). The primers were GTGCTGTGTTCCCATCTATCG and TGGACAATGGAGGGTCCGGATT for
-actin, and TCTGCGGTCACTACGGGCACC and CTCCTTGGGCCTCATCACCAACC for NHE1. PCR was performed from serially diluted templates, and it was confirmed that the amplification was dose dependent and nonsaturated. Quantitative real-time PCR was performed using the 7300 Real Time PCR system (Applied Biosystems) and SYBR Premix Ex Taq (Takara) according to the manufacturer's instructions. The primers were GAGAAATTGTGCGTGACATCA and CCTGAACCTCTCATTGCCA for the
-actin gene (product size, 152 bp), and TGTCCAAGGACAAGGAGGATGAGA and TAGGCGTTCTGCAACTGGAGTTCT for the NHE1 gene (product size, 184 bp). Quantification with a standard curve was performed using the software provided with the real-time PCR system. The data were normalized with respect to the expression of
-actin. Specific amplification was confirmed by referring to the dissociation curve and by performing electrophoresis.
Immunoblotting and surface labeling.
DT40 cells were washed with PBS, pelleted by centrifugation, and lysed in PBS containing 1% NP-40, 1% Triton X and 1 µg/ml aprotinin, 1 µg/ml pepstatin A, and 1 µg/ml leupeptin. Cells were disrupted by sonication in an ice-cold bath and mixed with SDS-PAGE sample buffer. To avoid NHE1 aggregation, boiling or heat treatment was not performed. Samples were resolved by SDS-PAGE and transferred to Immobilon-P transfer membrane (Millipore, Billerica, MA) at 180 mA for 90 min in transfer buffer (32 mM glycine, 124 mM Tris, 0.01% SDS, and 20% methanol) with a wet tank blotting apparatus. The blotted membrane was incubated in PBS containing 0.01% Tween 20 and 10% skim milk for 30 min and washed twice with PBST (PBS containing 0.01% Tween 20). The immunoreaction was performed with Can Get Signal solution (Toyobo, Osaka, Japan), following the manufacturer's instructions. Signals were detected with chemiluminescence using enhanced chemiluminescence (ECL; GE Healthcare, Chalfont St. Giles, UK), and images were acquired with Hyperfim ECL (GE Healthcare) or a cooled charge-coupled device (CCD) imaging system (LAS-1000; Fuji Film, Ashigara, Japan). For surface labeling experiments, DT40 cells (107 cells) were washed with PBS() (137 mM NaCl, 10 mM phosphate, 2.7 mM KCl, pH 7.4) and incubated with 2 mg/ml EZ-Link NHS-SS-biotin (Pierce Biotechnology, Rockford, IL) in 1.5 ml of PBS() at 4°C for 1 h. The cells were pelleted and suspended in 0.1 M glycine-PBS(), washed with PBS(), and lysed in PBS containing 1% NP-40, 1% Triton X and 1 µg/ml aprotinin, 1 µg/ml pepstatin A, and 1 µg/ml leupeptin. Debris was removed by centrifugation at 20,000 g for 10 min. The lysate was incubated with NeutrAvidin beads (immobilized NeutrAvidin on agarose, Pierce) for 30 min. Beads were washed twice with PBS(), and proteins were eluted in buffer with 50 mM DTT. NHE1 antibodies were purchased from Becton Dickinson and Chemicon. Antibodies for CHP1 and CHP2 were generated as described previously (15, 21). Antibodies for Na+/K+ ATPase
-1 and actin were purchased from Upstate (Billerica, MA) and Chemicon (Temecula, CA), respectively.
Na+ uptake assay. Ethylisopropyl-amiloride (EIPA)-sensitive 22Na+ uptake experiments were performed using the silicon layer method (44). DT40 cells (107) were washed with isotonic choline chloride solution (125 mM choline chloride, 1 mM MgCl2, 2 mM CaCl2, 5 mM glucose, 20 mM HEPES-Tris, pH 7.4). The cells were spun down, and the buffer was discarded; then cells were incubated for 1 h in isotonic NH4Cl solution (50 mM NH4Cl, 70 mM choline chloride, 5 mM KCl, 1 mM MgCl2, 2 mM CaCl2, 5 mM glucose, 20 mM HEPES-Tris, pH 7.4). Cells were washed with isotonic choline chloride solution and suspended at 107 cells/ml. The cell suspension (350 µl) was mixed with 350 µl of Na+ uptake solution [115 mM choline chloride, 10 mM 22NaCl (74 kBq/ml), 1 mM MgCl2, 2 mM CaCl2, 5 mM glucose, 2 mM ouabain, 20 mM HEPES-Tris, pH 7.4] with or without 0.02 mM EIPA. While Na+ uptake was performed, the cell suspension was transferred to the top of a silicon layer, which was layered on 3 M KOH. After incubation for the indicated time, cells were spun into the 3 M KOH layer by centrifugation at 10,000 g for 1 min, and the reaction was stopped. Cells were lysed in 3 M KOH for 2 h, the KOH solution was neutralized with HCl, and 22Na+ radioactivity was counted. Experiments were performed in triplicate.
Overexpression of NHE1. The FLAG-tagged NHE1 expression plasmid was constructed by introducing an EcoRI-SphI fragment containing rat NHE1 and a SphI-SalI fragment coding for FLAG tag and a stop codon into the pApuro II vector. The expression vector was introduced into wildtype or CHP1-deficient DT40 cells by electroporation as described above. After 710 days, drug-resistant colonies were obtained. The drug-resistant cells were cultured, and expression of NHE1 was studied by immunoblot analysis.
Proteasome inhibition and immunoprecipitation. FLAG-tagged NHE1-expressing cells (CHP+/+ and CHP/) and wildtype cells (5 ml of 0.15 x 106 cells/ml culture) were grown overnight and incubated for 3 h with or without 25 µM MG132 (Sigma-Aldrich) before lysis. The lysate was prepared as described above and then incubated with FLAG-M2 agarose beads (Sigma-Aldrich) for 30 min at 4°C. The beads were washed three times with PBS() and mixed with SDS-PAGE sample buffer. To avoid aggregation of NHE1, heat denaturation was not performed. The samples containing beads were applied to the wells of an SDS-PAGE gel. For detection of ubiquitinated proteins, polyclonal anti-ubiquitin antibody (Sigma-Aldrich and Stressgen) was used.
Knockdown of CHP1 in HeLa cells. Knockdown experiments were performed with Stealth siRNA (Invitrogen). siRNA and control RNA were designed by using the manufacturer's software (Invitrogen). The sense sequences of siRNA and control RNA were GGAUUCAUGCGAACUUUGGCUCAUU and GGAUACGCGCAAUUUCGGCUUUAUU, respectively. The cells ( 2x105 cells) were plated in 2 ml of medium and transfected with RNA duplex (250 pM) in the presence of Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. After 48 h, cells were lysed and subjected to immunoblot analysis.
| RESULTS |
|---|
|
|
|---|
|
|
Na+/H+ exchange activities in CHP-deficient DT40 cells. Previous studies showed that NHE1 is a major isoform in blood cells (37, 38). We determined the IC50 of the NHE1-selective inhibitor EIPA for DT40 NHE as 3.2 x 108 M (data not shown). This pharmacological property was consistent with NHE1 (30) rather than other NHEs. The major physiological role of NHE1 is to protect against intracellular acidification by extrusion of H+ in exchange for Na+ (7). To assess the effect of CHP1 on NHE1 exchange activity, we used the NHE1-selective inhibitor EIPA and analyzed EIPA-sensitive 22Na+ uptake at an acidic intracellular pH (45). Intracellular acidification was induced by incubation in NH4Cl-containing buffer and subsequent removal of NH4Cl. Na+ uptake was measured in the presence or absence of EIPA (Fig. 3A), and then EIPA-sensitive activity was calculated (Fig. 3B). Na+ uptake in the presence of EIPA, which was from non-NHE1 activity, did not show significant differences among wildtype, CHP1-deficient, and rescued cells (Fig. 3A). In wildtype cells, 3.9 ± 0.3 nmol·mg1·min1 EIPA-sensitive Na+ uptake was observed (Fig. 3B; WT), and an extensive decrease in EIPA-sensitive Na+ uptake (0.6 ± 0.5 nmol·mg1·min1) was observed for CHP1-deficient cells (Fig. 3B; /). In the rescued cell lines, Na+ uptake was recovered to 3.7 ± 0.2 nmol·mg1·min1 [Fig. 3B; (/)/+]. These results strongly suggest that CHP1 plays an important role in cellular Na+/H+ exchange activity mediated by NHE1.
|
-actin showed no significant difference between the wildtype and CHP1-deficient cells.
|
110 kDa, highly glycosylated form) and small (60
80 kDa, core-glycosylated form) forms of NHE1 protein were detected, similar to that observed in mammalian cells, as described previously (Fig. 5A) (8). Surprisingly, a significant decrease (to
8%) in NHE1 protein levels was observed in CHP1-deficient cells (Fig. 5C; /). In the CHP1-rescued cells, NHE1 protein levels recovered to 66% of that of wildtype cells (Fig. 5C). The expression level of NHE1 in rescued cells was not proportional to CHP1 expression levels. We also examined expression of NHE1 at the plasma membrane using a surface biotin labeling method (Fig. 5, B and D). Surface-expressed NHE1 tends to show a somewhat broad band in immunoblotting, possibly because of glycosylation. Levels of surface-expressed NHE1 in CHP1-deficient cells also exhibited a significant decrease (Fig. 5D). Moreover, recovery in the rescued cells was observed [Fig. 5, C and D; (/)/+]. These results suggest that CHP1 is required for NHE1 protein stabilization during the early biogenesis steps of NHE1 and for its resulting translocation to the plasma membrane.
|
|
We also tested the effect of proteasomal inhibitor degradation of endogenous NHE1. Short treatment as described above did not affect endogenous NHE1 (data not shown). Thus we treated the cells for 15 h. Although no effects were observed in wildtype cells, 15 h of treatment with MG132 or with another proteasomal inhibitor, MG101, resulted in an increase in the high molecular mass form of NHE1 protein in CHP 1-deficient cells (Fig. 6C; H) Very high molecular mass smears, as observed in cells overexpressing NHE1, were not observed. The restoration of high molecular mass NHE1 in inhibitor-treated CHP-deficient cells suggested that the high molecular mass NHE1 protein is the putative substrate for degradation in CHP1-deficient cells. The total amount of NHE1 protein (H+L) in the inhibitor-treated cells was not increased significantly by proteosomal inhibitor treatment. Other degradation pathways or mechanisms that attenuate NHE1 synthesis may also be involved in the loss of NHE1.
Effect of Ca2+ binding and myristoylation of CHP1 on NHE1. Rescue of CHP1 in CHP1-deficient cells caused recovery of NHE1 protein (Fig. 5). Previous studies revealed that CHP1 has a myristoylation site and two Ca2+-binding sites (33, 43). We constructed mutant forms of CHP1 lacking either the myristoylation site or calcium-binding capability. To construct the myristoylation-deficient mutant, a glycine residue known to be myristoylated was substituted by alanine (G2A construct). To construct calcium binding-deficient CHP1, glutamate residues E134 and E175, which are essential for calcium binding in EF-hand motifs, were substituted by alanine residues at one (E134A and E175A constructs) or both (E134/175A construct) sites. Expression vectors harboring the puromycin resistance gene together with wildtype CHP1 or CHP1 with the amino acid substitutions were introduced into CHP1-deficient cells, and, after isolating puromycin-resistant clones, NHE1 expression was analyzed. In SDS-PAGE with non-heat-denatured samples, wildtype CHP1 migrated slightly faster than the calculated molecular mass (22 kDa), as reported previously (34). However, calcium binding-deficient mutants (E134A, E175A, and E134/175A) migrated slowly compared with wildtype CHP1 (Fig. 7A), confirming that the mutations were present in CHP1. Because of random integration into the chromosome of transfected cells, CHP1 expression levels varied. However, partial recovery of NHE1 expression was observed in all mutant CHP1-expressing cells (Fig. 7A), suggesting that proper expression of NHE1 protein does not necessarily require calcium-binding activity or myristoylation of CHP1.
|
Effect of CHP1 knockdown on NHE1 in HeLa cells.
To test whether the decrease of NHE1 in the absence of CHP1 was a specific event in DT40 cells, we performed knockdown experiments in human HeLa cells by transfecting them with CHP1 siRNA. CHP1 protein was decreased typically to
10% of the normal level after 48-h posttransfection (Fig. 8A). The cells transfected with siRNA showed a decrease (
25%) in the level of NHE1 protein (Fig. 8, A and B). The decrease in NHE1 was moderate compared with the decrease in CHP1-deficient DT40 cells. Residual CHP1 in knockdown cells may contribute to the stabilization of NHE1. These results are consistent with those obtained in CHP1-deficient DT40 cells and suggest that CHP1 plays a ubiquitous role in stabilizing NHE1.
|
| DISCUSSION |
|---|
|
|
|---|
NHE1 protein levels may be reduced in CHP1-deficient cells because of proteolysis. A recent study reported that the heterologous expression of mammalian NHE1 in yeast plasma membrane is stabilized in a strain with decreased levels of ubiquitin ligases (12). Our data suggest that NHE1 is a substrate of the ubiquitin-proteasome system and that degradation by the ubiquitin-proteasome system contributes to the loss of NHE1 in CHP1-deficient cells (Fig. 6, B and C). However, our data do not necessarily exclude the involvement of other mechanisms, such as attenuation of translation. Multiple mechanisms, including proteasomal degradation, may be involved in the loss of NHE1. A full understanding of the mechanism of NHE1 loss will require further studies.
A recent structural study of CHP1 revealed that CHP1 has a hydrophobic pocket that provides an NHE1-binding site (26). Binding of CHP1 through this pocket may stabilize the NHE1 structure, allowing it to reach the plasma membrane. The CHP1-binding site is located at the juxtamembrane region in the hydrophilic domain of NHE (34). For the yeast plasma membrane NHE (Nha1p), the juxtamembrane region also contributes to proper expression in the plasma membrane (23). Although the sequences of animal and yeast NHEs are not homologous in this region, these observations suggest the structural importance of the juxtamembrane region of eukaryotic NHEs for their proper expression and activity.
In previous studies, Pang et al. (34) showed that overexpressed NHE1 mutants, which are incapable of interacting with CHP1, are transported to the plasma membrane, leading to the conclusion that CHP1 is not required for trafficking to the plasma membrane. Their results seem to be inconsistent with our results. If high levels of NHE1 are expressed from a transgene, a portion of the NHE1 would be expected to leak and escape degradation. This notion is supported by the similar levels of NHE1 protein in NHE1-overexpressing CHP1-deficient cells and NHE1-overexpressing wildtype cells (Fig. 6A). Our results indicate that the primary physiological function of CHP1 is to stabilize NHE1 so that it can reach the plasma membranes. The difference in the modification of NHE1 between wildtype and CHP1-deficient cells under NHE1-overexpressing conditions (Fig. 6) suggests that NHE1 stability may be affected by impaired modifications caused by incorrect NHE1 conformations. The mechanism that is responsible for the impaired modification of NHE1 is currently unclear. It has been reported that impaired modification is associated with cellular stress and proteasome degradation (49, 50). Such conformations and/or impaired modifications could contribute to stress control in the endoplasmic reticulum and subsequent degradation of NHE1, although determining the precise mechanism will require further study.
Lin and Barber (19) reported that overexpression of CHP1 causes inhibition of NHE1 activation induced by serum or small G proteins. In this study, we observed that NHE1 protein levels were very low in CHP1-deficient cells. As a result of the very low activity of NHE1 in these cells, we had considerable difficulty in performing the same type of experiments as those performed by Lin and Barber (19), such as serum activation. However, our results indicate that the primary role of CHP1 is stabilization of the NHE1 protein rather than regulation of NHE1 activity.
Expression of forms of CHP1 incapable of Ca2+ binding or myristoylation affect NHE1 protein levels (Fig. 6). However, the rescued NHE1 activities were lower than those observed in cells expressing wildtype CHP1. These results suggest that stabilization of NHE1 mediated by CHP1 requires Ca2+ binding or myristoylation, but these factors may not be essential. Pang et al. (33) found that cells expressing CHP1-green fluorescent protein or mutant derivatives (E134A, E175A, E134/175A) exhibited similarly high Na+/H+ exchange activity at an acidic pH, a result consistent with our observations. In our study, Na+ uptake activity by one NHE1 molecule in CHP-deficient cells was
20% of that of wildtype cells. It should be noted that this decreased activity was observed with endogenous NHE1 in CHP1-deficient cells. This decrease in NHE activity is consistent with the activity of engineered NHE1 lacking CHP1-binding capability, as previously described (34). Taken together, these results indicate that CHP1 enhances the acidification-induced activity of NHE1 and that Ca2+ binding or myristoylation is not necessarily essential for NHE1 activities in intact cells.
Although we used chicken lymphoma DT40 cells, our study is likely applicable to mammalian systems. Chicken CHP1 differs from mouse CHP1 by only four amino acids, and functional motifs, such as EF-hands, are conserved in both. The hydrophilic region of chicken NHE1 also exhibits >85% homology to mouse NHE1. Moreover, the CHP1-binding site in this region of NHE1 is completely conserved among avian and mammalian species. Because chicken NHE1 on the cell surface showed two forms, slight differences such as glycosylation may exist. However, the results of the knockdown experiments in HeLa cells strongly support the notion that NHE1 stabilization by CHP1 is not specific to chicken DT40 cells but rather is applicable to other types of cells and species.
Since CHP1 has several binding partners, as described previously (1, 18, 20, 21, 24), loss of CHP1 might affect several activities. However, we did not observe extensive decreases in cell growth or morphological changes in CHP1 knockout cells nor did we find that the CHP2 isoform was induced. In summary, in CHP1-deficient cells, extensive loss of NHE1 protein was observed. This result suggests that CHP1 may be involved in the biogenesis or folding and/or stabilization of NHE1. On the basis of newly discovered physiological functions of CHP1, we conclude that CHP1 primarily plays an essential role in stabilization of NHE1 at an early stage of biogenesis.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Attaphitaya S, Park K, Melvin JE. Molecular cloning and functional expression of a rat Na+/H+ exchanger (NHE5) highly expressed in brain. J Biol Chem 274: 43834388, 1999.
3. Baba TW, Giroir BP, Humphries EH. Cell lines derived from avian lymphomas exhibit two distinct phenotypes. Virology 144: 139151, 1985.[CrossRef][Web of Science][Medline]
4. Baird NR, Orlowski J, Szabo EZ, Zaun HC, Schultheis PJ, Menon AG, Shull GE. Molecular cloning, genomic organization, and functional expression of Na+/H+ exchanger isoform 5 (NHE5) from human brain. J Biol Chem 274: 43774382, 1999.
5. Barroso MR, Bernd KK, DeWitt ND, Chang A, Mills K, Sztul ES. A novel Ca2+-binding protein, p22, is required for constitutive membrane traffic. J Biol Chem 271: 1018310187, 1996.
6. Bowers K, Levi BP, Patel FI, Stevens TH. The sodium/proton exchanger Nhx1p is required for endosomal protein trafficking in the yeast Saccharomyces cerevisiae. Mol Biol Cell 11: 42774294, 2000.
7. Counillon L, Pouyssegur J. The expanding family of eucaryotic Na(+)/H(+) exchangers. J Biol Chem 275: 14, 2000.
8. Counillon L, Pouyssegur J, Reithmeier RA. The Na+/H+ exchanger NHE-1 possesses N- and O-linked glycosylation restricted to the first N-terminal extracellular domain. Biochemistry 33: 1046310469, 1994.[CrossRef][Medline]
9. Demaurex N, Downey GP, Waddell TK, Grinstein S. Intracellular pH regulation during spreading of human neutrophils. J Cell Biol 133: 13911402, 1996.
10. Demaurex N, Grinstein S. Na+/H+ antiport: modulation by ATP and role in cell volume regulation. J Exp Biol 196: 389404, 1994.
11. Denker SP, Huang DC, Orlowski J, Furthmayr H, Barber DL. Direct binding of the Na-H exchanger NHE1 to ERM proteins regulates the cortical cytoskeleton and cell shape independently of H(+) translocation. Mol Cell 6: 14251436, 2000.[CrossRef][Web of Science][Medline]
12. Flegelova H, Haguenauer-Tsapis R, Sychrova H. Heterologous expression of mammalian Na/H antiporters in Saccharomyces cerevisiae. Biochim Biophys Acta 1760: 504516, 2006.[Medline]
13. Goyal S, Vanden Heuvel G, Aronson PS. Renal expression of novel Na+/H+ exchanger isoform NHE8. Am J Physiol Renal Physiol 284: F467F473, 2003.
14. Houle JG, Wasserman WJ. Intracellular pH plays a role in regulating protein synthesis in Xenopus oocytes. Dev Biol 97: 302312, 1983.[CrossRef][Web of Science][Medline]
15. Inoue H, Nakamura Y, Nagita M, Takai T, Masuda M, Nakamura N, Kanazawa H. Calcineurin homologous protein isoform 2 (CHP2), Na+/H+ exchangers-binding protein, is expressed in intestinal epithelium. Biol Pharm Bull 26: 148155, 2003.[CrossRef][Web of Science][Medline]
16. Johnson JD, Epel D. Intracellular pH and activation of sea urchin eggs after fertilisation. Nature 262: 661664, 1976.[CrossRef][Medline]
17. Koyama H, Goodpasture C, Miller MM, Teplitz RL, Riggs AD. Establishment and characterization of a cell line from the American opossum (Didelphys virginiana). In Vitro 14: 239246, 1978.[Web of Science][Medline]
18. Kuwahara H, Kamei J, Nakamura N, Matsumoto M, Inoue H, Kanazawa H. The apoptosis-inducing protein kinase DRAK2 is inhibited in a calcium-dependent manner by the calcium-binding protein CHP. J Biochem (Tokyo) 134: 245250, 2003.
19. Lin X, Barber DL. A calcineurin homologous protein inhibits GTPase-stimulated Na-H exchange. Proc Natl Acad Sci USA 93: 1263112636, 1996.
20. Lin X, Sikkink RA, Rusnak F, Barber DL. Inhibition of calcineurin phosphatase activity by a calcineurin B homologous protein. J Biol Chem 274: 3612536131, 1999.
21. Matsumoto M, Miyake Y, Nagita M, Inoue H, Shitakubo D, Takemoto K, Ohtsuka C, Murakami H, Nakamura N, Kanazawa H. A serine/threonine kinase which causes apoptosis-like cell death interacts with a calcineurin B-like protein capable of binding Na(+)/H(+) exchanger. J Biochem (Tokyo) 130: 217225, 2001.
22. Matsushita M, Tanaka S, Nakamura N, Inoue H, Kanazawa H. A novel kinesin-like protein, KIF1Bbeta3 is involved in the movement of lysosomes to the cell periphery in non-neuronal cells. Traffic 5: 140151, 2004.[CrossRef][Web of Science][Medline]
23. Mitsui K, Yasui H, Nakamura N, Kanazawa H. Oligomerization of the Saccharomyces cerevisiae Na+/H+ antiporter Nha1p: implications for its antiporter activity. Biochim Biophys Acta 1720: 125136, 2005.[Medline]
24. Nakamura N, Miyake Y, Matsushita M, Tanaka S, Inoue H, Kanazawa H. KIF1Bbeta2, capable of interacting with CHP, is localized to synaptic vesicles. J Biochem (Tokyo) 132: 483491, 2002.
25. Nakamura N, Tanaka S, Teko Y, Mitsui K, Kanazawa H. Four Na+/H+ exchanger isoforms are distributed to Golgi and post-Golgi compartments and are involved in organelle pH regulation. J Biol Chem 280: 15611572, 2005.
26. Naoe Y, Arita K, Hashimoto H, Kanazawa H, Sato M, Shimizu T. Structural characterization of calcineurin B homologous protein 1. J Biol Chem 280: 3237232378, 2005.
27. Noel J, Pouyssegur J. Hormonal regulation, pharmacology, and membrane sorting of vertebrate Na+/H+ exchanger isoforms. Am J Physiol Cell Physiol 268: C283C296, 1995.
28. Numata M, Orlowski J. Molecular cloning and characterization of a novel (Na+,K+)/H+ exchanger localized to the trans-Golgi network. J Biol Chem 276: 1738717394, 2001.
29. Numata M, Petrecca K, Lake N, Orlowski J. Identification of a mitochondrial Na+/H+ exchanger. J Biol Chem 273: 69516959, 1998.
30. Orlowski J. Heterologous expression and functional properties of amiloride high affinity (NHE-1) and low affinity (NHE-3) isoforms of the rat Na/H exchanger. J Biol Chem 268: 1636916377, 1993.
31. Orlowski J, Grinstein S. Diversity of the mammalian sodium/proton exchanger SLC9 gene family. Pflügers Arch 447: 549565, 2004.[CrossRef][Web of Science][Medline]
32. Orlowski J, Kandasamy RA, Shull GE. Molecular cloning of putative members of the Na/H exchanger gene family. cDNA cloning, deduced amino acid sequence, and mRNA tissue expression of the rat Na/H exchanger NHE-1 and two structurally related proteins. J Biol Chem 267: 93319339, 1992.
33. Pang T, Hisamitsu T, Mori H, Shigekawa M, Wakabayashi S. Role of calcineurin B homologous protein in pH regulation by the Na+/H+ exchanger 1: tightly bound Ca2+ ions as important structural elements. Biochemistry 43: 36283636, 2004.[CrossRef][Medline]
34. Pang T, Su X, Wakabayashi S, Shigekawa M. Calcineurin homologous protein as an essential cofactor for Na+/H+ exchangers. J Biol Chem 276: 1736717372, 2001.
35. Pang T, Wakabayashi S, Shigekawa M. Expression of calcineurin B homologous protein 2 protects serum deprivation-induced cell death by serum-independent activation of Na+/H+ exchanger. J Biol Chem 277: 4377143777, 2002.
36. Rubin H. pH, serum and Zn++ in the regulation of DNA synthesis in cultures of chick embryo cells. J Cell Physiol 82: 231238, 1973.[CrossRef][Web of Science][Medline]
37. Rutherford P, Pizzonia J, Abu-Alfa A, Biemesderfer D, Reilly R, Aronson P. Sodium-hydrogen exchange isoform expression in blood cells: implications for studies in diabetes mellitus. Exp Clin Endocrinol Diabetes 105, Suppl 2: 1316, 1997.[Web of Science][Medline]
38. Rutherford PA, Pizzonia JH, Biemesderfer D, Abu-Alfa A, Reilly R, Aronson PS. Expression of Na+-H+ exchanger isoforms NHE1 and NHE3 in kidney and blood cells of rabbit and rat. Exp Nephrol 5: 490497, 1997.[Web of Science][Medline]
39. Sambrook J, Russell W. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 2001.
40. Sardet C, Franchi A, Pouyssegur J. Molecular cloning, primary structure, and expression of the human growth factor-activatable Na+/H+ antiporter. Cell 56: 271280, 1989.[CrossRef][Web of Science][Medline]
41. Szaszi K, Grinstein S, Orlowski J, Kapus A. Regulation of the epithelial Na(+) /H(+) exchanger isoform by the cytoskeleton. Cell Physiol Biochem 10: 265272, 2000.[CrossRef][Web of Science][Medline]
42. Takata M, Sabe H, Hata A, Inazu T, Homma Y, Nukada T, Yamamura H, Kurosaki T. Tyrosine kinases Lyn and Syk regulate B cell receptor-coupled Ca2+ mobilization through distinct pathways. EMBO J 13: 13411349, 1994.[Web of Science][Medline]
43. Timm S, Titus B, Bernd K, Barroso M. The EF-hand Ca(2+)-binding protein p22 associates with microtubules in an N-myristoylation-dependent manner. Mol Biol Cell 10: 34733488, 1999.
44. Tsuchiya Y, Hayashi H, Suzuki Y. Na+-dependent recovery of intracellular pH from acid loading in mouse colonic crypt cells. Tohoku J Exp Med 193: 111, 2001.[CrossRef][Web of Science][Medline]
45. Vigne P, Frelin C, Cragoe EJ Jr, Lazdunski M. Ethylisopropyl-amiloride: a new and highly potent derivative of amiloride for the inhibition of the Na+/H+ exchange system in various cell types. Biochem Biophys Res Commun 116: 8690, 1983.[CrossRef][Web of Science][Medline]
46. Wakabayashi S, Fafournoux P, Sardet C, Pouyssegur J. The Na+/H+ antiporter cytoplasmic domain mediates growth factor signals and controls "H(+)-sensing". Proc Natl Acad Sci USA 89: 24242428, 1992.
47. Wakabayashi S, Pang T, Su X, Shigekawa M. A novel topology model of the human Na(+)/H(+) exchanger isoform 1. J Biol Chem 275: 79427949, 2000.
48. Winding P, Berchtold MW. The chicken B cell line DT40: a novel tool for gene disruption experiments. J Immunol Methods 249: 116, 2001.[CrossRef][Web of Science][Medline]
49. Zachara NE, Hart GW. O-GlcNAc modification: a nutritional sensor that modulates proteasome function. Trends Cell Biol 14: 218221, 2004.[CrossRef][Web of Science][Medline]
50. Zachara NE, O'Donnell N, Cheung WD, Mercer JJ, Marth JD, Hart GW. Dynamic O-GlcNAc modification of nucleocytoplasmic proteins in response to stress. A survival response of mammalian cells. J Biol Chem 279: 3013330142, 2004.
This article has been cited by other articles:
![]() |
H. Kuwahara, M. Nishizaki, and H. Kanazawa Nuclear Localization Signal and Phosphorylation of Serine350 Specify Intracellular Localization of DRAK2 J. Biochem., March 1, 2008; 143(3): 349 - 358. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |