|
|
||||||||
MUSCLE CELL BIOLOGY AND CELL MOTILITY
1Department of Physiology and Biophysics, 2 Transgenic Production Service, University of Illinois at Chicago, Chicago, Illinois; 3Department of Molecular and Cellular Physiology, University of Cincinnati College of Medicine, Cincinnati, Ohio; 4Department of Physiology and Cell Biology, Doris M. Davis Heart and Lung Research Institute, Ohio State University College of Medicine, Columbus, Ohio; and 5Department of Medicine, Division of Cardiology, University of Colorado, Denver, Colorado
Submitted 9 November 2006 ; accepted in final form 19 March 2007
| ABSTRACT |
|---|
|
|
|---|
-actin promoter. Immunoblot analysis showed substantial expression of the cMyc-tagged SM1 and V5-tagged SM2 MyHC protein in aorta and bladder and transgene mRNA was expressed in mice carrying unlabeled SM1 or SM2 transgenes. Despite significant protein expression of tagged MyHCs we found only small changes in the SM1:SM2 protein ratio. Significant changes in functional phenotype were observed in mice carrying unlabeled SM1 or SM2 transgenes. Force in aorta and bladder was increased (72 ± 14%, 92 ± 11%) in SM1 and decreased to 57 ± 1% and 80 ± 3% in SM2 transgenic mice. SM1 transgenic bladders had faster (1.8 ± 0.3 s) and SM2 slower (7.1 ± 0.5 s) rates of force redevelopment following a rapid step shortening. We hypothesize that small changes in the SM1:SM2 ratio could be amplified if they are associated with changes in thick filament assembly and underlie the altered contractility. These data provide evidence indicating an in vivo function for the COOH-terminal isoforms of smooth muscle myosin and suggest that the SM1:SM2 ratio is tightly regulated in smooth muscle tissues. myosin heavy chain; transgenic mice
At least four isoforms of myosin heavy chain (MyHC) are expressed in SM, generated by differential splicing of a single gene at the 25K-50K junction in the NH2-terminal region of the myosin (16, 38), and at the COOH-terminus (24). The NH2-terminal splice site results in the insertion (SMb) or absence (SMa) of seven amino acids in the loop 1 region of the MyHC (27). At the COOH terminus, alternative splicing leads to the insertion of an exon coding for nine amino acids and a stop codon to form the isoform, SM2, with a nine amino acid nonhelical tail region, whereas the SM1 isoform, with no insert, has a longer nonhelical tail of 43 amino acids. The myosin isoforms are nonuniformly distributed among SM tissues. The SMb isoform predominates in phasic SMs, whereas SMa is the major isoform in tonic SMs (38). Both of the COOH-terminal isoforms, SM1 and SM2, are present in all adult SM tissues although individual cells containing only SM1 or SM2 have been identified (22). The NH2-terminal insert (SMb) is associated with an increased ATPase activity and actin velocity as determined by the in vitro motility assay (16) and a decreased affinity for ADP (9, 17, 34). Thus it is not unexpected that the absence of the SMb isoform (2) results in a decreased unloaded shortening velocity in bladder from a SMb null mouse (15).
The functional role of the SM1 and SM2 isoforms is controversial. We have shown previously that estrogen treatment of ovariectomized rats increases the relative amount of SM1 in rat uterus, which was correlated with an increase in developed force and unloaded shortening velocity in permeabilized myometrial fibers (12). Hypertrophy of smooth muscle, following partial obstruction of the bladder, caused a decrease in both the COOH-terminal SM2 and NH2-terminal SMb isoforms (10, 21) that was associated with a decreased shortening velocity (30).
Variation in the expression of the SMa and SMb isoforms in conjunction with changes in SM1 and SM2 has, in part, contributed to the contradictory evidence in the literature. We developed transgenic (TG) mouse lines carrying a transgene for the MyHC isoforms SM1 or SM2, targeted to SM expression by the SM
-actin promoter (8, 23). SM1 transgene expression increased isometric force and shortening velocity whereas the SM2 transgene had the opposite effects. These results indicate that the COOH-terminal isoforms of SM myosin may play an important role in SM contractile function.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of the SM-
-actin/SMaSM1 and SM-
-actin/SMaSM2 fusion genes.
A 6.2-kb cDNA clone (SMHC-5), isolated from a rat stomach cDNA library (38) and identified as the SMaSM1 MyHC isoform was used. The SM2 sequence was generated by RT-PCR of rat stomach RNA using standard procedures and primers, containing a 5' NcoI site and a 3' NotI site, flanking the SM2 splice site. The RT-PCR product was subcloned into the T/A vector (Invitrogen) and sequenced. The NcoI-NotI fragment was excised and ligated into the SMHC-5 cDNA. An XhoI site was inserted 15 bp upstream of the MyHC ATG start site and a NotI site was inserted following the polyadenylation signal. We inserted a cMyc-tag or a V5-tag between the XhoI site and the ATG start site of the SM1 MyHC to identify the MyHC protein derived from the transgene. All PCR amplified cDNA fragments were subcloned and sequenced. Finally, the entire MyHC cDNA was ligated into the pGEM7Z vector containing the SMP8 SM-
-actin promoter (8, 23) and a simian virus 40 (SV40) sequence forming the 10.3-kb SMP8-SM-
-actin promoter/MyHCcDNA/SV40 fusion gene (37). All boundaries were sequenced in the final construct.
Generation of TG mice. The fusion gene was digested by the restriction enzymes AatII and ClaI and separated by agarose gel electrophoresis. Following isolation and purification of the 10.3-kb construct, it was microinjected into pronuclei from fertilized eggs from CD-1 mice by Dr. Roberta Franks in the Transgenic Production Service, Research Resources Center at the University of Illinois at Chicago using a protocol approved by the University of Illinois at Chicago Animal Care Committee. Positive founders were identified by Southern blot analysis of PstI cut genomic DNA using an XhoI-SphI fragment from the 5' region of the rat MyHC cDNA as a probe and by PCR analysis using the following primers: 5'-GATTAGCATTTGTCTCCATTCGT and 3'-CTTGTTTATTGCAGCTTATAATGG that span the MyHC-SV40 boundary. Heterozygous and wild-type progeny were routinely identified by PCR analysis of genomic DNA from tail samples using the above primers. In the experiments reported here, we have used two SM1 lines (F81 and F84) and three SM2 lines (F37, F63, and F67). We have not observed any significant differences in functional phenotype between lines for either transgene.
Transgene expression in mouse tissues.
Total RNA was extracted from several SM and nonmuscle tissues using the procedure of Chomczynski and Sacchi (5). We used the following primers for analysis of the expression of the transgene mRNA in SM and non-SM tissues. The 3' primer (AGGATGCCACCACAGCCAAATACT) and 5' primer (ACCCTGAGACGCTG-GATCCAGATC) span the
-actin exon 2 and MyHC boundary. The PCR products were analyzed on agarose gels. For analysis of the relative levels of SMa and SMb mRNAs, we used two primers (5'ACCAGTCCATTCTGTGCAC) and (3' CCATGATGGACATGGCCTC) spanning the area of divergence between SMa and SMb MyHCs. These primers generated either a 500 or a 479-bp cDNA fragment corresponding to SMb and SMa mRNAs, respectively, which were separated on 4% polyacrylamide-urea gels. RT-PCR was performed using standard procedures with SuperScript RNAse H RT and Taq polymerase (GIBCO-BRL, Gaithersburg, MD). [32P]dCTP was included in the analysis of SMa and SMb mRNAs.
SDS-PAGE. The SM1 and SM2 isoforms of myosin were separated by electrophoresis on large 6% acrylamide gels with 1% cross-linking by the Laemmli procedure (18). The gels were stained with Coomassie blue and the relative proportions of SM1 and SM2 isoforms present were determined by densitometry. We also ran tissue extracts from bladder on 10% polyacrylamide gels to determine the ratio of actin to MyHC in nontransgenic (NTG) and TG mice by densitometric analysis of Coomassie blue-stained gels. The data are expressed as means ± SE.
The essential light chains (LC17a and LC17b) of myosin were separated on urea-glycerol polyacrylamide gels (25, 31) and blotted onto nitrocellulose. Myosin LCs were identified using an antibody specific for smooth muscle LC20 (Cell Signaling Technology, antibody no. 3672) and a polyclonal antibody to smooth muscle light chains that we observed reacts with both LC20 and LC17 myosin light chains (Santa-Cruz Biotechnology, antibody no. sc-15370). The membranes were washed and incubated with horseradish peroxidase (HRP)-conjugated secondary antibody for 1 h at room temperature. After being washed, the membranes were developed with the use of enhanced chemiluminescence. The relative proportions of LC17b and LC17a in aorta and bladder tissue extracts from NTG and SM1 and SM2 TG mice were determined by densitometric analysis.
Western blot analysis.
Protein expression from the transgene was examined in tissue extracts from bladder and aorta from mice carrying the cMyc-tagged SM1 or V5-tagged SM2 transgene and their NTG littermates. Proteins were separated by electrophoresis on 6% polyacrylamide gels with 1% cross-linking before electrophoretic transfer to PVDF membrane (36). cMyc expression was detected using a monoclonal antibody to cMyc protein (7) (Developmental Studies Hybridoma Bank, University of Iowa) and a secondary antibody (donkey anti-mouse IgG) conjugated to HRP. V5 expression was detected using a rabbit polyclonal antibody to the V5 peptide (Sigma, St. Louis, MO) and a goat anti-rabbit IgG conjugated to HRP. The blots were developed using the ECL kit from Amersham Biosciences (Piscataway, NJ). Antibodies were removed from the membrane in the presence of 2% SDS and 30 mM
-mercaptoethanol and the membrane was incubated with a polyclonal antibody, SM1Ab, or SM2Ab specific for either the SM1 or SM2 isoform of MyHC (14). SM1Ab and SM2Ab binding was detected using a HRP-conjugated goat anti-rabbit IgG and the Amersham ECL kit.
The relative ratio of
-actin to total actin in tissue extracts from TG and NTG bladders was determined using an antibody specific for SM
-actin (Sigma, St. Louis, MO) and an antibody (mAbC4) (19) that reacts with all isotypes of actin. The proteins in tissue extracts were separated by electrophoresis on 12.5% polyacrylamide gels and transferred to PVDF membrane (36). Binding of anti-actin antibodies was detected using a goat anti-mouse secondary antibody conjugated to hydrogen peroxidase and the ECL kit (Amersham). The membrane was exposed to X-ray film for different periods of time and the films were scanned using a Molecular Dynamics densitometer and analyzed using ImageQuant Software. The results are expressed as a ratio of SM
-actin pixels to total actin pixels for each protein concentration and each exposure. The means ± SE of these ratios in bladders from NTG and TG mice were compared using Student's t-test.
Measurement of contractile function.
Matched littermate mice between 8 and 14 wk old were euthanized by CO2 asphyxiation. Aortae or bladders were excised, placed in ice-cold physiological saline solution, and debrided of loose fat and connective tissue, and prepared for measurement of isometric force as previously described in detail (2, 33). Tissues were mounted isometrically and the length was adjusted to attain a passive force determined to place the smooth muscle in the range for optimal force generation. For the aorta, the applied tension was chosen to approximate that attributable to 100 mmHg. For the bladder, the applied tension for optimal force development was determined in preliminary experiments. The tissues were contracted in the presence of 80 mmol/l KCl for two contraction/relaxation cycles or until reproducible forces were obtained. KCl (1080 mmol/l) concentration-developed force relations were obtained in a cumulative fashion. Isometric force was normalized to the tissue cross sectional area. This area was calculated as the wet weight/length for the bladder or 2x wet wt/circumference for aorta. To quantitate tension regeneration kinetics, bladders were stimulated with 80 mmol/l KCl. When a stable tension was achieved, tissues were rapidly (<0.5 s) shortened by 5% of their resting length. The time taken to redevelop half the maximum tension was used as an index of the rate of tension regeneration. Data were obtained with Acquire hardware and analyzed using AcqKnowledge Software (Biopac). Standard ANOVA was used as appropriate; differences were accepted as statistically significant for P
0.01.
| RESULTS |
|---|
|
|
|---|
-actin promoter/MyHC construct are shown in Fig. 1A. We identified 5 SM1 founder mice of the 36 analyzed and 7 SM2 founder mice out of 52 analyzed by Southern blot and PCR analysis as illustrated in Fig. 1, B and C. In Fig. 1B, number F86 had a very low copy number compared with numbers F81 and F84. In all cases, the transgene was transmitted to the F1 generation. The tissue distribution of the SM2 (F37) transgene mRNA is shown in Fig. 1C. mRNA from the SM2 transgene is expressed in SM tissues such as aorta, mesenteric artery, bladder, stomach, and uterus. It is not present in the heart, brain, or kidney tissue from TG mice. This is a typical tissue distribution for transgenes regulated by the smooth muscle specific SMP8 promotor (8, 37).
|
|
|
|
We also found no significant alteration in the expression of SM
-actin relative to total actin in bladder from TG (SM1 = 1.18 ± 0.03, n = 4; SM2 = 1.71 ± 0.08, n = 4) compared with NTG (1.39 ± 0.16, n = 8) mice.
Smooth muscle function. Figure 5 shows the force-KCl concentration relation for bladder and aorta in mice expressing the SM1 or SM2 transgene. Results from the F81 line of SM1 TG mice and the F67 line of SM2 TG mice are shown. Similar results were observed in additional lines of mice carrying the transgene for each COOH-terminal MyHC isoform. The contractile parameters from these experiments are summarized in Table 1. Maximum force was significantly (P < 0.01) different from NTG control mice in both aorta and bladder from SM1 and SM2 TG mice. The ED50 values of the KCl concentration did not differ significantly between NTG and TG bladders or aortae. Figure 5, A and B, show the responses of the SM1 mouse aortae and bladders respectively to KCl activation. Tissues from SM1 TG mice showed a consistently higher maximum force in response to KCl than tissues from NTG littermates. Maximum tension development in aortae and bladder from SM1 TG mice was elevated by 72% and 92%, respectively, compared with NTG tissues.
|
|
The differences in maximal force generation (SM1> NTG>SM2) were unlikely due to differences in activation. We tested this possibility by using
-escin to permeabilize bladders in a high Ca2+-containing solution to maximize intracellular [Ca2+]. In all cases, isometric force increased slightly (<15%) above the preexisting force in KCl. Importantly the percent increases did not differ between TG and NTG for either transgene (n = 3 for SM1 pair; n = 4 for SM2 pair). Thus the differences in maximum force among TG and NTG animals were maintained, under conditions selected to maximize activation.
Contraction kinetics. We assessed contractile kinetics by measuring the rate at which the bladder was able to regenerate tension following a rapid (0.5 s) stepwise shortening of 5% of the resting length. As shown in Fig. 6 and Table 1, SM1 TG bladders exhibit a significantly faster rate of tension regeneration compared with NTG. In contrast, the SM2 bladders showed the opposite response, having a significantly slower rate of tension regeneration than NTG.
|
| DISCUSSION |
|---|
|
|
|---|
We demonstrated that cMyc- and V5-labeled MyHC are expressed from the transgene in bladder and aorta (Fig. 2A). Further supporting the activity of the transgene is the shift from SMb to SMa mRNA (Fig. 2B). Intriguingly, relatively little demonstrable change was observed in the ratio of SM1:SM2 protein in smooth muscle tissues from heterozygous SM1 or SM2 TG mice using SDS-PAGE. This is an important finding as it suggests that the ratio of the COOH-terminal isoforms of MyHC is tightly regulated in smooth muscle. This idea is also consistent with the difficulty in developing experimental models that alter the isoform ratio. It is possible to alter the SM1:SM2 ratio using experimental interventions such as estrogen administration to ovariectomized rats (12), and partial obstruction of the bladder (10, 30). However, the shifts in the SM1:SM2 ratio in these experimental models are not very large (<10 percentage points) and are substantially exceeded by the associated functional changes. Conservation of the SM1:SM2 ratio may be compared with the maintenance of the stoichiometry between myofibrillar proteins in the heart. Myofibrillar proteins, overexpressed in the heart from a transgene, replace to a greater or lesser extent the endogenous protein, while maintaining the stoichiometry of the myofibrils (28). In our TG mice, we also see significant changes in force and kinetics associated with expression of the SM1 or SM2 transgene accompanied by only relatively small changes in the SM1:SM2 ratio. This is consistent with previous studies showing that relatively small changes in myosin isoform ratios can be associated with significant alterations in smooth muscle (12, 30) as well as cardiac (35) contractile function.
There are several hypotheses by which changes in MyHC isoform population can lead to major alteration of functional properties. Babu et al. (3) found altered expression of thin filament regulatory proteins associated with a change from the SMb to SMa NH2-terminal MyHC isoform. Since we found opposite functional effects for the SM1 and SM2 animals, we think that the effects of these proteins, which may have been altered with the transgene expression, are unlikely. We found no detectable LC17b in bladder tissue extracts and no differences between TG and NTG tissues for either SM1 or SM2 lines. A small (
10%) and not statistically significant increase in the ratio of LC17b to LC17a in aorta was observed in both SM1 and SM2 TG lines. Thus, it is unlikely that these increases could contribute to the opposite functional effects we observe in SM1 and SM2 TG tissues.
Changes in the SMa MyHC isoform have been reported to alter contractile characteristics in the bladder (6, 32). Babu et al. (2) have also shown that elimination of the SMb MyHC isoform in bladder leads to a significant decrease in maximal tension development and shortening velocity in the presence of unchanged ratios of SM1:SM2. In contrast, we find an increase in SMa mRNA expression in bladders from both SM1 and SM2 TG mice. However, we found significant and opposite changes in maximal tension development and velocity of shortening. Thus increased expression of SMaSM1 or SMaSM2 appears to alter contractile function independently of NH2-teminal SMa/SMb isoform expression. In the aorta, which contains principally the SMa isoform, similar changes in maximum force generation to those seen in the TG bladder further support our hypothesis that these contractility changes are associated with altered COOH-terminal isoform expression.
The functional role of the COOH-terminal SM1 and SM2 MyHC isoforms is not known with certainty. The nonhelical tail regions of nonmuscle MyHCs (1, 13) have been implicated in modulation of ATPase activity and thick filament assembly. We have shown that removal of the SM1 COOH-terminal region affects the NH2-terminal Mg-ATPase activity of phosphorylated myosin in vitro (14). It is also possible that the SM1 and SM2 isoforms assemble into thick filaments with different stabilities and functional properties (26, 29). In support of this hypothesis, paracrystals formed in vitro from SM1 or SM2 rod regions have different molecular packing characteristics and stability (26, 29). The greater stability of the SM1 rod thick filaments (29) may result from interaction of the SM1 COOH-terminal tail with an adjacent myosin molecule (4).
Our hypothesis is that overproduction of the SM1 or SM2 isoform from multiple copies of a transgene may change the dynamics of filament assembly, producing a different population of thick filament types with only minor changes in the proportions of SM1 and SM2 expressed in the tissue. Recent evidence (29) suggests that homodimers of SM1 and SM2 heavy chains are preferentially formed in vivo, whereas significant heterodimeric formation is seen in vitro. Whether thick filaments in vivo contain both SM1 and SM2 MyHC homodimers is unknown. However, isolated smooth muscle cells containing only SM1 or SM2 have been identified, in addition to cells containing both isoforms (22), therefore, filaments containing only SM1 or SM2 can be formed.
An example of how small differences in the SM1:SM2 isoform ratio can lead to large differences in filament types is illustrated in Fig. 7, A and B. If one assumes that a 50:50 mix of SM1 and SM2 MyHC chains are synthesized from the endogenous MyHC gene and that these SM1 and SM2 MyHCs randomly assemble into thick filaments, then the expected result would be the formation of 50% hybrid filaments consisting of SM1 and SM2 homodimers and 25% each SM1 only filaments or SM2 only filaments (Fig. 7A). An overall 8% increase in tissue expression of SM1 can result in a doubling of filaments containing only the SM1 isoform relative to those containing only the SM2 (Fig. 7B). In this way, a small change in SM1:SM2 ratio may be amplified by its effect on filament assembly.
|
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Babu GJ, Loukianov E, Loukianova T, Pyne GJ, Huke S, Osol G, Low RB, Paul RJ, Periasamy M. Loss of SM-B myosin affects muscle shortening velocity and maximal force development. Nat Cell Biol 3: 10251029, 2001.[CrossRef][Web of Science][Medline]
3. Babu GJ, Pyne GJ, Zhou Y, Okwuchukuasanya C, Brayden JE, Osol G, Paul RJ, Low RB, Periasamy M. Isoform switching from SM-B to SM-A myosin results in decreased contractility and altered expression of thin filament regulatory proteins. Am J Physiol Cell Physiol 287: C723C729, 2004.
4. Cai S, Ferguson DG, Martin AF, Paul RJ. Smooth muscle contractility is modulated by myosin tail-S2-LMM hinge region interaction. Am J Physiol Cell Physiol 269: C1126C1132, 1995.
5. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156159, 1987.[Web of Science][Medline]
6. Disanto ME, Stein R, Chang S, Hypolite JA, Zheng Y, Zderic S, Wein AJ, Chacko S. Alteration in expression of myosin isoforms in detrusor smooth muscle following bladder outlet obstruction. Am J Physiol Cell Physiol 285: C1397C1410, 2003.
7. Evan GI, Lewis GK, Ramsay G, Bishop JM. Isolation of monoclonal antibodies specific for human c-myc proto-oncogene product. Mol Cell Biol 5: 36103616, 1985.
8. Foster DN, Min B, Foster LK, Stoflet ES, Sun S, Getz MJ, Strauch AR. Positive and negative cis-acting regulatory elements mediate expression of the mouse vascular smooth muscle
-actin gene. J Biol Chem 267: 1199512003, 1992.
9. Fuglsang A, Khromov A, Torok K, Somlyo AV, Somlyo AP. Flash photolysis studies of relaxation and cross-bridge detachment: higher sensitivity of tonic than phasic smooth muscle to MgADP. J Muscle Res Cell Motil 14: 666677, 1993.[CrossRef][Web of Science][Medline]
10. Gomes CM, Disanto ME, Horan P, Levin RM, Wein AJ, Chacko S. Improved contractility of obstructed bladders after Tadenan treatment is associated with reversal of altered myosin isoform expression. J Urol 163: 20082013, 2000.[CrossRef][Web of Science][Medline]
11. Hellstrand P, Paul RJ. Vascular smooth muscle:relations betwee energy metabolism and mechanics. In: Vascular Smooth Muscles Metabolic, Ionic and Contractile Mechanisms, edited by Crass MF. New York: Academic, 1982, p. 126.
12. Hewett TE, Martin AF, Paul RJ. Correlations between myosin heavy chain isoforms and mechanical parameters in rat myometrium. J Physiol 460: 351364, 1993.
13. Hodge TP, Cross R, Kendrick-Jones J. Role of the COOH-terminal nonhelical tailpiece in the assembly of a vertebrate nonmuscle myosin rod. J Cell Biol 118: 10851095, 1992.
14. Ikebe M, Hewett TE, Martin AF, Chen M, Hartshorne DJ. Cleavage of a smooth muscle myosin heavy chain near its C terminus by
-chymotrypsin. Effect on the properties of myosin. J Biol Chem 266: 70307036, 1991.
15. Karagiannis P, Babu GJ, Periasamy M, Brozovich FV. Myosin heavy chain isoform expression regulates shortening velocity in smooth muscle: studies using an SMB KO mouse line. J Muscle Res Cell Motil 25: 149158, 2004.[CrossRef][Web of Science][Medline]
16. Kelley CA, Takahashi M, Yu JH, Adelstein RS. An insert of seven amino acids confers functional differences between smooth muscle myosins from the intestines and vasculature. J Biol Chem 268: 1284812854, 1993.
17. Kurzawa-Goertz SE, Perreault-Micale CL, Trybus KM, Szent-Gyorgyi AG, Geeves MA. Loop I can modulate ADP affinity, ATPase activity, and motility of different scallop myosins. Transient kinetic analysis of S1 isoforms. Biochemistry 37: 75177525, 1998.[CrossRef][Medline]
18. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680685, 1970.[CrossRef][Medline]
19. Lessard JL. Two monoclonal antibodies to actin: one muscle selective and one generally reactive. Cell Motil Cytoskeleton 10: 349362, 1988.[CrossRef][Web of Science][Medline]
20. Malmqvist U, Arner A. Isoform distribution and tissue contents of contractile and cytoskeletal proteins in hypertrophied smooth muscle from rat portal vein. Circ Res 66: 832845, 1990.
21. Malmqvist U, Arner A, Uvelius B. Cytoskeletal and contractile proteins in detrusor smooth muscle from bladders with outlet obstructiona comparative study in rat and man. Scand J Urol Nephrol 25: 261267, 1991.[Web of Science][Medline]
22. Meer DP, Eddinger TJ. Heterogeneity of smooth muscle myosin heavy chain expression at the single cell level. Am J Physiol Cell Physiol 270: C1819C1824, 1996.
23. Min BH, Foster DN, Strauch AR. The 5'-flanking region of the mouse vascular smooth muscle alpha-actin gene contains evolutionarily conserved sequence motifs within a functional promoter. J Biol Chem 265: 1666716675, 1990.
24. Nagai R, Kuro-o M, Babij P, Periasamy M. Identification of two types of smooth muscle myosin heavy chain isoforms by cDNA cloning and immunoblot analysis. J Biol Chem 264: 97349737, 1989.
25. Perrie WT, Perry SV. An electrophoretic study of the low-molecular-weight components of myosin. Biochem J 119: 3138, 1970.[Web of Science][Medline]
26. Quevillon-Cheruel S, Foucault G, Desmadril M, Lompre AM, Bechet JJ. Role of the C-terminal extremities of the smooth muscle myosin heavy chains: implication for assembly properties. FEBS Lett 454: 303306, 1999.[CrossRef][Web of Science][Medline]
27. Rayment I, Rypniewski WR, Schmidt-Bäse K, Smith R, Tomchick DR, Benning MM, Winkelmann DA, Wesenberg G, Holden HM. Three-dimensional structure of myosin subfragment-1: a molecular motor. Science 261: 5058, 1993.
28. Robbins J. Remodeling the cardiac sarcomere using transgenesis. Annu Rev Physiol 62: 261287, 2000.[CrossRef][Web of Science][Medline]
29. Rovner AS, Fagnant PM, Lowey S, Trybus KM. The carboxyl-terminal isoforms of smooth muscle myosin heavy chain determine thick filament assembly properties. J Cell Biol 156: 113123, 2002.
30. Sjuve R, Haase H, Morano I, Uvelius B, Arner A. Contraction kinetics and myosin isoform composition in smooth muscle from hypertrophied rat urinary bladder. J Cell Biochem 63: 8693, 1996.[Web of Science][Medline]
31. Sobieszek A, Jertschin P. Urea-glycerol-acrylamide gel electrophoresis of acidic low molecular weight muscle proteins:rapid determination of myosin light chain phosphorylation in myosin, actomyosin and whole muscle samples. Electrophoresis 7: 417425, 1986.[CrossRef][Web of Science]
32. Stanton MC, Clement M, Macarak EJ, Zderic SA, Moreland RS. Partial bladder outlet obstruction alters Ca2+ sensitivity of force, but not of MLC phosphorylation, in bladder smooth muscle. Am J Physiol Renal Physiol 285: F703F710, 2003.
33. Sutliff RL, Paul RJ. Smooth muscle studies using gene-altered mouse models: a users guide. In: Cardiovascular Physiology in the Genetically Engineered Mouse, edited by Hoit BD and Walsh RA. Boston: Kluwer, 1998, p. 247257.
34. Sweeney HL, Rosenfeld SS, Brown F, Faust L, Smith J, Xing J, Stein LA, Sellers JR. Kinetic tuning of myosin via a flexible loop adjacent to the nucleotide binding pocket. J Biol Chem 273: 62626270, 1998.
35. Tardiff JC, Hewett TE, Factor SM, Vikstrom KL, Robbins J, Leinwand LA. Expression of the
slow-isoform of MHC in the adult mouse heart causes dominant-negative functional effects. Am J Physiol Heart Circ Physiol 278: H412H419, 2000.
36. Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA 76: 43504354, 1979.
37. Wang J, Niu W, Nikiforov Y, Naito S, Chernausek S, Witte D, LeRoith D, Strauch A, Fagin JA. Targeted overexpression of IGF-I evokes distinct patterns of organ remodeling in smooth muscle cell tissue beds of transgenic mice. J Clin Invest 100: 14251439, 1997.[Web of Science][Medline]
38. White S, Martin AF, Periasamy M. Identification of a novel smooth muscle myosin heavy chain cDNA: isoform diversity in the S1 head region. Am J Physiol Cell Physiol 264: C1252C1258, 1993.
This article has been cited by other articles:
![]() |
D. Ronen and S. Ravid Myosin II Tailpiece Determines Its Paracrystal Structure, Filament Assembly Properties, and Cellular Localization J. Biol. Chem., September 11, 2009; 284(37): 24948 - 24957. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |