Am J Physiol Cell Physiol AJP: Advances in Physiology Education
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Cell Physiol 292: C2259-C2268, 2007. First published February 28, 2007; doi:10.1152/ajpcell.00323.2006
0363-6143/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow All Versions of this Article:
292/6/C2259    most recent
00323.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rotmann, A.
Right arrow Articles by Closs, E. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rotmann, A.
Right arrow Articles by Closs, E. I.

MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS

Activation of classical protein kinase C decreases transport via systems y+ and y+L

Alexander Rotmann,* Alexandra Simon,* Ursula Martiné, Alice Habermeier, and Ellen I. Closs

Department of Pharmacology, Johannes Gutenberg University, Mainz, Germany

Submitted 13 June 2006 ; accepted in final form 29 January 2007


   ABSTRACT
TOP
 ABSTRACT
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Activation of protein kinase C (PKC) downregulates the human cationic amino acid transporters hCAT-1 (SLC7A1) and hCAT-3 (SLC7A3) (Rotmann A, Strand D, Martiné U, Closs EI. J Biol Chem 279: 54185–54192, 2004; Rotmann A, Vekony N, Gassner D, Niegisch G, Strand D, Martine U, Closs EI. Biochem J 395: 117–123, 2006). However, others found that PKC increased arginine transport in various mammalian cell types, suggesting that the expression of different arginine transporters might be responsible for the opposite PKC effects. We thus investigated the consequence of PKC activation by phorbol-12-myristate-13-acetate (PMA) in various human cell lines expressing leucine-insensitive system y+ [hCAT-1, hCAT-2B (SLC7A2), or hCAT-3] as well as leucine-sensitive system y+L [y+LAT1 (SLC7A7) or y+LAT2 (SLC7A6)] arginine transporters. PMA reduced system y+ activity in all cell lines tested, independent of the hCAT isoform expressed, while mRNAs encoding the individual hCAT isoforms were either unchanged or increased. System y+L activity was also inhibited by PMA. The extent and onset of inhibition varied between cell lines; however, a PMA-induced increase in arginine transport was never observed. In addition, when expressed in Xenopus laevis oocytes, y+LAT1 and y+LAT2 activity was reduced by PMA, and this inhibition could be prevented by the PKC inhibitor bisindolylmaleimide I. In ECV304 cells, PMA-induced inhibition of systems y+ and y+L could be prevented by Gö6976, a specific inhibitor of conventional PKCs. Thymelea toxin, which activates preferentially classical PKC, had a similar inhibitory effect as PMA. In contrast, phosphatidylinositol-3,4,5-triphosphate-dipalmitoyl, an activator of atypical PKC, had no effect. These data demonstrate that systems y+ and y+L are both downregulated by classical PKC.

human cationic amino acid transporter; system y+L amino acid transporter

ARGININE AND ITS DERIVATIVE ornithine are the substrates for important metabolic pathways such as nitric oxide and polyamine synthesis. Uptake of these cationic amino acids (CAA) from the extracellular space can be rate limiting for the synthesis of these signaling molecules. In addition, arginine and the essential amino acid lysine must be supplied to cells for protein synthesis. It is therefore crucial to understand the regulation of CAA transport. In mammalian cells, CAA transport is mediated by various transport systems that can be distinguished by their interaction with neutral amino acids and their dependence on Na+. Of these, the so-called system y+ accounts for a significant part of CAA transport in most cell types. It was first described in fibroblasts (for review, see Ref. 8) and long thought to be the only CAA transporter in mammalian cells. System y+ is characterized by selectivity for CAA, half-maximal activity at CAA concentrations (KM) of 0.1–0.2 mM, Na+ and pH independence, and strong stimulation of transport by substrate at the trans-side of the membrane (trans-stimulation). Three carrier proteins that exhibit system y+ properties have been identified. They belong to the solute carrier family 7 (SLC7) where they build the subfamily of CAA transporters (CATs) (for review, see Refs. 7, 8). CAT-1 exhibits the widest expression and conforms best with system y+, since, at least among the human isoforms (human CATs; hCATs), hCAT-1 shows the highest apparent affinity, the strongest trans-stimulation, and independence of pH changes over a wide range. We and others have previously shown that hCAT-1-mediated transport is downregulated on protein kinase C (PKC) activation (11, 19). This PKC-mediated inhibition of hCAT-1 is due to a reduction of transporter protein in the plasma membrane (28). In a recent study, we demonstrated that PKC inhibits the activity of hCAT-3, a transporter with a much more restricted expression pattern (15–17, 36), in the same way (29). PKC is a large protein family that consists of different isoforms classified in three distinct categories: classical (or conventional), novel, and atypical (for a recent review, see Ref. 30). The conventional isoforms (cPKC{alpha}, -betaI, -betaII, and -{gamma}) contain two membrane-targeting regions, designated C1 and C2, responsible for binding of phorbol-12-myristate-13-acetate (PMA) or endogenously generated diacylglycerol (DAG) and anionic phospholipids (in a calcium-dependent manner), respectively. The novel isoforms (nPKC{delta}, -{epsilon}, -{eta}, and -{theta}) are maximally activated by DAG/PMA independently of calcium. The atypical isoforms (aPKC{zeta} and -{iota}/{lambda}) are not activated by DAG or PMA and also lack a calcium-sensitive C2 domain. Classic PKC isoforms, most likely PKC{alpha}, seem to be responsible for the downregulation of both hCAT-1 and hCAT-3 (19, 29). The effect of PKC on the two splice variants of the CAT-2 gene, the low-affinity CAT-2A and the system y+-like CAT-2B, has not yet been studied.

In contrast to the inhibitory action of PKC on hCAT-mediated transport, a PKC-induced increase of arginine transport in various mammalian cells was observed by others (1, 14, 21, 27). This suggested that other CAA transporters might be stimulated by PKC. In contrast to system y+, all the other CAA transporters accept also neutral amino acids (NAA) as substrates. Systems B0,+ (31, 34) and b0,+ (3, 10, 23, 35), predominantly expressed in epithelial cells, transport CAA and a wide range of NAA in a Na+-dependent and -independent way, respectively. System y+L is expressed in both epithelial and nonepithelial cells (9, 24, 33). CAA transport by this system is independent of Na+, whereas NAA transport requires Na+. One can thus discriminate among the individual systems by their Na+ dependence of CAA and NAA transport. For example, the activity of system y+ can be determined by measuring arginine transport in the presence of Na+ and high leucine concentrations that inhibit, competitively, transport through system y+L (8). The carrier proteins mediating system b0,+ (b0,+AT) and y+L [system y+L amino acid transporter (y+LAT)1 and y+LAT2] activity belong to the same gene family (SLC7) as the CAT proteins (37). However, in contrast to the CATs, b0,+AT and y+LATs require partner glycoproteins (rBAT and 4F2 heavy chain, respectively) for membrane targeting and proper function. Also different from the CAT proteins, these carriers function as obligatory exchangers. In the present study, we investigated the effect of PKC activation on system y+ and y+L transport in human cell lines from distinct origin as well as on system y+LAT expressed in Xenopus laevis oocytes.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell culture. The human cell lines A549/8 (lung carcinoma), A673 (neuroepithelioma), DLD-1 (colon carcinoma), ECV (bladder carcinoma), HaCaT (keratinocyte like), U373 MG (glioblastoma), and SK-N-MC (neuroblastoma) were obtained from American Type Culture Collection (Manassas, VA). The human endothelial cell line EA.hy926 was a gift from C.-J. S. Edgell (Univ. of North Carolina at Chapel Hill, NC), and the human testis teratocarcinoma cell line NT2 was purchased from Stratagene (Heidelberg, Germany). Cells were grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), except for the cell lines U373MG and A673, which were grown in Iscove's modified Dulbecco's medium (IMDM) supplemented with 10% FBS, and NT-2 cells grown in a 1+1 mixture of minimal essential medium (MEM) and Ham's F12 Nutrient mix, supplemented with 10% FBS. Cells were regularly tested for mycoplasma infection using 4,6-diamidino-2-phenylindole (DAPI; Roche Molecular Biochemicals, Mannheim, Germany). No contamination was detected. Human umbilical vein endothelial cells (HUVECs) were isolated as previously described (18). Cells were expanded in Earl's medium 199 [supplemented with 20% FBS, penicillin, streptomycin, and 3 mmol/l GlutaMAX (Invitrogen, Carlsbad, CA)] on dishes coated with 1% gelatin and used in the second or third passage.

Transport studies in human cells. Transport studies were carried out in cells grown to confluence in 96-well plates. All amino acids used were L-isomers. Uptake was measured either in untreated cells or in cells preincubated for the indicated time at 37°C in 100 µl/well medium containing the indicated compounds (all purchased from Calbiochem, Bad Soden, Germany) in 0.1% dimethyl sulfoxide (DMSO) or 0.1% DMSO alone. After preincubation, cells were washed twice with Locke's solution (in mM: NaCl 154, KCl 5.6, CaCl2 2, MgCl2 1, HEPES 10, NaHCO3 3.6, glucose 5.6, pH 7.4) containing 100 µM arginine and, where indicated, 2 mM leucine and then incubated for 30 s at 37°C in the same solution, respectively, containing, in addition, [3H]arginine (5–10 µCi/ml). The cells were then immediately transferred on ice, washed three times with ice-cold Locke's solution, and lysed in 0.5 M NaOH (100 µl/well, 30 min at room temperature). After neutralization of the lysates with 100 µl of 0.5 M HCl and 200 µl of buffer P (50 mM Tris·HCl, pH 7.4, 0.5 mM EDTA, 0.5 mM EGTA), the protein content of each sample was determined using the Bradford reaction (Bio-Rad, Munich, Germany). The radioactivity in the samples was measured by liquid scintillation counting. The background radioactivity derived from arginine bound to the cells {determined by addition of Locke's solution containing [3H]arginine (10 µCi/ml) followed by immediate washing steps} was subtracted from all values (usually <10% of experimental values).

Transport studies in X. laevis oocytes. cDNAs encoding y+LAT1 and y+LAT2 were obtained by RT-PCR using mRNA from human peripheral blood mononuclear cells and the following sense and antisense oligonucleotides, respectively: AAGGGTTTCCTCTCCTCCACC and AACCCCTGCTTTCCACATCA for human y+LAT1 and TGACAGGCCACAGCAAACAC and GCCCAGATCCTGAGTCTCCTATAG for human y+LAT2. They were inserted into the pSGEM vector (38). A plasmid encoding 4F2hc was a generous gift from Stefan Broer (Australian National University, Canberra, Australia). cRNAs were prepared by in vitro transcription (mMessage mMachine in vitro transcription kit; Ambion, AMS Biotechnology Europe, Cambridgeshire, UK). Twenty nanograms of 4F2hc and 40 ng of y+LAT(-1 or -2) cRNA (in 40 nl of H2O) were injected into each X. laevis oocyte (Dumont stages V–VI). Oocytes injected with 40 nl of water were used as controls. Arginine uptake was determined 2 days after injection of cRNA as previously described (5). Briefly, oocytes were incubated for 30 min at 20°C in uptake solution (100 mM NaCl, 2 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 5 mM HEPES, 5 mM Tris, pH 7.5) containing 100 µM unlabeled arginine and PMA or other compounds in the concentrations given. Oocytes were then transferred to the same solution supplemented with 5 µCi/ml L-[3H]arginine (ICN, Eschwege, Germany; L-[4,5-3H]arginine, 39 Ci/mmol). After incubation for 15 min at 20°C, oocytes were washed four times in ice-cold uptake solution and solubilized individually in 2% sodium dodecyl sulfate (SDS). The incorporated radioactivity was determined in a liquid scintillation counter.

Ribonuclease protection analyses. Plasmids containing a 201-nt fragment of hCAT-1 (phCAT-1/riboII), a 243-nt fragment of hCAT-3 (pXcmHC3/4), a 115-nt fragment of hCAT-2A (phCAT-2A/9), a 296-nt fragment of hCAT-2B (phCAT-2B/13.1), and a 108-nt cDNA fragment of the human beta-actin cDNA (pCR beta-actin hu {Delta}BstEII HindIII) have previously been described (11, 36, 39). To generate radiolabeled antisense RNA probes, the plasmids were linearized and in vitro transcribed as described previously (6). Total RNA was isolated from human cells using the method of Chomczynski and Sacchi (4). Ribonuclease protection analyses were performed with 20 µg RNA/sample as described previously (6).

Quantitative RT-PCR. Total RNA was isolated using the RNeasy Mini Kit (Qiagen) and quantified by its absorption at 260 nm. The expression of amino acid transporters and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; as reference) was determined using a one-step quantitative RT-PCR (qRT-PCR) method. Quantification of the hCAT mRNAs was performed using in vitro-synthesized RNAs containing the complete coding region of each transporter. To this end, plasmids hCAT2A-pSP64T, hCAT2B-pSP64T, and HC3.pSP64T were linearized with SalI and pSPhCAT1-AB1C with EcoRI, and cRNA was prepared by in vitro transcription from the SP6 promoter (mMessage mMachine in vitro transcription kit, Ambion,). RT-PCR was performed with the QuantiTect RT-PCR Kit (Qiagen) in 25-µl reactions in a 96-well spectrofluorometric thermal cycler (iCycler, Bio-Rad) using 0.5 µg of total RNA, 0.8 µM each sense and antisense oligonucleotide (Table 1), 0.4 µM TaqMan hybridization probes (Table 1), 400 µM each dNTP, and 5.75 mM MgCl2. The RT phase of the reaction was allowed to run for 30 min at 50°C. The cDNA product was then amplified through 50 cycles: 94°C (15 s), 60°C (60 s). Fluorescence was monitored at each 60°C annealing/extension step.


View this table:
[in this window]
[in a new window]

  		Table 1. Oligonucleotides used for qRT-PCR

 

   RESULTS
TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Leucine-insensitive and -sensitive arginine transport in different human cell lines. Since system y+ has been described as the major transport system for CAA in most mammalian cells, we first aimed at determining its contribution to total CAA transport in various human cells from different origin: A549/8 lung carcinoma, A673 neuroepithelioma, DLD-1 colon carcinoma, EA.hy926 endothelial, ECV304 bladder carcinoma, HaCaT keratinocyte-like, NT-2 teratocarcinoma, U373MG glioblastoma, SK-N-MC neuroblastoma, and HUVECs. We used 100 µM arginine for our transport assays, corresponding to the physiological arginine concentration in human plasma. Arginine uptake was measured in confluent cells either in the presence of 2 mM leucine (= system y+ activity) or in its absence (= all CAA systems). The system y+-mediated arginine transport was in the range of 0.5–1 pmol·µg protein–1·min–1 in all cells except for NT-2 cells, which exhibited a higher activity (1.8 ± 0.6 pmol·µg protein–1·min–1) (Fig. 1). System y+ activity made up, respectively, 74 and 69% of total arginine uptake in DLD-1 and NT2 cells and only 33 and 38% in EA.hy926 and A549/8 cells. In all other cell lines, system y+ amounted to ~50–60% of the total arginine transport. The leucine-sensitive arginine transport (representing all other transport systems for CAA) was calculated by subtracting the leucine-insensitive transport from total transport. This transport component was highest in EA.hy926 cells (1 ± 0.3 pmol·µg protein–1·min–1) and lowest in DLD-1 cells (0.35 ± 0.3 pmol·µg protein–1·min–1).


Figure 1
View larger version (20K):
[in this window]
[in a new window]

  		Fig. 1. Leucine-sensitive and -insensitive arginine (Arg) transport in different human cell lines. Confluent cells grown in 24- or 96-well plates were washed twice with Locke's solution containing 100 µM arginine and then incubated in the same solution containing, in addition, 5–10 µCi/ml [3H]arginine for 30 s at 37°C. A: leucine-insensitive arginine transport (system y+ transport) was determined in the presence of 2 mM leucine. B: bars represent the leucine-sensitive arginine transport mediated by transport systems other than system y+ (calculated by subtracting the system y+ transport from total transport). The background radioactivity derived from L-arginine bound to the cells {determined by addition of Locke's solution containing L-[3H]arginine (10 µCi/ml) followed by immediate washing steps} was subtracted from all values. Data represent means ± SD; n = 15–30. HUVECs, human umbilical vein endothelial cells.

 
Expression of CAA transporter mRNA in different human cell lines. We then asked which transporter might mediate the respective CAA transport activity in the cell lines investigated. For this purpose, we investigated the expression of all known CAA transporters on the mRNA level. RNase protection analyses performed for the system y+ transporters hCAT-1, -2A, -2B, and -3 revealed a distinct expression pattern for each hCAT isoform (Fig. 2). hCAT-1 was expressed in all cell lines, but at different levels (Fig. 2A). The highest expression was found in A673 and DLD-1 cells. ECV304, HaCaT, NT2, and SK-N-MC cells exhibited an intermediate expression level. Low expression was seen in A549/8, EA.hy926, and U373MG cells. A similar hCAT-1 expression pattern was observed using qRT-PCR, except that SK-N-MC cells exhibited a higher hCAT-1 expression than assessed by RNase protection analysis (Fig. 3A). For all other hCAT isoforms, the results of both analysis methods were basically identical (compare Fig. 2, B and C, with Fig. 3, B and C, respectively). No hCAT-2A expression could be detected in any of the cell lines investigated (data not shown; for a positive control of the hCAT-2A qRT-PCR, see Supplemental Fig. S1A; supplemental data are available at the online version of this article). The highest hCAT-2B expression was found in A549/8 cells, whereas A673, DLD-1, NT2, and SK-N-MC cells and HUVECs exhibited a low hCAT-2B expression. No hCAT-2B expression was found in EA.hy926, ECV304, HaCaT, and U373MG cells (Figs. 2B and 3B). hCAT-3 was only expressed in three cell lines: NT-2 cells exhibited a very strong expression, and A673 and SK-N-MC cells showed a very weak expression (Figs. 2C and 3C).


Figure 2
View larger version (21K):
[in this window]
[in a new window]

  		Fig. 2. Expression pattern of human cationic amino acid transporter (hCAT)-1, hCAT-2B, and hCAT-3 mRNA in different human cell lines. RNase protection analyses of total RNA prepared from the indicated cell lines using the method of Chomczynski and Sacchi (4). The RNA was hybridized with antisense cRNA probes specific for hbeta-actin (as an internal control) and for hCAT-1 (A), hCAT-2B (B), or hCAT-3 (C). After RNase treatment, the protected RNA fragments (hbeta-actin, 108 nt; hCAT-1, 201 nt; hCAT-2B, 296 nt; and hCAT-3, 243 nt) were separated on a 6% denaturing polyacrylamide gel. M, DNA size marker ({Phi}X174; Promega, Heidelberg, Germany, restricted with HinfI); A1, A2, h1, h2B, and h3, undigested probes for hbeta-actin (188 or 222 nt), hCAT-1 (252 nt), hCAT-2B (307 nt), and hCAT-3 (292 nt), respectively; T, tRNA used as a negative control. Representative autoradiograms are shown. A similar expression pattern was seen in 3–4 independent experiments. Note that, in B, the positions of SK-N-MC and U373MG are switched.

 

Figure 3
View larger version (14K):
[in this window]
[in a new window]

  		Fig. 3. Quantification of hCAT-1, hCAT-2B, and hCAT-3 mRNA-expression in different human cell lines. Total RNA from the indicated human cell lines was analyzed by quantitative RT-PCR (qRT-PCR) for hCAT-1 (A), hCAT-2B (B), and hCAT-3 (C) expression. The amount of each hCAT mRNA was calculated from calibration curves obtained using in vitro-synthesized RNAs comprising the respective entire coding region. Data represent means ± SD; n = 3–5.

 
Next, we investigated the expression of CAA transporters that mediate the activities of systems y+L (y+LAT1+2), b0,+ (b0,+AT), and B0,+ (ATB0,+). While at least one representative of the first was found in each cell line investigated, no noteworthy b0,+AT or ATB0,+ expression could be detected in any of them (for a positive control of the respective qRT-PCR, see Supplemental Fig. S1, B and C). By far the strongest expression of y+LAT1 was found in DLD-1 cells and HUVECs (Fig. 4A). In contrast, ECV304 and U373MG cells did not exhibit any appreciable y+LAT1 expression. All other cell lines showed a low-to-intermediate expression of this transporter. The expression pattern of y+LAT2 was more uniform among the different cell types (Fig. 4B). Only A549/8, NT2, and U373MG cells exhibited a rather low expression level. A comparison between transporter expression and activity in the different cell lines is shown in Table 2 and Supplemental Fig. S2.


Figure 4
View larger version (14K):
[in this window]
[in a new window]

  		Fig. 4. Quantification of system y+L amino acid transporter (y+LAT)1 and y+LAT2 mRNA expression by real-time PCR. Total RNA from the indicated human cells was analyzed by qRT-PCR for y+LAT1 (A) and y+LAT2 (B) expression. hGAPDH was chosen as housekeeping gene for relative determinations. Data represent means ± SD; n = 3–6.

 

View this table:
[in this window]
[in a new window]

  		Table 2. Correlation between the expression and the transport activity of CAA transporters in the cell lines investigated

 
PMA-induced inhibition of leucine-insensitive and -sensitive arginine transport. To find out whether PKC activation has a differential effect on arginine transport in the various cell types expressing different CAA transporters, cells were treated with the PKC activating phorbol ester PMA (100 nM). Total arginine transport was reduced by PMA in all cell lines investigated (data not shown). The extent of inhibition of the leucine-insensitive (hCAT-mediated) component was similar in all cell lines investigated, independent of the hCAT isoform expressed in the respective cell type (Fig. 5A). A 30-min PMA treatment was sufficient to achieve almost maximal inhibition in all cell lines. In some cells, the inhibition was smaller at 4 h compared with 30 min, indicating reversibility of the PMA action. The PMA treatment reduced the adhesiveness of NT2 and A673 cells such that we could not perform transport studies under these conditions. In contrast to hCAT-mediated transport, the extent of inhibition of the leucine-sensitive transport varied between cell lines and did not correlate with the expression of a specific transporter (Fig. 5B). The strongest inhibition (down to ~25%) was observed in EA.hy926, HaCaT, and SK-N-MC cells, expressing both y+LAT1 and -2 at an intermediate level. A less pronounced inhibition of leucine-sensitive transport (down to 50–60%) was observed in A459/8 cells (with low expression of both y+LAT1 and -2), HUVECs (with good expression of both y+LAT1 and -2), ECV304 cells (with intermediate expression of y+LAT2 and no expression of y+LAT1), and DLD-1 cells (which express mainly y+LAT1). Finally, no significant inhibition of y+LAT-mediated transport by PMA could be observed in U373MG cells (expressing exclusively y+LAT2 at a low level). However, U373MG cells could only support a 30-min PMA treatment so that we could not determine the effect of a longer treatment on these cells. The time needed to achieve maximal inhibition of the leucine-sensitive transport was also different between the various cell lines. For example, in A549/8 and EA.hy926 cells, nearly maximal inhibition was achieved after 30 min. In contrast, in DLD-1, ECV304, and SK-N-MC cells, a 4-h PMA treatment led to a stronger inhibition than the 30-min treatment.


Figure 5
View larger version (20K):
[in this window]
[in a new window]

  		Fig. 5. PMA-induced inhibition of leucine-insensitive and leucine-sensitive arginine transport. Confluent cells seeded in 24- or 96-well plates were preincubated 0.5 h (open bars) or 4 h (black bars) in their respective cell culture medium containing 100 nM PMA and 0.1% DMSO or 0.1% DMSO alone. Leucine-insensitive transport (A) and leucine-sensitive transport (B) of 100 µM [3H]arginine was determined as described in Fig. 1. Data are expressed as percent transport rate of cells treated with DMSO alone (means ± SD; n = 15–25). #Not determined. The transport rates of untreated and DMSO-treated cells did not differ significantly.

 
PKC-dependent increase of hCAT-1 and hCAT-2B mRNA expression. PMA increased hCAT-1 mRNA in EA.hy926 cells (Fig. 6A), confirming our previous results (11). In contrast, PMA did not change hCAT-1 mRNA expression in A549/8, A673, or DLD-1 cells (data not shown). The PMA-mediated increase in hCAT-1 mRNA could be prevented by the PKC inhibitor bisindolylmaleimide I (BIM I) (Fig. 6B). In A549/8 cells, PMA increased the expression of hCAT-2B mRNA (Fig. 6C). Again, this effect was not seen in the other cell lines investigated (A673, DLD-1, and EA.hy926; data not shown).


Figure 6
View larger version (11K):
[in this window]
[in a new window]

  		Fig. 6. PKC-dependent increase of hCAT-1 mRNA expression in EA.hy926 endothelial cells and hCAT-2B mRNA expression in A549/8 lung carcinoma cells. Total RNA from EA.hy926 endothelial cells (A and B) or from A549/8 lung carcinoma cells (C) was analyzed by qRT-PCR for hCAT-1 or hCAT-2B expression, respectively. Confluent cells seeded in 6-well plates were preincubated for the indicated time with 100 nM PMA or for 5 h with 0.1% DMSO (A and C). In B, cells were first treated for 30 min with 1 µM bisindolylmaleimide I (lane with BIM I) or 0.1% DMSO alone (all other columns) and then for an additional 4 h, as indicated, with 0.2% DMSO alone, 100 nM PMA, or 100 nM PMA plus 1 µM BIM I (both in 0.2% DMSO). qRT-PCR and quantification of the hCAT mRNA were performed as described in Fig. 3. Statistical analysis was performed using analysis of variance with the Bonferroni post hoc test (data are means ± SE; n = 3–4). *P < 0.05, **P < 0.01, and ***P < 0.001 compared with DMSO control. {dagger}{dagger}P < 0.01 between cells treated with PMA only and with PMA plus BIM I.

 
Time- and concentration-dependent inhibition of arginine transport in ECV304 cells. Our experiments were so far performed with a single concentration of PMA at two different time points. To find out whether smaller PMA concentrations or shorter treatments might have different effects on arginine transport, we investigated the time- and concentration-dependent effect of PMA in ECV304 cells. These cells express only two arginine transporters, hCAT-1 (system y+) and y+LAT2 (system y+L), that could be studied individually using leucine inhibition. A time course between 5 min and 4 h revealed an earlier onset of system y+ inhibition compared with system y+L inhibition (Fig. 7A). In some experiments, inhibition of system y+ was even reduced after longer treatment periods (1–4 h). In contrast, inhibition of system y+L was only maximal after 2–4 h. We then studied the effect of PMA at different concentrations (0.3, 1, 3, 10, 30, and 100 nM) and time points (5 min, 30 min, and 4 h) but could not detect an increase in arginine transport under any of these conditions. The concentration-dependent inhibition of systems y+ and y+L at 30 min and 4 h, respectively, is shown in Fig. 7, B and C. The IC50 values for PMA were 9.2 ± 1.6 and 3.0 ± 1.4 for systems y+ and y+L, respectively.


Figure 7
View larger version (17K):
[in this window]
[in a new window]

  		Fig. 7. PKC-dependent inhibition of leucine-insensitive and leucine-sensitive arginine transport in ECV304 bladder carcinoma cells. Confluent ECV304 cells seeded in 96-well plates were cultured in DMEM. Leucine-insensitive (system y+) and leucine-sensitive (system y+L) transport of 100 µM L-[3H]arginine was determined as described in Fig. 1. A: time-dependent decrease in system y+ (squares) and system y+L (circles) transport activity in cells preincubated for the indicated times in DMEM containing 100 nM PMA. B and C: concentration-dependent inhibition of system y+ (B) and system y+L (C) transport activity by 30 and 240 min of treatment with PMA, respectively. D and E: system y+ (D) and system y+L (E) transport activity was determined in cells treated first for 15 min with 1 µM Gö6976 (columns with Gö) or 0.1% DMSO alone (all other columns) and then for an additional 30 min (D) or 240 min (E), as indicated, with 0.15% DMSO alone, 100 nM PMA, (alone or in combination with 0.5 µM Gö6976), 100 nM thymelea toxin (Thy), 100 nM 4{alpha}-phorbol-12,13-didecanoate (4{alpha}PDD), or 5 µM phosphatidylinositol-3,4,5-triphosphate-dipalmitoyl (PIP). Data are expressed as percent transport rate of cells treated with DMSO alone in the same concentration and for the same time as in the respective PMA treatment (means ± SE; n = 12–24). The transport rates of untreated and DMSO-treated cells did not differ significantly. Statistical analysis was performed using analysis of variance with the Bonferroni post hoc test. ***P < 0.001 and **P < 0.01 compared with DMSO control. {dagger}{dagger}{dagger}P < 0.001 and {dagger}{dagger}P < 0.01 between cells treated with PMA only and with PMA plus Gö.

 
Classical PKC isoforms inhibit both system y+ and y+L transporters in ECV304 cells. To classify the PKC isoform(s) responsible for inhibition of the two transport systems, we used different PKC activators and inhibitors (Fig. 7, D and E). Gö6976, a specific inhibitor of conventional PKCs, prevented inhibition of both systems by PMA. In addition, thymelea toxin, which activates preferentially classical PKC, had a similar inhibitory effect as PMA. In contrast, phosphatidylinositol-3,4,5-triphosphate-dipalmitoyl (PIP), an activator of atypical PKC, and the inactive phorbol ester 4{alpha}-phorbol-12,13-didecanoate had no effect. These data demonstrate that both system y+ and y+L transporters are downregulated by classical PKC.

PMA inhibition of y+L transporters expressed in X. laevis oocytes. To investigate the PMA effect on each isoform, y+LAT1 and -2 were expressed individually in X. laevis oocytes, together with the glycoprotein 4F2hc (CD98), which is necessary to target the transporters to the plasma membrane. A 30-min PMA treatment (100 nM) caused a pronounced inhibition of y+LAT1 and y+LAT2 by 60 and 50%, respectively (Fig. 8). In contrast, the inactive phorbol ester 4{alpha}-phorbol-12,13-didecanoate had no effect. The PMA inhibition could be prevented by the PKC inhibitor BIM I. Thus, both y+LAT isoforms are downregulated by PMA through activation of PKC.


Figure 8
View larger version (24K):
[in this window]
[in a new window]

  		Fig. 8. PKC-dependent inhibition of arginine uptake in Xenopus laevis oocytes expressing y+LAT1 or y+LAT2. X. laevis oocytes were injected with cRNA encoding 4F2hc together with y+LAT1 (A) or y+LAT2 (B) and analyzed 2 days later. Uptake of 100 µM L-[3H]arginine was measured in oocytes treated for 30 min, as indicated, with DMSO alone, 100 nM PMA (alone or in combination with 1 µM BIM, in 0.2% DMSO), or 100 nM 4{alpha}PDD. BIM I was added 5 min before PMA, and control cells were incubated in 0.2% DMSO. Data are expressed as percent transport rate of cells treated with DMSO alone (means ± SE; n = 21–33). Values obtained with water-injected oocytes (0.02 nmol·oocyte–1·h–1) were subtracted. Statistical analysis was performed using analysis of variance with the Bonferroni post hoc test. ***P < 0.001 compared with DMSO control. {dagger}{dagger}{dagger}P < 0.001 between cells treated with PMA only and with PMA plus BIM I.

 

   DISCUSSION
TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
In the present study, we have established that activation of PKC leads to a downregulation of arginine transport mediated by both system y+ and system y+L transporters in human cells. While inhibition of the first was similar in all cell lines investigated, the extent of inhibition of system y+L transporters differed considerably. Further studies will be necessary to find out if this is due to distinct mechanisms by which PMA exerts its inhibitory action on the two different classes of transporters. In respect to the system y+ transporter (hCAT), two observations from our previous work indicate that PKC does not interact directly with these proteins: first, mutation of all putative PKC phosphorylation sites in hCAT-1 does not diminish the inhibitory action of PMA, and second, PMA treatment of cells does not lead to an enhanced phosphorylation of hCAT-1 (28). PKC seems thus to act on intermediary proteins that promote a reduction of cell surface expression of the hCAT proteins when phosphorylated by PKC. This may be achieved by either increasing endocytosis or by decreasing exocytosis of membrane patches containing the transporter. The similar effects of PMA on hCAT-mediated transport in the different cell lines investigated suggest they all express these putative intermediary proteins to a similar extent. We and others (19, 29) have shown that classical PKC, most likely PKC{alpha}, is responsible for repression of hCAT-1 and hCAT-3. The wide expression of this isoform can explain the uniform inhibition of system y+. However, it needs to be noted that PKC{alpha} is also expressed in alveolar macrophages, where the most pronounced PKC-mediated increase of system y+ activity has been observed (27). PMA-induced activation of arginine transport in the macrophages is not abolished by a long period of PMA treatment, usually leading to a downregulation of PKC{alpha}. In contrast, a 24-h treatment of EA.hy926 cells with PMA leads to the degradation of PKC{alpha}. Accordingly, arginine transport recovers and is then resistant to inhibition by PMA (11). The slightly reduced system y+ inhibition in ECV304 cells observed in the present study after 1–4 h of PMA treatment also points to a reversible PMA effect. It thus seems likely that PMA-induced activation of system y+ in alveolar macrophages and its inhibition in the human cells, as observed in the present study, are mediated by different PKC isoforms. In support of this notion is the observation by Tabakman et al. (32) that, in rat alveolar macrophages, PKCbeta but not PKC{alpha} translocates to the plasma membrane in response to PMA, indicating that PMA does not activate PKC{alpha} in these cells. The extent of PMA-induced activation of arginine transport is greater in rabbit than in rat or mouse alveolar macrophages, indicating a species difference of PMA action (27). Species differences in the expression of PKC isoforms have been observed between mouse and human macrophages, with the absence of PKC{eta} in the latter being responsible for their lack of inducible nitric oxide synthase induction in response to LPS (25). Aside from variations in PKC isoform activation, there might be also differences in intermediary proteins that mediate the PKC effect. In light of these numerous possibilities, it is remarkable that all cell types investigated in our study responded uniformly to the PMA treatment with a reduction of system y+ transport, irrespective of their origin.

In contrast to EA.hy926 cells, where PMA led to an increase of hCAT-1 mRNA, PMA had no effect on hCAT-1 levels in other cell lines. A PMA-induced increase in hCAT-1 mRNA has also been observed in human B lymphocytes but not in HL60 promyelocytic cells (41). Similarly, hCAT-2B was only increased in A549/8 cells after a PMA treatment. Because the promoters of either gene have not been identified, the mechanism of this mRNA increase remains obscure. NF-{kappa}B has been shown to be essential for the induction of CAT-2B mRNA in rat alveolar macrophages (12). Thus PKC activation in A549/8 cells may induce hCAT-2B via downregulation of I{kappa}B. In addition, PKC activation may lead to an increase in the stability of preexisting mRNA. Although the increased hCAT mRNA did not lead to enhanced transport activity in our study, this might be different in other cell types or under different experimental conditions, particularly because translation of both CAT mRNAs seems to be extensively controlled (26, 40). Therefore, the increase in arginine transport reported in human umbilical vein endothelial and Caco intestinal epithelial cells after a prolonged PMA treatment (21, 22) might well be due to an increased expression of either hCAT-1 or hCAT-2 protein in these cells, which opposes the initial inhibitory action of PKC activation. Our study shows that hCAT mRNA expression is differentially regulated by PKC in different human cell lines.

In all cell types investigated, a significant portion of the arginine uptake was mediated by a leucine-sensitive transport system, represented by y+LAT1 or -2, as shown by RNA expression studies. However, under physiological conditions (at high extracellular concentrations of NAA that are substrates for system y+L and an inward-directed Na+ gradient), this transport system mediates export rather than import of CAA (2, 37). Quantifying the expression of each transporter in the individual cell lines relative to GAPDH, we found that the amount of RNA detected of either system y+ or y+L transporter in the different cell types did not necessarily correlate with the activity of the respective transport system (Table 2). The qRT-PCR protocol used in our study seems to be equivalent to the more tedious RNase protection analysis. RNA quantification between different cell lines is, of course, difficult and depends on the reference parameter used. While expression values relative to a housekeeping gene are more robust and thus ideal when comparing expression levels within a given cell type, comparison between cell lines is hampered by possible differences in the expression level of the respective housekeeping gene. With this in mind, we can still establish some discrepancies between transporter expression and activity. For example, A549/8 cells exhibited a very low expression of y+LATs despite significant system y+L activity. In contrast, DLD-1 cells had the lowest y+L activity but the highest expression of y+LATs. The relative proportion of activity and expression of the two transport systems agreed best in HaCaT, ECV, U373MG, and EA.hy926 cells, despite large differences in the absolute values of the two parameters (Table 2). Taken together, our results demonstrate that mRNA expression of either system y+ or y+L transporters does not necessarily correlate with transport activity. This may be due to translational regulation of expression, as has been described for CAT-1 and CAT-2 (13, 26, 40). Efficient trans-location of transporter protein to the plasma membrane may also play a role. Thus expression of 4F2hc may be limiting for incorporation of y+LATs in the plasma membrane.

Independent of its absolute or relative activity, system y+L was downregulated by PMA in all but one cell line. In ECV304 cells, classic PKC isoforms were responsible for the inhibitory effect of PMA on system y+L as well as system y+. The latter confirms earlier results with hCAT-1 and hCAT-3 obtained in different cell systems (19, 29). The fact that system y+L inhibition occurred to a variable degree and within a different time frame in each cell line suggests that the PMA effect is indirect and that the protein(s) that mediates this effect is differentially expressed or regulated in the cell types investigated. The activity of both y+LAT1 and y+LAT2 was also downregulated when these transporters were expressed individually in X. laevis oocytes. However, this inhibition occurred faster than in human cells. As discussed for the system y+ transporter, equipment of the cells with different PKC isoforms and/or differences in the response to PMA could also explain unequal PMA effects. Interestingly, in rat alveolar macrophages, PMA treatment leads also to an enhancement of leucine-sensitive arginine transport, indicating a fundamentally different regulation of arginine transport compared with the human cells used in our study.


   GRANTS
TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by Grants Cl-100/4-1 and Collaborative Research Center SFB-553 (Project B4) from the Deutsche Forschungsgemeinschaft, Bonn, Germany.


   FOOTNOTES
 

Address for reprint requests and other correspondence: E. I. Closs, Dept. of Pharmacology, Johannes Gutenberg Univ., Obere Zahlbacher Str. 67, 55101 Mainz, Germany (e-mail: Closs{at}uni-mainz.de)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* A. Rotmann and A. Simon contributed equally to this study. Back


   REFERENCES
TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Bode BP, Reuter N, Conroy JL, Souba WW. Protein kinase C regulates nutrient uptake and growth in hepatoma cells. Surgery 124: 260–267, 1998.[ISI][Medline]

2. Broer A, Wagner CA, Lang F, Broer S. The heterodimeric amino acid transporter 4F2hc/y+LAT2 mediates arginine efflux in exchange with glutamine. Biochem J 349: 787–795, 2000.[ISI][Medline]

3. Chairoungdua A, Kanai Y, Matsuo H, Inatomi J, Kim DK, Endou H. Identification and characterization of a novel member of the heterodimeric amino acid transporter family presumed to be associated with an unknown heavy chain. J Biol Chem 276: 49390–49399, 2001.[Abstract/Free Full Text]

4. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156–159, 1987.[ISI][Medline]

5. Closs EI, Gräf P, Habermeier A, Cunningham JM, Förstermann U. Human cationic amino acid transporters hCAT-1, hCAT-2A and hCAT-2B: three related carriers with distinct transport properties. Biochemistry 36: 6462–6468, 1997.[CrossRef][Medline]

6. Closs EI, Mann GE. Identification of carrier systems in plasma membranes of mammalian cells involved in transport of L-arginine. In: Methods in Enzymology, edited by Abelson J and Simon M. San Diego, CA: Academic, 1999, p. 78–91.

7. Closs EI, Simon A, Vékony N, Rotmann A. Plasma membrane transporters for arginine. J Nutr Rev 134: 2752–2759, 2004.

8. Deves R, Boyd CA. Transporters for cationic amino acids in animal cells: discovery, structure, and function. Physiol Rev 78: 487–545, 1998.[Abstract/Free Full Text]

9. Deves R, Chavez P, Boyd CA. Identification of a new transport system (y+L) in human erythrocytes that recognizes lysine and leucine with high affinity. J Physiol 454: 491–501, 1992.[Abstract/Free Full Text]

10. Feliubadalo L, Font M, Purroy J, Rousaud F, Estivill X, Nunes V, Golomb E, Centola M, Aksentijevich I, Kreiss Y, Goldman B, Pras M, Kastner DL, Pras E, Gasparini P, Bisceglia L, Beccia E, Gallucci M, de Sanctis L, Ponzone A, Rizzoni GF, Zelante L, Bassi MT, George AL, Manzoni M, De Grandi A, Riboni M, Endsley JK, Ballabio A, Borsani G, Reig N, Fernandez E, Estevez R, Pineda M, Torrents D, Camps M, Lloberas J, Zorzano A, Palacin M. Non-type I cystinuria caused by mutations in SLC7A9, encoding a subunit (b(o,+)AT) of rBAT. Nat Genet 23: 52–57, 1999.[ISI][Medline]

11. Gräf P, Förstermann U, Closs EI. The transport activity of the human cationic amino acid transporter hCAT-1 is downregulated by activation of protein kinase C. Br J Pharmacol 132: 1193–1200, 2001.[CrossRef][ISI][Medline]

12. Hammermann R, Dreissig MD, Mossner J, Fuhrmann M, Berrino L, Gothert M, Racke K. Nuclear factor-kappaB mediates simultaneous induction of inducible nitric-oxide synthase and Up-regulation of the cationic amino acid transporter CAT-2B in rat alveolar macrophages. Mol Pharmacol 58: 1294–1302, 2000.[ISI][Medline]

13. Hatzoglou M, James F, Yaman I, Closs E. Regulation of cationic amino acid transporters, the story of the CAT-1 transporter. Annu Rev Nutr 24: 377–399, 2004.[CrossRef][ISI][Medline]

14. Hortelano S, Genaro AM, Bosca L. Phorbol esters induce nitric oxide synthase and increase arginine influx in cultured peritoneal macrophages. FEBS Lett 320: 135–139, 1993.[CrossRef][ISI][Medline]

15. Hosokawa H, Ninomiya H, Sawamura T, Sugimoto Y, Ichikawa A, Fujiwara K, Masaki T. Neuron-specific expression of cationic amino acid transporter 3 in the adult rat brain. Brain Res 838: 158–165, 1999.[CrossRef][ISI][Medline]

16. Hosokawa H, Sawamura T, Kobayashi S, Ninomiya H, Miwa S, Masaki T. Cloning and characterization of a brain-specific cationic amino acid transporter. J Biol Chem 272: 8717–8722, 1997.[Abstract/Free Full Text]

17. Ito K, Groudine M. A new member of the cationic amino acid transporter family is preferentially expressed in adult mouse brain. J Biol Chem 272: 26780–26786, 1997.[Abstract/Free Full Text]

18. Jaffe EA, Nachman RL, Becker CG, Minick CR. Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria. J Clin Invest 52: 2745–2756, 1973.[ISI][Medline]

19. Krotova KY, Zharikov SI, Block ER. Classical isoforms of PKC as regulators of CAT-1 transporter activity in pulmonary artery endothelial cells. Am J Physiol Lung Cell Mol Physiol 284: L1037–L1044, 2003.[Abstract/Free Full Text]

20. Li HG, Oehrlein SA, Wallerath T, Ihrig-Biedert I, Wohlfart P, Ulshofer T, Jessen T, Herget T, Förstermann U, Kleinert H. Activation of protein kinase C alpha and/or epsilon enhances transcription of the human endothelial nitric oxide synthase gene. Mol Pharmacol 53: 630–637, 1998.[Abstract/Free Full Text]

21. Pan M, Stevens BR. Protein kinase C-dependent regulation of L-arginine transport activity in Caco-2 intestinal cells. Biochim Biophys Acta 4: 27–32, 1995.

22. Pan M, Wasa M, Lind DS, Gertler J, Abbott W, Souba WW. TNF-stimulated arginine transport by human vascular endothelium requires activation of protein kinase C. Ann Surg 221: 590–601, 1995.[ISI][Medline]

23. Pfeiffer R, Loffing J, Rossier G, Bauch C, Meier C, Eggermann T, Loffing-Cueni D, Kuhn LC, Verrey F. Luminal heterodimeric amino acid transporter defective in cystinuria. Mol Biol Cell 10: 4135–4147, 1999.[Abstract/Free Full Text]

24. Pfeiffer R, Rossier G, Spindler B, Meier C, Kuhn L, Verrey F. Amino acid transport of y(+)L-type by heterodimers of 4F2hc/CD98 and members of the glycoprotein-associated amino acid transporter family. EMBO J 18: 49–57, 1999.[CrossRef][ISI][Medline]

25. Pham TN, Brown BL, Dobson PR, Richardson VJ. Protein kinase C-eta (PKC-eta) is required for the development of inducible nitric oxide synthase (iNOS) positive phenotype in human monocytic cells. Nitric Oxide 9: 123–134, 2003.[CrossRef][ISI][Medline]

26. Prasanth KV, Prasanth SG, Xuan Z, Hearn S, Freier SM, Bennett CF, Zhang MQ, Spector DL. Regulating gene expression through RNA nuclear retention. Cell 123: 249–263, 2005.[CrossRef][ISI][Medline]

27. Racke K, Hey C, Mossner J, Hammermann R, Stichnote C, Wessler I. Activation of L-arginine transport by protein kinase C in rabbit, rat and mouse alveolar macrophages. J Physiol 511: 813–825, 1998.[Abstract/Free Full Text]

28. Rotmann A, Strand D, Martiné U, Closs EI. Protein kinase C activation promotes the internalization of the human cationic amino acid transporter hCAT-1: a new regulatory mechanism for hCAT-1 activity. J Biol Chem 279: 54185–54192, 2004.[Abstract/Free Full Text]

29. Rotmann A, Vekony N, Gassner D, Niegisch G, Strand D, Martine U, Closs EI. Activation of classical protein kinase C reduces the expression of human cationic amino acid transporter 3 (hCAT-3) in the plasma membrane. Biochem J 395: 117–123, 2006.[CrossRef][ISI][Medline]

30. Sampson SR, Cooper DR. Specific protein kinase C isoforms as transducers and modulators of insulin signaling. Mol Genet Metab 89: 32–47, 2006.[CrossRef][ISI][Medline]

31. Sloan JL, Mager S. Cloning and functional expression of a human Na(+) and Cl(–)-dependent neutral and cationic amino acid transporter B(0+). J Biol Chem 274: 23740–23745, 1999.[Abstract/Free Full Text]

32. Tabakman R, Lazarovici P, Matsuda Y, Brodie C, Ovadia H. Protein kinase C-independent selective induction of nitric oxide synthase activity in rat alveolar macrophages by staurosporine. Nitric Oxide 2: 250–258, 1998.[CrossRef][ISI][Medline]

33. Torrents D, Estevez R, Pineda M, Fernandez E, Lloberas J, Shi YB, Zorzano A, Palacin M. Identification and characterization of a membrane protein (y+L amino acid transporter-1) that associates with 4F2hc to encode the amino acid transport activity y+L. A candidate gene for lysinuric protein intolerance. J Biol Chem 273: 32437–32445, 1998.[Abstract/Free Full Text]

34. Van Winkle LJ, Campione AL. Development of amino acid transport system B0,+ in mouse blastocysts. Biochim Biophys Acta 925: 164–174, 1987.[Medline]

35. Van Winkle LJ, Campione AL, Gorman JM. Na(+)-independent transport of basic and zwitterionic amino acids in mouse blastocysts by a shared system and by processes which distinguish between these substrates. J Biol Chem 263: 3150–3163, 1988.[Abstract/Free Full Text]

36. Vékony N, Wolf S, Boissel JP, Gnauert K, Closs EI. Human cationic amino acid transporter hCAT-3 is preferentially expressed in peripheral tissues. Biochemistry 40: 12387–12394, 2001.[CrossRef][Medline]

37. Verrey F, Closs EI, Wagner CA, Palacin M, Endou H, Kanai Y. CATs and HATs: the SLC7 family of amino acid transporters. Pflügers Arch 447: 532–542, 2004.[CrossRef][ISI][Medline]

38. Villmann C, Bull L, Hollmann M. Kainate binding proteins possess functional ion channel domains. J Neurosci 17: 7634–7643, 1997.[Abstract/Free Full Text]

39. Wolf S, Janzen A, Vékony N, Martiné U, Strand D, Closs EI. Expression of solute carrier 7A4 (SLC7A4) in the plasma membrane is not sufficient to mediate an amino acid transport activity. Biochem J 364: 767–775, 2002.[CrossRef][ISI][Medline]

40. Yaman I, Fernandez J, Liu H, Caprara M, Komar AA, Koromilas AE, Zhou L, Snider MD, Scheuner D, Kaufman RJ, Hatzoglou M. The zipper model of translational control: a small upstream ORF is the switch that controls structural remodeling of an mRNA leader. Cell 113: 519–531, 2003.[CrossRef][ISI][Medline]

41. Yoshimoto T, Yoshimoto E, Meruelo D. Enhanced gene expression of the murine ecotropic retroviral receptor and its human homolog in proliferating cells. J Virol 66: 4377–4381, 1992.[Abstract/Free Full Text]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow All Versions of this Article:
292/6/C2259    most recent
00323.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rotmann, A.
Right arrow Articles by Closs, E. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rotmann, A.
Right arrow Articles by Closs, E. I.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.