|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RECEPTORS AND SIGNAL TRANSDUCTION
1Renal Division, Department of Internal Medicine and Department of Cell Biology and Physiology, and 2Genome Sequencing Center, Washington University School of Medicine, St. Louis, Missouri; and 3Department of Pathology, University of California-San Diego, La Jolla, California
Submitted 21 November 2005 ; accepted in final form 7 December 2006
| ABSTRACT |
|---|
|
|
|---|
aquaporin; nuclear factor of activated T cells; tonicity-responsive enhancer binding protein; osmotic response
Although the hypertonic environment within the kidney allows for reabsorption of water, it also subjects cells to a potentially lethal osmotic stress. The cellular response that permits cells of the renal medulla to adapt and survive within a hypertonic environment is mediated by the tonicity-responsive enhancer binding protein (TonEBP)/nuclear factor of activated T cells (NFAT)5 transcription factor (13). TonEBP/NFAT5 is activated in response to hypertonic stress and regulates the transcription of genes that allow for the accumulation of compatible osmolytes within the cell, thus establishing intracellular water homeostasis within a hypertonic environment. Although TonEBP/NFAT5 shares amino acid sequence similarity with the NFATc transcription factors NFATc1NFATc4, this similarity is limited to the DNA binding domain (17). NFATc proteins are a substrate for calcineurin, a calcium-regulated serine/threonine phosphatase comprised of a catalytic subunit, calcineurin A (CnA), and a regulatory subunit, calcineurin B (CnB) (22). Calcineurin regulates the nuclear localization of NFATc proteins through the calcium-dependent dephosphorylation of residues within a serine-proline-rich NFATc homology region that is not present in TonEBP/NFAT5. Thus, unlike NFATc proteins, TonEBP/NFAT5 is not subject to direct dephosphorylation by calcineurin. Previous studies suggest that TonEBP/NFAT5 is constitutively localized to the nucleus (29). Other studies, however, indicate that the nuclear localization of TonEBP/NFAT5 is highly regulated (7, 27, 33) and may involve calcineurin via a mechanism distinct from that regulating NFATc proteins (29, 33, 41, 43). The similarity between TonEBP/NFAT5 and NFATc proteins within the DNA binding domain and the resulting similarity in their consensus target DNA recognition sequences (32, 37) suggest that there could be overlap in the target genes regulated by these proteins. However, while TonEBP/NFAT5 binds to DNA as a homodimer, NFATc proteins usually require other cofactors, such as AP-1, for effective DNA binding (17).
The highly specific calcineurin inhibitors cyclosporin A (CsA) and FK506 (tacrolimus) have been utilized clinically as potent immunosuppressive agents (5). CsA and FK506 form complexes with immunophilins cyclophilin A and FK506-binding protein (FKBP)12, respectively, before binding to and inhibiting calcineurin (6, 17). These drugs exhibit significant nephrotoxicity, suggesting a critical role for calcineurin in normal renal function (1). A recent study found that long term-treatment with CsA reduced the expression of multiple AQPs by decreasing the Gs
protein level, but the involvement of calcineurin was not directly addressed (25). CsA was also found to inhibit the hypertonicity-induced upregulation of osmoprotective genes, including aldose reductase (AR) and betaine/
-amino-n-butyric acid transporter 1 (BGT1) (41). It is worth noting that AQP2 has been reported to be a substrate of calcineurin within an A kinase anchoring proteins (AKAP) complex (19). Furthermore, the expression of AQP2 is significantly decreased in mice deficient for TonEBP/NFAT5 (26). The purpose of this study was to investigate the regulation of AQP2 expression by the Ca-calcineurin-NFATc pathway and the TonEBP/NFAT5 osmotic stress response pathway. These studies not only reveal the regulation of AQP2 expression by both the Ca-calcineurin-NFATc pathway and the TonEBP/NFAT5-mediated hypertonic response pathway but also demonstrate a novel function of calcineurin-NFATc signaling in the osmotic stress response.
| MATERIALS AND METHODS |
|---|
|
|
|---|
/
) mouse embryonic fibroblasts (MEFs) (11) were cultured in DMEM (Sigma) with 10% FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin at 37°C in 5% CO2-95% air. A 600-bp DNA fragment from the mouse AQP2 proximal promoter (nucleotides 89239522, GenBank AY055468) was amplified by PCR with KpnI and BglII sites attached. The PCR products were cloned into the KpnI and BglII sites in pGL3-Basic (Promega) to generate pAQP2-WT (wild type). We further generated pAQP2-MT1, pAQP2-MT2, and pAQP2-MT3 (mutants) in which the putative NFAT sites1 were mutated by PCR-directed mutagenesis. The pTonE-Luc reporter (43) has 2 TonE sites: ACCAGCGGTAATTTTCCACCAAGCTAGCTAGCTTGGTGGAAAATTACCGCTGGT (TonE sites underlined).
Luciferase,
-galactosidase, and protein assay.
Cells were transfected (0.51 µg DNA/well) with FuGENE6 (Roche). One day after transfection, the cells were subcultured into 24-well plates. Treatments were applied 24 h later in fresh medium containing 0.2% FBS. After 6 h of treatment, the cells were harvested in Reporter Lysis Buffer (Promega) and the supernatant of cell lysate was subjected to luciferase assays (BD Bioscience). Luciferase activity was standardized by the corresponding
-galactosidase activity (
-galactosidase assay; Tropix) in most cases and by total cellular protein levels (determined by the Bradford method) when treatments were performed in samples originated from the same transfection. Data were analyzed by one- or two-way analysis of variance (ANOVA) with SAS (SAS Institute) software.
Reverse transcription-polymerase chain reaction.
Total RNA was isolated from cultured cells with an RNeasy Mini Kit (Qiagen). The primers used for reverse transcription-polymerase chain reaction (RT-PCR) were AQP2 (5'-CACATCAACCCTGCTGTGAC-3' and 5'-CAGCTGCATGGTCAGGAAGAG-3'), CnA
(5'-CAGAGGGTGCTTCGATTCTC-3' and 5'-CAAGGCCCACAAATACAGCAC-3'), CnB1 (5'-CTGCCTGAGTTACAGCAGAACC-3' and 5'-GATTGTTGCCCACCATCATC-3'), NFATc1 (5'-CACATTCTGGTCCATACGAG-3' and 5'-tgagaggttcattctccaag-3'), NFATc2 (5'-GAGTCCATCCTGCTGGTAC-3' and 5'-TGCTGTCCCAATGAAGATC-3'), NFATc3 (5'-CACGAAATGATTGTGACTGG-3' and 5'-AACTGCTGGGTTATGATAGG-3'), NFATc4 (5'-CGGCATGGATTACCTAGCAG-3' and 5'-GGCTGCCCTCAGTCTCATAG-3'), TonEBP/NFAT5 (5'-AAGACTGAAGATGTTACTCCAATGGAAG-3' and 5'-AACGTTTGTGCTTGTTCTTGTAGTGG-3'), and GAPDH (5'-CGTCCCGTAGACAAAATGGTG-3' and 5'-AGGTTTGCCGTGAGTGGAGTC-3'). Cycling conditions were 45°C for 30 min, 95°C for 5 min, and 30 cycles of 95°C for 20 s, 58°C for 35 s, and 72°C for 45 s.
Western blot and immunofluorescent staining assay.
Whole cell lysates in lysis buffer (0.3 M sucrose, 25 mM imidazole, and 1 mM EDTA, pH 7.2) containing a cocktail of protease inhibitor (Roche) and 1 mM phenylmethylsulfonyl fluoride were separated by SDS-PAGE, transferred to Immobilon-P membranes (Millipore), and probed by an anti-AQP2 antibody (Chemicon), an anti-CnA antibody (Chemicon, detecting CnA
, -
, and -
), an anti-CnB antibody (Upstate, detecting CnB1 and CnB2), an anti-NFATc1 antibody (PharMingen) or an anti-NFAT5 antibody (Santa Cruz), and an anti-
-tubulin antibody (Developmental Study Hybridoma Bank, University of Iowa), respectively. After incubation with Alexa Fluor 680-conjugated goat anti-rabbit IgG (Molecular Probes), Alexa Fluor 680-conjugated rabbit anti-goat IgG (Molecular Probes), or IRDye 800CW-conjugated goat anti-mouse IgG (Rockland) secondary antibodies, the antibody complexes were revealed by the Odyssey Infrared Imaging System (LI-COR). Immunostaining was carried out as previously described (4). The antibodies used were an anti-NFATc1 antibody (PharMingen) and an Alexa Fluor 488-conjugated goat anti-mouse IgG antibody (Molecular Probes). Nuclei were counterstained with DAPI (Sigma).
Chromatin immunoprecipitation assays.
For the chromatin immunoprecipitation (ChIP) assays, mpkCCDc14 cells were treated for 30 min, harvested, and incubated with 1% formaldehyde (final concentration) for 15 min to cross-link proteins and DNA. Cross-linking was stopped by the addition of glycine at a final concentration of 0.125 M. Cells were washed with ice-cold PBS and resuspended in 500 µl of lysis buffer (Santa Cruz) containing a cocktail of protease inhibitors (Roche). After centrifugation of the cell lysates at 3,000 rpm for 5 min, the crude nuclear extracts were collected, washed with cold PBS, and resuspended in 1 ml of high-salt lysis buffer (Santa Cruz). The nuclear extracts were sonicated on ice to break up the chromatin into fragments
500 bp long (2). Debris was removed by centrifugation for 10 min at 13,000 rpm and 4°C. Supernatants were transferred to new Eppendorf tubes. One-twentieth of each chromatin solution was kept as input controls. The rest of the chromatin solutions were precleared with 50 µl of protein A/G plus agarose (Santa Cruz) at 4°C for 30 min with agitation. Four micrograms of the mouse anti-NFATc1 monoclonal antibody (BD Bioscience) or the goat anti-NFAT5 polyclonal antibody (Santa Cruz) was added to the chromatin solution for overnight incubation at 4°C with rotation. Normal mouse IgG1 and goat IgG (Santa Cruz), respectively, were used as controls. Immunocomplexes were precipitated with 50 µl of protein A/G plus agarose for 2 h at 4°C. The pellets were washed sequentially with high-salt lysis buffer and wash buffer (Santa Cruz). The immunocomplexes were eluted with elution buffer (Santa Cruz) and reverse cross-linked at 65°C overnight. After digestion with 2 mg/ml of proteinase K for 30 min at 50°C, DNA was extracted with phenol-chloroform and precipitated by ethanol. Primers used to amplify a 366-bp region (nucleotides 89129277, GenBank AY055468) of the AQP2 promoter containing six potential NFAT binding sites were 5'-GGTGATTAACTGCAAGAAAG-3' (forward) and 5'-CATCTTAGCTTTCACAGCTGAC-3' (reverse). PCR was performed for 35 cycles (94°C for 20 s, 56°C for 35 s, and 72°C for 35 s), and the products were run on 2% agarose gels.
| RESULTS |
|---|
|
|
|---|
, and Calcineurin B1, were found to be expressed in the collecting duct epithelial cell line mpkCCDc14 as well as in the kidney (Fig. 1A and data not shown). Interestingly, inspection of the AQP2 proximal promoter sequence revealed multiple potential NFAT binding sites including a putative TonE consensus sequence (A site in Fig. 1B; Refs. 13, 42). The potential NFAT sites have the core GGAAA sequence (Fig. 1B). To investigate the potential regulation of AQP2 expression by the NFAT family of proteins, especially the NFATc proteins, we cloned a 600-bp fragment of the mouse AQP2 proximal promoter into the pGL3-basic luciferase reporter vector to generate pAQP2-WT (Fig. 1B). Transfection of pAQP2-WT into mpkCCDc14 cells demonstrated significant promoter activity (Fig. 1C).
|
500 mosmol/kgH2O) mediated by 220 mM NaCl (final NaCl concentration in medium) (Fig. 2A), indicating that the AQP2 proximal promoter contains cis elements responsive to hypertonic stress. Given the presence of several potential NFAT binding sites within the AQP2 promoter, regulation of AQP2-WT in response to pharmacological agents that induce NFATc-dependent transcription was investigated. Ionomycin, a calcium ionophore, activates calcineurin by increasing intracellular Ca2+ through the release of stored Ca2+ from the endoplasmic reticulum. Phorbol 12-myristate 13-acetate (PMA) activates AP-1, a known cofactor for NFATc proteins through its effects on PKC (17). Ionomycin plus PMA (I+P) treatment of mpkCCDc14 cells transfected with pAQP2-WT significantly induced reporter activity (Fig. 2B). Western blotting demonstrated a significant increase in the endogenous AQP2 protein level in response to hypertonic stress (Fig. 2, C and D), consistent with the observed induction of the AQP2 reporter construct (Fig. 2, A and B). In addition, the transcription of the endogenous AQP2 gene was increased under hypertonic conditions and with I+P treatment (Fig. 2, E and F). Interestingly, such an effect was significantly inhibited by the calcineurin inhibitors CsA plus FK506 (C+FK), indicating a potential involvement of calcineurin in these processes (Fig. 2, CF).
|
|
promoter (17). In parallel to the NFATc1 study, we found that promoter activity induced by the overexpression of TonEBP/NFAT5 was lost when all the putative NFAT sites were mutated (pAQP2-MT3). Interestingly, mutation of the first NFAT site (pAQP2-MT1) caused a decrease, but not a complete loss, of the induction. Furthermore, mutation of the last five sites (pAQP2-MT2) led to an even greater decrease in promoter activity induced by TonEBP/NFAT5. These results suggest that the effect of TonEBP/NFAT5 on the AQP2 promoter is not solely mediated by the A site. A possible mechanism underlying this observation is described in DISCUSSION.
|
500 mosmol/kgH2O), I+P, or both. The induction of the AQP2 promoter (pAQP2-WT) by the combined NaCl and I+P treatment is greater than those from either of the two individual treatments. This result indicates that TonEBP/NFAT5 and NFATc1 do not have completely redundant functions in AQP2 induction, because the combined treatment, in theory, would not lead to any increase above the highest level of the individual inductions if NFATc1 and TonEBP/NFAT5 have complete overlap of site usage and activity. The induction by NaCl, I+P, or both was completely lost in pAQP2-MT3 with all six sites mutated, confirming the importance of these sites in the induction of AQP2 promoter activity by hypertonicity and I+P. In addition, the mutation of site A in pAQP2-MT1 and the mutation of the last five sites in pAQP2-MT2 both reduced, but neither eliminated, the response to NaCl, I+P, and the combined stimulation (Fig. 4D). This is consistent with the observations in Fig. 4, B and C, and with the observation that the combined treatment produced a higher induction that is smaller than the sum of those from the individual treatments, most obviously in the pAQP2-WT group. If NFATc1 and TonEBP/NFAT5 do not have any overlap in site usage, the combined treatment of I+P plus NaCl could, in theory, produce an induction at the level near the sum of the individual inductions. Therefore, these results suggest that NFATc1 and TonEBP/NFAT5 have partial overlap in their binding site usage. However, these are simplistic models, and more studies are required to reveal the detailed mechanism of these events.
Hypertonicity induction of TonEBP/NFAT5 gene expression may involve calcineurin.
To investigate the mechanism by which calcineurin-NFATc and TonEBP/NFAT5 mediate the induction of AQP2, we examined the expression of the TonEBP/NFAT5, calcineurin, and NFATc genes by RT-PCR and Western blotting in mpkCCDc14 cells exposed to NaCl-induced hypertonic stress or treated with I+P. TonEBP/NFAT5 mRNA was significantly induced by both NaCl and I+P, while CnA
, CnB1, and NFATc1 mRNA levels were not affected (Fig. 5A). Interestingly, the upregulation of TonEBP/NFAT5, either by NaCl or by I+P, was significantly reduced by CsA/FK506, suggesting a role of calcineurin in the induction of TonEBP/NFAT5 mRNA in response to hypertonicity or I+P. These effects were further confirmed in the Western blot assay (Fig. 5B). The presence of putative NFAT sites in the TonEBP/NFAT5 promoter (data not shown) and the observation that CsA downregulates TonEBP/NFAT5 in the renal medulla (25) and splenocytes (11, 43) are consistent with the possible regulation of TonEBP/NFAT5 expression by calcineurin-NFATc.
|
|
|
500 bp in the ChIP assay we performed, it is not feasible to assess the binding of NFATc1 and TonEBP/NFAT5 to individual putative NFAT sites with this method. Future experiments will aim at investigating the properties of the individual candidate NFAT sites in terms of binding with NFATc and TonEBP/NFAT5, as well as the relative functional importance of these sites.
|
| DISCUSSION |
|---|
|
|
|---|
Transcriptional regulation of AQP2 by calcineurin-NFATc and TonEBP/NFAT5 can facilitate transcellular transfer of water from the apical membrane of the collecting duct epithelial cells to the medullary interstitium when interstitial osmolality rises. This regulation is likely to provide the collecting duct epithelial cells a means to react to local osmotic change independent of the systemic water and electrolyte balance. Nephrotoxicity is a major side effect of calcineurin inhibitors such as CsA and FK506 (1, 12, 34). Calcineurin inhibitor-induced nephrotoxicity is characterized by, among other pathological changes, tubular atrophy, especially in the outer and inner regions of the medulla that are typically exposed to a hypertonic environment (34). Since hypertonicity regulates the expression of multiple AQPs (18, 30, 44) and CsA treatment decreases the expression of AQP1-s4 in rat kidney (25), it is possible that calcineurin-NFATc signaling is involved in the osmotic regulation of other AQPs. Besides the AQPs, CsA treatment has been found to reduce the expression of multiple osmoprotective genes (41). Therefore, calcineurin may play a key role in water homeostasis and osmoprotection in collecting duct epithelial cells. The chronic toxicity of calcineurin inhibitors on renal tubules may partially result from the loss of a calcineurin-mediated regulatory mechanism necessary for water homeostasis and the accumulation of protective osmolytes. In fact, the calcineurin-NFATc pathway has been found to be involved in osmotic protection of lymphoid cells through the regulation of TonEBP/NFAT5 (43).
The high degree of conservation among the mammalian AQP2 promoters with regard to the putative NFAT sites especially in the first, second, and last positions (data not shown) strongly suggests the functional importance of these elements. While a previous study by Storm et al. (42) suggested that the putative TonE site in the proximal AQP2 promoter (designated the 1st binding site in this study) subjects the expression of AQP2 to osmotic control, the study by Kasono et al. (20) discounted the importance of this proximal putative TonE site and suggested that an unknown cis element for tonicity response resides in a 2-kb region located 4.3 kb upstream to the site of transcription initiation (20). A more recent study by Hasler et al. (13) demonstrated that the proximal AQP2 promoter (including the proximal putative TonE site) responds to hypertonicity. Discrepancy between these studies may result from the distinct culture systems being used and possible differences in experimental procedures. Our results support a role for the proximal AQP2 promoter in osmotic stress response and further indicate that the regulation of AQP2 expression is a complex process involving not just TonEBP/NFAT5 but also calcineurin/NFATc. Similar results were obtained in both mpkCCDc14 cells and mIMCD3 cells, suggesting that such regulation is likely common in kidney collecting duct epithelial cells of different origins (data not shown). While the importance of TonEBP/NFAT5 and calcineurin/NFATc in the hypertonic induction of AQP2 expression is indicated by previous reports and the present study, there is possible involvement of other factors in this process, especially considering the likely contributions of cofactors for NFATc and the discovery of putative osmotic responsive elements with no resemblance to the NFAT sites (20).
The observation that not only the A site but also the other five sites (BF) can mediate TonEBP/NFAT5 effects on the AQP2 proximal promoter (Fig. 4) may seem surprising at first, since only the A site has been suggested as a TonE site (13, 42). However, the examination of the DNA sequence provides clues on the possible biological basis for the other sites to mediate TonEBP/NFAT5 effects. Although the A site has the sequence TGGAAATTTGT matching the TonE consensus sequence TGGAAANNYNY proposed by Miyakawa et al. (32), it has mismatches in two nucleotides when compared against the NGGAAADNHMC consensus sequence proposed by Ferraris et al. (9, 10) (keys to degenerate nucleotides are R = A+G, M = A+C, W = A+T, K = G+T, S = G+C, Y = C+T, H = A+T+C, B = G+T+C, D = G+A+T, N = A+C+G+T, V = G+A+C). It also has two nucleotide mismatches in the sequence TGGAAAHAWDM derived from PCR clones selected by TonEBP/NFAT5 binding by Lopez-Rodriguez et al. (28). On the other hand, the corresponding sequence in the B site (TGGAAAACAAC) matches the consensus by Ferraris et al. (9, 10), and has only one nucleotide mismatch when compared against the other two proposed consensus sequences (29, 32). In addition, site C (CGGAAAGGCAG) is very similar to the first two proposed consensus sequences, with one mismatch only in each comparison, and site E (AGGAAAAAACG) is very similar to the last two proposed consensus sequences, with one mismatch only in each comparison. While confirming that the TonEBP/NFAT5 can act through the A site, these results also suggest that the other putative NFAT sites in the AQP2 proximal promoter are potential TonEs capable of mediating TonEBP/NFAT5 functions.
Comparison of NFATc and TonEBP/NFAT5 function in the mouse collecting duct cells used in this study with similar studies performed in the Jurkat lymphoid cell line (43) reveals several similarities. In both systems, TonEBP/NFAT5 activity, measured by the same pTonE-Luc reporter construct, could be induced not only by hypertonicity but also by the pharmacological agents I+P (Fig. 7A and data not shown). In addition, TonEBP/NFAT5 expression (either mRNA or protein) in both systems exhibited calcineurin dependence in the form of sensitivity to inhibition by CsA. Several known targets of calcineurin-NFATc, including IL-8 and TNF-
, have been shown to be regulated by hypertonicity, especially by the TonEBP/NFAT5-mediated osmotic stress response (27, 39, 40). Together, these observations further support the hypothesis that, similar to AQP2, other targets of the calcineurin-NFATc pathway may also be subject to regulation by the TonEBP/NFAT5 osmotic stress response and vice versa. Besides the apparent regulation of TonEBP/NFAT5 by calcium-calcineurin, this overlap in target genes between NFATc and TonEBP/NFAT5 may result from the potential overlap in binding specificity between NFATc and TonEBP/NFAT5 (9, 10, 29, 31). Furthermore, these observations also imply that changes in cellular function induced by receptor-mediated signaling events that activate the calcineurin-NFATc pathway under isotonic conditions may affect intracellular water homeostasis in a manner similar to extracellular osmotic stress (15, 16).
Contrary to the notion that TonEBP/NFAT5 is the only Rel/NFAT family member regulated by tonicity, the results presented here demonstrate that hypertonicity promotes the nuclear translocation of both calcineurin and NFATc proteins and the subsequent induction of AQP2 transcription. Calcineurin activity was also found to be involved in the induction of TonEBP/NFAT5 expression by hypertonicity, suggesting that calcineurin may play an essential role in osmotic stress responses mediated by both TonEBP/NFAT5 and NFATc proteins. The coordinate regulation of AQP2 expression by both osmotic stress and calcium signaling appears to provide a means to integrate diverse extracellular signals into optimal cellular responses. Additional studies are necessary to further define the functional specificity of NFATc proteins and TonEBP/NFAT5 under various physiological conditions, both in the presence and absence of overt extracellular osmotic stress.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
Present address for S. N. Ho: Molecular Discovery, Biogen Idec, 5200 Research Place, San Diego, CA 92122.
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 In this report, we use "NFATc site" for cis elements known to interact with NFATc1c4, "TonE" for cis elements known to interact with TonEBP/NFAT5, and "putative NFAT sites" for cis elements containing the GGAAA core sequence but not yet examined experimentally for binding specificity. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Akool el-S, Doller A, Muller R, Gutwein P, Xin C, Huwiler A, Pfeilschifter J, Eberhardt W. Nitric oxide induces TIMP-1 expression by activating the transforming growth factor beta-Smad signaling pathway. J Biol Chem 280: 3940339416, 2005.
3. Brenner B, Rector F. The Kidney. Philadelphia, PA: Saunders, 2004.
4. Chang CP, McDill BW, Neilson JR, Joist HE, Epstein JA, Crabtree GR, Chen F. Calcineurin is required in urinary tract mesenchyme for the development of the pyeloureteral peristaltic machinery. J Clin Invest 113: 10511058, 2004.[CrossRef][Web of Science][Medline]
5. Clipstone NA, Crabtree GR. Identification of calcineurin as a key signalling enzyme in T-lymphocyte activation. Nature 357: 695697, 1992.[CrossRef][Medline]
6. Crabtree GR, Olson EN. NFAT signaling: choreographing the social lives of cells. Cell 109, Suppl: S67S79, 2002.[CrossRef][Web of Science][Medline]
7. Dahl SC, Handler JS, Kwon HM. Hypertonicity-induced phosphorylation and nuclear localization of the transcription factor TonEBP. Am J Physiol Cell Physiol 280: C248C253, 2001.
8. Dascalu A, Matithyou A, Oron Y, Korenstein R. A hyperosmotic stimulus elevates intracellular calcium and inhibits proliferation of a human keratinocyte cell line. J Invest Dermatol 115: 714718, 2000.[CrossRef][Web of Science][Medline]
9. Ferraris JD, Garcia-Perez A. Osmotically responsive genes: the mammalian osmotic response element (ORE). Am Zool 41: 734742, 2001.[CrossRef][Web of Science]
10. Ferraris JD, Williams CK, Ohtaka A, Garcia-Perez A. Functional consensus for mammalian osmotic response elements. Am J Physiol Cell Physiol 276: C667C673, 1999.
11. Go WY, Liu X, Roti MA, Liu F, Ho SN. NFAT5/TonEBP mutant mice define osmotic stress as a critical feature of the lymphoid microenvironment. Proc Natl Acad Sci USA 101: 1067310678, 2004.
12. Grinyo JM, Cruzado JM. Cyclosporine nephrotoxicity. Transplant Proc 36: 240S242S, 2004.[CrossRef][Web of Science][Medline]
13. Hasler U, Jeon US, Kim JA, Mordasini D, Kwon HM, Feraille E, Martin PY. Tonicity-responsive enhancer binding protein is an essential regulator of aquaporin-2 expression in renal collecting duct principal cells. J Am Soc Nephrol 17: 15211531, 2006.
14. Hasler U, Vinciguerra M, Vandewalle A, Martin PY, Feraille E. Dual effects of hypertonicity on aquaporin-2 expression in cultured renal collecting duct principal cells. J Am Soc Nephrol 16: 15711582, 2005.
15. Ho SN. Intracellular water homeostasis and the mammalian cellular osmotic stress response. J Cell Physiol 206: 915, 2005.[Web of Science]
16. Ho SN. The role of NFAT5/TonEBP in establishing an optimal intracellular environment. Arch Biochem Biophys 413: 151157, 2003.[CrossRef][Web of Science][Medline]
17. Hogan PG, Chen L, Nardone J, Rao A. Transcriptional regulation by calcium, calcineurin, and NFAT. Genes Dev 17: 22052232, 2003.
18. Jenq W, Mathieson IM, Ihara W, Ramirez G. Aquaporin-1: an osmoinducible water channel in cultured mIMCD-3 cells. Biochem Biophys Res Commun 245: 804809, 1998.[CrossRef][Web of Science][Medline]
19. Jo I, Ward DT, Baum MA, Scott JD, Coghlan VM, Hammond TG, Harris HW. AQP2 is a substrate for endogenous PP2B activity within an inner medullary AKAP-signaling complex. Am J Physiol Renal Physiol 281: F958F965, 2001.
20. Kasono K, Saito T, Saito T, Tamemoto H, Yanagidate C, Uchida S, Kawakami M, Sasaki S, Ishikawa SE. Hypertonicity regulates the aquaporin-2 promoter independently of arginine vasopressin. Nephrol Dial Transplant 20: 509515, 2005.
21. King LS, Kozono D, Agre P. From structure to disease: the evolving tale of aquaporin biology. Nat Rev Mol Cell Biol 5: 687698, 2004.[CrossRef][Web of Science][Medline]
22. Klee CB, Ren H, Wang X. Regulation of the calmodulin-stimulated protein phosphatase, calcineurin. J Biol Chem 273: 1336713370, 1998.
23. Knoers NV, Deen PM. Molecular and cellular defects in nephrogenic diabetes insipidus. Pediatr Nephrol 16: 11461152, 2001.[CrossRef][Web of Science][Medline]
24. Krumschnabel G, Gstir R, Manzl C, Prem C, Pafundo D, Schwarzbaum PJ. Metabolic and ionic responses of trout hepatocytes to anisosmotic exposure. J Exp Biol 206: 17991808, 2003.
25. Lim SW, Li C, Sun BK, Han KH, Kim WY, Oh YW, Lee JU, Kador PF, Knepper MA, Sands JM, Kim J, Yang CW. Long-term treatment with cyclosporine decreases aquaporins and urea transporters in the rat kidney. Am J Physiol Renal Physiol 287: F139F151, 2004.
26. Lopez-Rodriguez C, Antos CL, Shelton JM, Richardson JA, Lin F, Novobrantseva TI, Bronson RT, Igarashi P, Rao A, Olson EN. Loss of NFAT5 results in renal atrophy and lack of tonicity-responsive gene expression. Proc Natl Acad Sci USA 101: 23922397, 2004.
27. Lopez-Rodriguez C, Aramburu J, Jin L, Rakeman AS, Michino M, Rao A. Bridging the NFAT and NF-kappaB families: NFAT5 dimerization regulates cytokine gene transcription in response to osmotic stress. Immunity 15: 4758, 2001.[CrossRef][Web of Science][Medline]
28. Lopez-Rodriguez C, Aramburu J, Rakeman AS, Copeland NG, Gilbert DJ, Thomas S, Disteche C, Jenkins NA, Rao A. NF-AT5: the NF-AT family of transcription factors expands in a new direction. Cold Spring Harb Symp Quant Biol 64: 517526, 1999.[CrossRef][Web of Science][Medline]
29. Lopez-Rodriguez C, Aramburu J, Rakeman AS, Rao A. NFAT5, a constitutively nuclear NFAT protein that does not cooperate with Fos and Jun. Proc Natl Acad Sci USA 96: 72147219, 1999.
30. Matsuzaki T, Suzuki T, Takata K. Hypertonicity-induced expression of aquaporin 3 in MDCK cells. Am J Physiol Cell Physiol 281: C55C63, 2001.
31. Miyakawa H, Rim JS, Handler JS, Kwon HM. Identification of the second tonicity-responsive enhancer for the betaine transporter (BGT1) gene. Biochim Biophys Acta 1446: 359364, 1999.[Medline]
32. Miyakawa H, Woo SK, Chen CP, Dahl SC, Handler JS, Kwon HM. Cis- and trans-acting factors regulating transcription of the BGT1 gene in response to hypertonicity. Am J Physiol Renal Physiol 274: F753F761, 1998.
33. Miyakawa H, Woo SK, Dahl SC, Handler JS, Kwon HM. Tonicity-responsive enhancer binding protein, a rel-like protein that stimulates transcription in response to hypertonicity. Proc Natl Acad Sci USA 96: 25382542, 1999.
34. Myers BD, Ross J, Newton L, Luetscher J, Perlroth M. Cyclosporine-associated chronic nephropathy. N Engl J Med 311: 699705, 1984.[Abstract]
35. Nielsen S, Frokiaer J, Marples D, Kwon TH, Agre P, Knepper MA. Aquaporins in the kidney: from molecules to medicine. Physiol Rev 82: 205244, 2002.
36. Paemeleire K, de Hemptinne A, Leybaert L. Chemically, mechanically, and hyperosmolarity-induced calcium responses of rat cortical capillary endothelial cells in culture. Exp Brain Res 126: 473481, 1999.[CrossRef][Web of Science][Medline]
37. Rao A, Luo C, Hogan PG. Transcription factors of the NFAT family: regulation and function. Annu Rev Immunol 15: 707747, 1997.[CrossRef][Web of Science][Medline]
38. Sanchez JC, Wilkins RJ. Changes in intracellular calcium concentration in response to hypertonicity in bovine articular chondrocytes. Comp Biochem Physiol A 137: 173182, 2004.[CrossRef][Medline]
39. Shapiro L, Dinarello CA. Hyperosmotic stress as a stimulant for proinflammatory cytokine production. Exp Cell Res 231: 354362, 1997.[CrossRef][Web of Science][Medline]
40. Shapiro L, Dinarello CA. Osmotic regulation of cytokine synthesis in vitro. Proc Natl Acad Sci USA 92: 1223012234, 1995.
41. Sheikh-Hamad D, Nadkarni V, Choi YJ, Truong LD, Wideman C, Hodjati R, Gabbay KH. Cyclosporine A inhibits the adaptive responses to hypertonicity: a potential mechanism of nephrotoxicity. J Am Soc Nephrol 12: 27322741, 2001.
42. Storm R, Klussmann E, Geelhaar A, Rosenthal W, Maric K. Osmolality and solute composition are strong regulators of AQP2 expression in renal principal cells. Am J Physiol Renal Physiol 284: F189F198, 2003.
43. Trama J, Lu Q, Hawley RG, Ho SN. The NFAT-related protein NFATL1 (TonEBP/NFAT5) is induced upon T cell activation in a calcineurin-dependent manner. J Immunol 165: 48844894, 2000.
44. Umenishi F, Yoshihara S, Narikiyo T, Schrier RW. Modulation of hypertonicity-induced aquaporin-1 by sodium chloride, urea, betaine, and heat shock in murine renal medullary cells. J Am Soc Nephrol 16: 600607, 2005.
45. Vandewalle A. Immortalized renal proximal and collecting duct cell lines derived from transgenic mice harboring L-type pyruvate kinase promoters as tools for pharmacological and toxicological studies. Cell Biol Toxicol 18: 321328, 2002.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
N. Mohebbi, M. Mihailova, and C. A. Wagner The calcineurin inhibitor FK506 (tacrolimus) is associated with transient metabolic acidosis and altered expression of renal acid-base transport proteins Am J Physiol Renal Physiol, August 1, 2009; 297(2): F499 - F509. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Hasler, V. Leroy, P.-Y. Martin, and E. Feraille Aquaporin-2 abundance in the renal collecting duct: new insights from cultured cell models Am J Physiol Renal Physiol, July 1, 2009; 297(1): F10 - F18. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Hasler Controlled aquaporin-2 expression in the hypertonic environment Am J Physiol Cell Physiol, April 1, 2009; 296(4): C641 - C653. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Saito, T. Saito, K. Kasono, H. Tamemoto, M. Kawakami, S. Sasaki, and S.-e Ishikawa Hypotonicity reduces the activity of murine aquaporin-2 promoter induced by dibutyryl cAMP Exp Physiol, October 1, 2008; 93(10): 1147 - 1156. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Hasler Interplay between TonEBP and calcineurin-NFATc signaling pathways: a means of optimizing water reabsorption? Focus on "Calcineurin-NFATc signaling pathway regulates AQP2 expression in response to calcium signals and osmotic stress" Am J Physiol Cell Physiol, May 1, 2007; 292(5): C1581 - C1582. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |