|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RECEPTORS AND SIGNAL TRANSDUCTION

1Will Rogers Institute Pulmonary Research Center, Division of Pulmonary and Critical Care Medicine, Department of Medicine, Keck School of Medicine; 2Department of Molecular Pharmacology and Toxicology, School of Pharmacy; and 3Department of Pediatrics, Keck School of Medicine, University of Southern California, Los Angeles, California
Submitted 14 February 2006 ; accepted in final form 13 November 2006
| ABSTRACT |
|---|
|
|
|---|
(HIF-1
) by hypertonicity, which was confirmed by quantitative RT-PCR. Cotransfections of AQP5-luciferase with HIF-1
and HIF-1
expression plasmids in MLE-15 cells led to dose-dependent transcriptional enhancement, which was partially abrogated by mutagenesis of putative HIF-1
binding sites in the proximal AQP5 promoter. Importantly, hypertonic induction of AQP5 was significantly inhibited by preventing HIF-1
induction with small interfering RNA. Hypertonicity induced activation of a transiently transfected vascular endothelial growth factor (VEGF) hypoxia response element-driven luciferase construct and increased expression of endogenous VEGF. These results demonstrate that hypertonic induction of both AQP5 and VEGF is transcriptionally regulated and mediated, at least in part, by HIF-1
, suggesting a novel role for HIF-1
in modulating cellular adaptive responses to osmotic stress. osmotic regulation; alveolar epithelium; lung; water channels
Several members of the aquaporin family have been shown to be regulated in the context of an osmotic gradient at both transcriptional and posttranscriptional levels (15, 18, 22, 37, 42). AQP1 is induced by hypertonic stress, accompanied by activation of extracellular signal-related kinase (ERK), p38 kinase and c-Jun NH2-terminal kinase (JNK) (40). Transcriptional activation of the AQP1 promoter is attenuated by inhibitors of these pathways, suggesting a role for the hypertonicity response element in the AQP1 promoter in hypertonicity-induced AQP1 expression (41). AQP2, AQP3, AQP4, and AQP9 have also been shown to be upregulated by hyperosmolarity (1, 24, 36). The promoters of both AQP4 and AQP9 are regulated by hypertonicity, although the precise hypertonicity response element in these promoters has not been identified and appears to differ from that in the AQP1 promoter (1). Upregulation of AQP5 by osmotic stress has been reported in a mouse lung epithelial (MLE-15) cell line and in hyperosmolar rats, suggesting possible roles for AQP5 in regulating alveolar surface liquid tonicity and/or maintaining cell volume (17). Effects of hypertonic stress on AQP5 expression in MLE-15 cells were shown to be mediated via an ERK-dependent pathway. Increases in AQP5 were gradual, with levels of AQP5 mRNA and protein peaking at 12 and 24 h, respectively. AQP5 mRNA and protein both increased without a change in mRNA stability, consistent with transcriptional activation of AQP5. However, a 1.5-kb AQP5 proximal promoter/enhancer could not be activated by hypertonicity in transient transfection assays.
Isolated rat AT2 cells in primary culture lose their characteristic phenotypic hallmarks, such as lamellar bodies and production of surfactant-associated proteins, and change morphologically to resemble AT1 cells (10). Concurrently, they gradually express phenotypic markers characteristic of AT1 cells in situ, including expression of AQP5, suggesting that AT2 cells in primary culture transdifferentiate toward an AT1 cell-like phenotype in vitro (4, 6). When grown on semipermeable supports, AEC form polarized high-resistance monolayers and exhibit active sodium transport, reflecting properties of the alveolar epithelium in vivo (7). AT2 cells in primary culture therefore constitute a well-characterized model with which to investigate functional properties of the alveolar epithelium.
Hypoxia-inducible factor-1 (HIF-1) is a transcription factor that mediates adaptive responses to changes in tissue oxygenation. It regulates the transcription of numerous genes involved in vascular development, glucose and energy metabolism, iron metabolism, and cell proliferation and viability. HIF-1 is a basic helix-loop-helix transcription factor that is composed of two subunits, HIF-1
and HIF-1
(30). HIF-1
is constitutively expressed, whereas the level of HIF-1
is subjected to regulation by hypoxia and iron chelators. In addition, we and others (5, 39) have shown that HIF-1 is activated in response to stimulation of signaling pathways or treatment with growth factors, leading to induction of several genes under normoxia, including vascular endothelial growth factor (VEGF).
In this report, we utilized AEC in primary culture in conjunction with a previously cloned 4.5-kb fragment of the rat AQP5 promoter/enhancer (3) to investigate molecular mechanisms governing transcriptional regulation in response to hypertonic stress. In searching for transcription factor(s) that mediate hypertonic induction of AQP5 in both primary rat AEC and MLE-15 cells, HIF-1
has been identified as a transcription factor that is induced to activate transcription of AQP5 and VEGF by hypertonicity. These findings suggest that HIF-1
plays a novel role in governing cellular responses to hypertonic stress and that signaling pathways regulating hypoxic response may overlap, at least in part, with those activated during hyperosmotic stress.
| METHODS |
|---|
|
|
|---|
125150 g) by disaggregation with elastase (2.02.5 U/ml; Worthington Biochemical, Freehold, NJ), followed by differential adherence on IgG-coated bacteriological plates. All animals were treated in accordance with the guidelines and approval of the University of Southern California Institutional Animal Care and Use Committee. Freshly isolated AT2 cells were plated in minimal defined serum-free medium (MDSF) consisting of Dulbecco's modified Eagle's medium and Ham's F-12 nutrient mixture in a 1:1 ratio, supplemented with 1.25 mg/ml bovine serum albumin, 10 mM HEPES, 0.1 mM nonessential amino acids, 2.0 mM glutamine, 100 U/ml sodium penicillin G, and 100 µg/ml streptomycin. Cells were seeded onto tissue culture-treated polycarbonate filter cups (Nuclepore, Corning-Costar, Corning, NY; 0.4 µm) at a density of 1.0 x 106 cells/cm2 and grown to confluence for RNA and protein analyses, or on Primaria plates (Becton Dickinson, Franklin Lakes, NJ) for lentivirus transduction. Media were changed on the second day after plating and every other day thereafter. Cultures were maintained in a humidified 5% CO2 incubator at 37°C. AT2 cell purity (>90%) was assessed by staining freshly isolated cells with tannic acid or an antibody (Ab) to a lamellar membrane protein, p180 (Covance Research, Berkeley, CA), followed by immunofluorescence visualization. Cell viability (>95%) was measured by trypan blue dye exclusion.
Maintenance of cell lines.
MLE-15 cells (J. Whitsett, University of Cincinnati) were cultivated on 35 mm culture dishes (Becton Dickinson) in HITES medium (RPMI 1640; Invitrogen, Carlson, CA) supplemented with 10 nM hydrocortisone, 5 µg/ml insulin, 5 µg/ml human transferrin, 10 nM
-estradiol, 5 µg/ml selenium, 2 mM L-glutamine, 10 mM HEPES, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2% FBS. 293T human kidney cells were grown in Dulbecco's modified Eagle's medium (Sigma, St. Louis, MO) supplemented with 4 mM L-glutamine, 10% FBS, and 200 U/ml penicillin.
Exposure of primary AEC to hypertonicity. Beginning on day 6 in culture, medium was made hypertonic by adding 200 mM sorbitol to MDSF. Sorbitol was selected to induce hypertonic stress based on a previous study demonstrating that AQP5 protein expression was only increased by relatively impermeable solutes such as sorbitol and sucrose (17). Cells were harvested for evaluation of AQP5 mRNA and protein levels by Northern and Western blot analysis, respectively, at intervals up to 24 h. To determine the effects of hypertonicity on mRNA stability, AEC treated with sorbitol on day 6 were exposed to actinomycin D (1 µg/ml) and RNA was harvested at intervals up to 18 h for Northern blot analysis.
Northern blot analysis. Total RNA was harvested according to the method of Chomczynski and Sacchi (9). Briefly, AEC monolayers were washed with cold phosphate-buffered saline (PBS; pH 7.2) and lysed in working D solution (4 M guanidinium thiocyanate, 7.2 mM sodium citrate, 0.5% sarkosyl, and freshly added 0.72% 2-mercaptoethanol). RNA was extracted with phenol/chloroform and precipitated with isopropanol twice. RNA (10 µg) was fractionated by denaturing agarose gel electrophoresis and transferred onto Hybond-N+ membranes (Amersham, Piscataway, NJ). Membranes were hybridized with a 1.2-kb AQP5 cDNA probe labeled with [32P]dCTP [Random Prime DNA Labeling Kit (Roche, Indianapolis, IN)]. Signal intensity was normalized to 18S rRNA. AQP5 and 18S rRNA levels were quantified by exposure to a phosphor screen, scanned using a Storm 840 PhosphorImager (Amersham), and analyzed using ImageQuant software (Amersham).
Western blot analysis.
Protein was extracted from AEC monolayers in 2% SDS lysis buffer (62.5 mM Tris·HCl, 2% SDS, and 10% glycerol) and lysates were cleared by centrifugation (30 min, 9,500 rpm, 4°C). Samples (1020 µg) were separated by SDS-PAGE (12.5%) and transferred to Immobilon-P membranes (Millipore, Bedford, MA). Membranes were blocked in 5% nonfat milk solution overnight at 4°C and incubated with an anti-AQP5 polyclonal antibody (Chemicon, Temecula, CA) at a dilution of 1:1,000 in 20 mM Tris·HCl, pH 7.5, 500 mM NaCl, and 0.1% Tween 20 for 2 h at room temperature. After being washed, membranes were incubated with peroxidase-labeled anti-rabbit secondary Ab diluted 1:1,000 (Promega, Madison, WI) for 1 h. Complexes were visualized using enhanced chemiluminescence (ECL; Amersham) according to the manufacturer's protocol. To ensure equal loading, protein was normalized to eukaryotic initiation factor 2
(eIF2
) using a rabbit anti-eIF2
polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Signal intensity was quantified using the Fluorchem Imaging System (Alpha Innotech, San Leandro, CA).
Production of lentivirus in 293T cells.
A 4.5-kb rat AQP5 promoter fragment was cloned into the lentivirus backbone vector (L. Naldini, Turin, Italy) pRRL.hCMV.Sin.GFP after removal of the CMV promoter. The green fluorescent protein reporter gene was replaced by a luciferase reporter gene from pGL3-Basic (Promega) to create pRRL.AQP5.Sin.Luc. Infectious lentivirus was created by cotransfection of pRRL.AQP5.Sin.Luc plasmid with p
8.7 and pMD.G into human 293T cells. The infection cocktail (500 µl), consisting of 10 µg pRRL.AQP5.Sin.Luc plasmid, 10 µg pCMV
R8.91, 6 µg pMD.G, 63 µl 2 M CaCl2, and H2O, was mixed with 500 µl warm HBS (8.18% NaCl, 5.9% HEPES, and 0.2% Na2HPO4; pH 7.2), added dropwise to 293T cells plated on 10 cm culture dishes and incubated at 37°C overnight. The virus was harvested after 48 h, filtered through 0.45 µm filters, and concentrated through a centrifugal concentrator (300 kDa cutoff; Pall Life Science, Ann Arbor, MI) and stored at 80°C.
Lentivirus transduction of MLE-15 cells and primary AEC.
One day before infection, MLE-15 cells were trypsinized, counted, and plated at 5 x 105 cells per 60 mm culture dish. On the day of infection, 300 µl of thawed AQP5-luciferase (AQP5-Luc) virus stock, 1.5 ml of HITES medium and polybrene (final concentration 6 µg/ml) were mixed and added to the cells after removal of culture medium. Cells were incubated at 37°C overnight and changed into HITES media the following day. After 48 h, virus-infected MLE-15 cells were split into 24-well plates and seeded at 105 cells/well. After reaching
80% confluence, cells were exposed to hypertonic sorbitol solution in RPMI medium containing 0.05% FBS for periods of 12, 24, and 36 h. Control cells were incubated in RPMI medium containing 0.05% FBS. Cells were harvested by the addition of passive lysis buffer (Promega) and shaking at room temperature for 15 min, followed by one freeze/thaw cycle. Luciferase activity was measured using a commercially available kit (Promega) and normalized to total protein measured by the Bio-Rad protein assay kit (Bio-Rad, Hercules, CA).
For transduction of AEC, 106 AT2 cells were plated in each well of a 24-well Primaria plate. On day 3, after being washed twice with MDSF, cells were incubated at 37°C overnight with 100 µl AQP5-Luc virus stock, 100 µl MDSF and polybrene (final concentration 6 µg/ml). The following day, virus was removed and MDSF was added to a total volume of 1 ml per well. On day 5, hypertonic induction and analysis of luciferase activity were performed as described above at intervals up to 36 h.
Preparation of nuclear extracts. AEC were washed with PBS (pH 7.2) and scraped with a cell scraper in PBS. After centrifugation, pellets (from 10 wells) were resuspended in 1 ml hypotonic buffer (10 mM HEPES, pH 7.5, 10 mM KCl, 3 mM MgCl2, 0.05% Nonidet P-40, 1 mM EDTA, pH 8.0, 10 mM NaF, and 0.1 mM Na3VO4) supplemented with protein inhibitor cocktail set III (5 µl/ml, Calbiochem, San Diego, CA) and incubated on ice for 20 min, followed by vortexing for 10 s and centrifugation at 500 g for 10 min at 4°C. Nuclear pellets were washed twice with hypotonic buffer and lysed in 200 µl lysis buffer [100 mM HEPES (pH 7.5), 0.5 M KCl, 5 mM MgCl2, 28% glycerol, and protein inhibitor cocktail set III (5 µl/ml)] for 30 min on ice with shaking. After centrifugation at 20,000 g for 30 min to remove debris, the nuclear extracts were stored at 80°C.
Hybridization of nuclear extracts from AEC with TranSignal protein/DNA array. AT2 cells were plated on 6-well plates (2 x 106 cells per well). From day 6, cells were exposed to hypertonic sorbitol solution and nuclear extracts harvested at 4 and 24 h following initiation of sorbitol exposure. Hybridization to the DNA array was carried out according to the manufacturer's protocol (Panomics, Redwood City, CA). Briefly, 10 µg of nuclear extract from AEC in MDSF ± sorbitol were incubated with the TranSignal probe (version II) for 30 min at 15°C, followed by agarose gel electrophoresis for 20 min in x0.5 TBE (44.5 mM Tris base, 44.5 mM boric acid, and 1 mM EDTA at pH 8.0) buffer. The gel area containing the protein/DNA complex was excised. Probe in the complexes was extracted with gel extract beads and hybridized to the TranSignal array. Signal was detected with an HRP-based chemiluminescence detection system and analyzed using a FluorChem Imager (Alpha Innotech).
Preparation of AQP5 and HIF-1 plasmids and transient transfection assays.
The 1716-bp rat AQP5-luciferase reporter plasmid was previously generated in pGL2-Basic (3). HIF-1
and HIF-1
expression plasmids, pCEM4/HIF-1
and pBM5/Neo/D241, were prepared. For transient transfections, MLE-15 cells were seeded at a density of 6 x 104 cells per well in 24-well plates the day before transfection. The following day, cells were transfected using SuperFect reagent (Qiagen, Valencia, CA). The 1716-AQP5-luciferase reporter construct (0.75 µg) was co-transfected with increasing amounts of HIF-1
and HIF-1
expression plasmids in equal ratios or corresponding empty expression vectors and incubated with 6 µl SuperFect reagent for 10 min at room temperature. Cells were harvested 48 h after transfection, and firefly luciferase activity was determined with the Dual-Luciferase reporter assay system (Promega). Firefly luciferase was normalized to Renilla luciferase activity.
Mutation of HIF-1 binding sites by site-directed mutagenesis.
Two putative HIF-1
consensus binding sites were identified in the proximal AQP5 promoter between 419/414 and 330/326. Before mutants were generated out of these two sites, a 483-bp fragment of AQP5 spanning from 2 to 484 was generated from the 1716-bp construct by PCR using the forward primer 5'-CGGGTACCACTTCCAGAGCTCTGTGGGAG-3' and reverse primer 5'-GCAAGCTTGTGGCCTTGGGGGCCCGGTG-3', which have KpnI and HindIII sites at each 5' end, respectively. The PCR product was first cloned into TOPO cloning vector (Invitrogen), sequenced, and cloned into pGL2-Basic. The two HIF-1
binding sites were mutated using the Quik Change II Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA), changing the core motifs from 419 to 414 (site 1) and from 330 to 326 (site 2). Primers 5'-GGGAGTCCCGCACGCTTTTCGGCCAGGAGGGCG-3' and 5'-CGCCCTCCTGGCCGAAAAGCGTGCGGGACTCCG-3' were used to mutate site 1 and primers 5'-GCCGCGTGGGTCAAAAGGCCCGGGCGGGTCC-3' and 5'-GGACCCGCCCGGGCCTTTTGACCCACGCGGC-3' were used to mutate site 2 (mutations are underlined). Clones were sequenced to verify mutations. Transcriptional activity was assessed in transient transfection assays in MLE-15 cells following cotransfection of HIF-1
and HIF-1
expression plasmids in equal ratios or corresponding empty expression vectors and compared with activity of wild-type 484-AQP5-luciferase.
Response of VEGF HRE to hypertonicity. To determine whether hypertonic stress regulates hypoxia-responsive genes via the HIF-1 pathway, MLE-15 cells were transiently transfected with a wild-type VEGF hypoxia response element (HRE) linked to a luciferase reporter (WT HRE-luc) or mutant HRE-luc (MT HRE-luc) construct. After exposure to hypertonic sorbitol solution for an additional 24 h, cells were harvested for assay of luciferase activity. Control cells were incubated in RPMI medium containing 0.05% FBS.
Effect of hypertonicity on mRNA expression in AEC by quantitative RT-PCR.
RNA was harvested from primary AEC or MLE-15 cells exposed to hypertonic sorbitol solution for 24 h. Samples were pretreated with a DNA-free kit (Ambion, Austin, TX) for removal of contaminating DNA. cDNA was synthesized with Superscript II (Invitrogen) using a mixture of random hexamer and oligo-dT primers in a ratio of 1:10. PCR primers used for amplification of VEGF, HIF-1
, AQP5 and 18S are as follows: VEGF forward 5'-GTCCAATTGAGACCCTGGTG-3' and reverse 5'-CTATGTGCTGGCTTTGGTGA-3'; HIF-1
forward 5'-gcgacaccatcatctctctggatt-3'' and reverse 5'-gggcatggtaaaagaaagtcccagt-3'; AQP5 forward 5'- CGCTCAGCAACAACACAACACC-3' and reverse 5'- GACCGACAAGCCAATGGATAAG -3'; 18S forward 5'-CTTTGGTCGCTCGCTCCTC-3' and reverse 5'-CTGACCGGGTTGGTTTTGAT-3'. The amplification protocol was set as follows: 95°C denaturation for 3 min, followed by 40 cycles of 10-s denaturation at 95°C, 45 s annealing/extension and data collection at 55°C. Real-time quantitation was carried out with the iCycler iQ Real-Time PCR Detection System (Bio-Rad). Melt-curve analysis was performed immediately after each amplification protocol to ensure specificity of the chosen primer pairs and absence of primer-dimers. Relative expression of VEGF, AQP5, and HIF-1
was calculated according to the comparative method using the formula 2
CT[
CT =
CT(sample)
CT(calibrator)] to calculate the normalized target gene expression level in the sample. In this experiment,
CT(sample) = CTsorbitol CT18S;
CT(calibrator) = CTcontrol CT18S.
Transfection of MLE-15 cells with HIF-1
small interfering RNA.
MLE-15 cells were seeded at a density of 6 x 104 cells per well in 24-well plates. Cells were transfected with 75 pmol of duplex small interfering (si)RNA targeting bases 146164 (5'-UGUGAGCUCACAUCUUGAUDdTdT-3') of mouse HIF-1
(Dharmacon, Chicago, IL) or a control siRNA (Silencer Negative control no. 1 siRNA; Ambion) using Targefect-siRNA transfection kit (Targeting Systems, Santee, CA). siRNA was applied to cells at both 24 and 48 h after seeding. At 5 h after the second transfection, cells were exposed to hypertonic sorbitol solution containing 0.05% FBS. Control cells were maintained in RPMI medium containing 0.05% FBS. RNA and protein were harvested after 24 h of sorbitol treatment for quantitation of HIF-1
mRNA and AQP5 mRNA and protein by quantitative RT-PCR and Western blotting.
Statistical analysis. Data are shown as means ± SE; n is the number of observations. We used z-tests to determine whether the ratiometric data (i.e., normalized against control) are different from control. When appropriate, two-tailed Student's t-tests were used to determine the significance of differences between two group means. For all other data, we performed one-way ANOVA, followed by post hoc comparisons of group means using the Student-Newman-Keuls procedure. P < 0.05 was considered significant.
| RESULTS |
|---|
|
|
|---|
|
|
2-fold increase in luciferase activity in MLE-15 cells after 12 h, with further increases up to 36 h. Transduction of primary AEC with pRRL.AQP5.Sin.Luc on day 3, followed by treatment with sorbitol from day 5, showed an
2.5-fold increase in luciferase activity, which was sustained for 24 h but declined to basal levels after 36 h (Fig. 4B).
|
|
consensus binding sites were identified in the proximal AQP5 promoter, we chose to further characterize interactions of HIF-1 with the AQP5 promoter to elucidate the transcriptional mechanisms mediating responses of AQP5 gene transcription to osmotic stress.
|
and HIF-1
expression plasmids, pCEM4/HIF and pBM5/Neo/D241, demonstrated transcriptional activation of AQP5 by HIF-1 with concentration-dependent increases in luciferase activity (Fig. 6). Transcriptional activation of 1716-AQP5-Luc and 484-AQP5-Luc by HIF-1
and HIF-1
did not differ significantly (Fig. 7A), suggesting that the elements responsible for activation of AQP5 by HIF-1 are encompassed by the proximal promoter region, which contains two putative HIF-1 binding sites (Fig. 7B). Transcriptional activation was decreased by 53 ± 8 and 51 ± 8% following transient transfection of HIF-1
and HIF-1
expression plasmids with constructs mutated at either putative HIF-1 binding site 1 or 2, respectively, compared with the parental 484-AQP5-Luc construct (Fig. 7C). However, even when both HIF-1 binding sites were mutated, there was no further reduction in luciferase activity, suggesting the presence of additional cryptic binding sites within the proximal promoter and/or the possibility that HIF-1 activates AQP5 through its interactions with other transcription factors.
|
|
3-fold and mutation of the HRE almost completely attenuated the hypertonicity-mediated induction (Fig. 8).
|
|
inhibition with HIF-1
siRNA on induction of AQP5 by osmotic stress.
To confirm a specific role for HIF-1
in mediating hypertonicity-induced increases in AQP5, inhibition of HIF-1
expression was accomplished using HIF-1
siRNA in MLE-15 cells. As shown in Fig. 10, HIF-1
mRNA is increased
2-fold following exposure to hypertonic sorbitol solution (Fig. 10A), accompanied by
4-fold increases in AQP5 mRNA (Fig. 10B) and protein (Fig. 10C). Prevention of HIF-1
induction with HIF-1
siRNA significantly abrogates induction of AQP5 mRNA (Fig. 10B) and protein (Fig. 10C) by sorbitol, further supporting a role for HIF-1
in mediating responses of AQP5 to hypertonicity.
|
| DISCUSSION |
|---|
|
|
|---|
as a transcription factor whose expression is upregulated by hypertonicity. Cotransfection of HIF-1
and HIF-1
with AQP5 in MLE-15 cells revealed dose-dependent transcriptional activation of the AQP5 promoter by HIF-1, which is partially inhibited by mutagenesis of putative HIF-1
binding sites in the proximal promoter. Consistent with these results, quantitative RT-PCR confirmed increased expression of HIF-1
mRNA following sorbitol treatment. Inhibition of sorbitol-induced increases in HIF-1
mRNA with siRNA significantly prevented induction of AQP5 mRNA and protein by hypertonic stress. Transient transfection of VEGF HRE-luciferase into MLE-15 cells and quantitative RT-PCR analyses of endogenous VEGF expression further support the hypothesis that exposure of AEC to hypertonic sorbitol solution leads to induction of VEGF. Together with increased HIF-1 activity in nuclear extracts from osmotically stressed AEC, these studies suggest a novel role for HIF-1 in mediating adaptive responses of AEC to hypertonicity involving both AQP5 and VEGF. AQP5 was previously shown to be upregulated by hypertonicity in MLE-15 cells and in the lungs of rodents that were made hypertonic by injection of hyperosmolar saline (17). These effects were found to be mediated, at least in part, through an ERK-dependent pathway. Because of their inability to demonstrate transcriptional activation of an AQP5-luciferase reporter, Hoffert et al. (17) suggested that effects of hyperosmolarity on AQP5 expression may be indirect. In this study, transcriptional activation of AQP5 by hypertonic stress is demonstrated in parallel with increases in AQP5 mRNA and protein in AEC. This difference may be because lentivirus transduction is more efficient than transient transfections for the reporter assays and/or that there is a requirement for chromatin modification following stable integration of the AQP5 reporter. In a recent study, Sidhaye et al. (34) provided additional evidence to support long-term regulation of AQP5 in lung epithelial cells by showing that cAMP has both acute and chronic effects on AQP5 expression in lung epithelial cells, although cAMP is typically believed to mediate more acute effects.
Several AQP family members have been shown to be regulated by hypertonicity. In the case of AQP1, AQP4, and AQP9, regulation has been shown to be at the transcriptional level (1). A GC-rich hypertonicity response element was demonstrated in AQP1, but the trans-acting hypertonicity response element binding protein has not yet been identified (42). No discrete hypertonicity response element has been identified in AQP4 and AQP9, although regions important for osmotic responsiveness have been localized within these promoters (1). Other hypertonicity-responsive genes, such as aldose reductase, sodium/myo-inositol cotransporter, sodium/chloride/betaine cotransporter, urea transporter, and heat shock protein, have been shown to contain the osmotic response element ORE/TonE, which initiates adaptive accumulation of compatible organic osmolytes by binding of tonicity-response enhancer/osmotic response element-binding protein (TonEBP/OREBP) in response to increased tonicity (16).
Protein/DNA array analyses identified HIF-1
as a transcription factor that was induced by hypertonicity in our current studies, which was further confirmed by qRT-PCR. Further examination of the proximal AQP5 promoter/enhancer region identified two putative cis-acting HRE (located at 419/414 and 330/326), leading us to investigate the possibility that effects of hypertonic stress are mediated by interactions of HIF-1 with the AQP5 promoter. Consistent with the array findings, co-transfections demonstrated transcriptional activation of the proximal AQP5 promoter by HIF-1, which was partially abrogated by mutagenesis of these two sites, suggesting a role for HIF-1 in osmotic regulation of AQP5. Furthermore, inhibition of HIF-1
induction with HIF-1
siRNA significantly reduced induction of AQP5 by hypertonic stress. These results represent the first demonstration that HIF-1 and HRE are involved in transcriptional regulation of AQP5 and VEGF by hypertonic stress in AEC.
HIF-1-regulated genes play key roles in critical developmental and physiological processes, including angiogenesis, erythropoiesis, glucose transport, glycolysis, iron transport, cell survival, and proliferation (29). More importantly, clinical and laboratory studies have demonstrated that HIF-1 target genes are involved in numerous human diseases, such as myocardial and cerebral ischemia, pulmonary hypertension, preeclampsia, intrauterine growth retardation, and cancer (31). In addition to oxygen, iron is also required as a cofactor for prolyl hydroxylase, which explains the observed hypoxia-mimetic effects of iron chelators such as desferoxamine (DFO) and iron antagonists such as cobalt chloride (44). Under hypoxia or hypoxia-mimetic conditions, HIF-1
escapes prolyl hydroxylation and degradation, which enables it to dimerize with the constitutively expressed HIF-1
and translocate to the nucleus where the heterodimer exerts gene regulatory activity. The HIF-1 heterodimer binds to a specific HRE, which contains the core sequence RCGTG (29). Although HIF-1 activity is largely regulated in a hypoxia-dependent manner, increasingly it is being recognized that activation of HIF-1 can be mediated by a variety of stimuli, including hormones and cytokines (28), nitric oxide (19), carbon monoxide (12), and mechanical (21) and thermal (33) stress. We report here the novel finding that HIF-1 activity is also regulated by hypertonic stress. Concurrent increases in AQP5 and VEGF expression in response to hypertonicity suggest that the HIF-1-dependent pathway plays an additional role in governing adaptive responses following hypertonic exposure of AEC.
It has been reported that possible mechanisms of HIF-1
activation include HIF-1
stabilization, posttranslational modification, nuclear translocation, dimerization, transcriptional activation and/or interaction with other proteins (46). Upregulation of HIF-1
mRNA by hypertonicity suggests that activation of HIF-1
in this setting is at least in part transcriptionally regulated. Interestingly, treatment of MLE-15 cells with DFO mimics hypertonic induction of HIF-1 but not AQP5 by Western blot analysis (data not shown), indicating that HIF-1 is necessary but not sufficient to induce AQP5 expression. The effects of HIF-1 on AQP5 under hypertonic conditions probably involve mechanisms distinct from those occurring under hypoxic conditions. For example, p53 has been shown to modulate HIF-1 activity through competitive binding of p300 (46), and p38
-MAP kinase is required for hypoxic (but not DFO) activation of HIF-1 (13). Differential interactions of HIF-1 with these and other transcription factors likely determine the specific response of target genes to HIF-1 under different stress conditions.
Emerging evidence has suggested that HIF-1 plays an important role in governing cellular processes to enable cells to survive or escape noxious conditions, such as an oxygen deficient environment or toxic insults (38, 43). Within distal lung epithelium, AT1 cells are particularly susceptible to injury. Hence, it is not surprising that HIF-1 is involved in regulation of a differentiation-related gene, AQP5, and its responses to environmental stress. The exact nature of cross-talk between hypertonicity-elicited and hypoxia-mediated HIF-1 activation is unclear. Hypertonic activation of aquaporins has been shown to involve activation of several MAP kinase pathways with variable responses, depending on the particular cell type. For example, hypertonic induction of AQP5 required activation of the ERK signaling pathway in MLE-15 cells (17), whereas hypertonic induction of AQP1 in mouse inner medullary collecting duct-3 cells involved all three MAP kinase pathways (40). Induction of AQP4 and AQP9 by hyperosmolar mannitol in astrocytes activated p38-MAPK (1). Upregulation of several other osmotically responsive genes, including TonE-regulated genes, has been shown to be largely mediated by p38 MAPK, although the other MAP kinases, such as ERK, JNK, and non-receptor-mediated tyrosine kinases, have also been implicated (32). Our current findings suggest HIF-1 as an additional potential downstream target of this pathway. Emerling et al. (13) recently demonstrated that activation of p38
-MAP kinase is required for HIF-1 activation, suggesting involvement of a mechanism whereby hypertonic activation of MAP kinase pathways, and particularly p38, may lead to activation of HIF-1. In addition, several reports have shown that the p42/p44(ERK2/ERK1) MAPK can phosphorylate the HIF-1
subunit, leading to enhanced HIF-1 activity (27, 45). Notwithstanding the uncertainty concerning the detailed mechanism(s) underlying this process, our results unequivocally demonstrate a crucial role of HIF-1 in augmenting AQP5 expression. Although it is possible that these events are indirectly linked, they may functionally cooperate downstream under different extracellular stimuli such as hypoxia and hyperosmotic stress. One plausible model is that HIF-1-mediated transactivation is part of a central regulatory circuit in response to both hypoxic and hyperosmotic stresses.
Although the precise physiological role of AQP5 to regulation of epithelial surface liquid in the lung is yet to be clearly defined, conditions in which effects of hyperosmolarity on AQP5 would be relevant in vivo include salt-water drowning and diseases such as cystic fibrosis (in which epithelial surface fluid regulation may be impaired). A recent study by Chen et al. (8) demonstrated that downregulation of AQP5 in a human lung adenocarcinoma cell line led to marked increases in MUC5AC, implicating AQP5 in chronic regulation of mucin genes and mucus secretion, also undoubtedly affecting epithelial surface liquid regulation. In this report, we have demonstrated that hypertonic stress induces AQP5 expression at the transcriptional level and, unexpectedly, HIF-1 is a transcription factor that is activated by hypertonicity. Additionally, hypertonicity is able to activate VEGF HRE and increase endogenous VEGF expression, suggesting that the mechanism(s) mediating hypertonic induction of AQP5 via HIF-1 may be extended to regulation of other genes (including other aquaporins), which together participate in regulation of cell survival under environmental stresses such as hypertonicity.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Borgnia M, Nielsen S, Engel A, Agre P. Cellular and molecular biology of the aquaporin water channels. Annu Rev Biochem 68: 425458, 1999.[CrossRef][ISI][Medline]
3. Borok Z, Li X, Fernandes VF, Zhou B, Ann DK, Crandall ED. Differential regulation of rat aquaporin-5 promoter/enhancer activities in lung and salivary epithelial cells. J Biol Chem 275: 2650726514, 2000.
4. Borok Z, Lubman RL, Danto SI, Zhang XL, Zabski SM, King LS, Lee DM, Agre P, Crandall ED. Keratinocyte growth factor modulates alveolar epithelial cell phenotype in vitro: expression of aquaporin 5. Am J Respir Cell Mol Biol 18: 554561, 1998.
5. Chau CH, Chen KY, Deng HT, Kim KJ, Hosoya K, Terasaki T, Shih HM, Ann DK. Coordinating Etk/Bmx activation and VEGF upregulation to promote cell survival and proliferation. Oncogene 21: 88178829, 2002.[CrossRef][ISI][Medline]
6. Cheek JM, Evans MJ, Crandall ED. Type I cell-like morphology in tight alveolar epithelial monolayers. Exp Cell Res 184: 375387, 1989.[CrossRef][ISI][Medline]
7. Cheek JM, Kim KJ, Crandall ED. Tight monolayers of rat alveolar epithelial cells: bioelectric properties and active sodium transport. Am J Physiol Cell Physiol 256: C688C693, 1989.
8. Chen Z, Zhu R, Bai L, Bai C. Downregulation of aquaporin 5 induced by vector-based short hairpin RNA and its effect on MUC5AC gene expression in human airway submucosal gland cells. Respir Physiol Neurobiol 152: 197203, 2006.[CrossRef][ISI][Medline]
9. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156159, 1987.[ISI][Medline]
10. Diglio CA, Kikkawa Y. The type II epithelial cells of the lung. IV. Adaption and behavior of isolated type II cells in culture. Lab Invest 37: 622631, 1977.[ISI][Medline]
11. Dobbs LG, Gonzalez R, Matthay MA, Carter EP, Allen L, Verkman AS. Highly water-permeable type I alveolar epithelial cells confer high water permeability between the airspace and vasculature in rat lung. Proc Natl Acad Sci USA 95: 29912996, 1998.
12. Dulak J, Jozkowicz A, Foresti R, Kasza A, Frick M, Huk I, Green CJ, Pachinger O, Weidinger F, Motterlini R. Heme oxygenase activity modulates vascular endothelial growth factor synthesis in vascular smooth muscle cells. Antioxid Redox Signal 4: 229240, 2002.[CrossRef][ISI][Medline]
13. Emerling BM, Platanias LC, Black E, Nebreda AR, Davis RJ, Chandel NS. Mitochondrial reactive oxygen species activation of p38 mitogen-activated protein kinase is required for hypoxia signaling. Mol Cell Biol 25: 48534862, 2005.
14. Ferrara N, Gerber HP, LeCouter J. The biology of VEGF and its receptors. Nat Med 9: 669676, 2003.[CrossRef][ISI][Medline]
15. Furuno M, Uchida S, Marumo F, Sasaki S. Repressive regulation of the aquaporin-2 gene. Am J Physiol Renal Fluid Electrolyte Physiol 271: F854F860, 1996.
16. Ho SN. The role of NFAT5/TonEBP in establishing an optimal intracellular environment. Arch Biochem Biophys 413: 151157, 2003.[CrossRef][ISI][Medline]
17. Hoffert JD, Leitch V, Agre P, King LS. Hypertonic induction of aquaporin-5 expression through an ERK-dependent pathway. J Biol Chem 275: 90709077, 2000.
18. Jenq W, Mathieson IM, Ihara W, Ramirez G. Aquaporin-1: an osmoinducible water channel in cultured mIMCD-3 cells. Biochem Biophys Res Commun 245: 804809, 1998.[CrossRef][ISI][Medline]
19. Kasuno K, Takabuchi S, Fukuda K, Kizaka-Kondoh S, Yodoi J, Adachi T, Semenza GL, Hirota K. Nitric oxide induces hypoxia-inducible factor 1 activation that is dependent on MAPK and phosphatidylinositol 3-kinase signaling. J Biol Chem 279: 25502558, 2004.
20. King LS, Kozono D, Agre P. From structure to disease: the evolving tale of aquaporin biology. Nat Rev Mol Cell Biol 5: 687698, 2004.[CrossRef][ISI][Medline]
21. Kuwahara F, Kai H, Tokuda K, Shibata R, Kusaba K, Tahara N, Niiyama H, Nagata T, Imaizumi T. Hypoxia-inducible factor-1
/vascular endothelial growth factor pathway for adventitial vasa vasorum formation in hypertensive rat aorta. Hypertension 39: 4650, 2002.
22. Leitch V, Agre P, King LS. Altered ubiquitination and stability of aquaporin-1 in hypertonic stress. Proc Natl Acad Sci USA 98: 28942898, 2001.
23. Ma T, Fukuda N, Song Y, Matthay MA, Verkman AS. Lung fluid transport in aquaporin-5 knockout mice. J Clin Invest 105: 93100, 2000.[ISI][Medline]
24. Matsuzaki T, Suzuki T, Takata K. Hypertonicity-induced expression of aquaporin 3 in MDCK cells. Am J Physiol Cell Physiol 281: C55C63, 2001.
25. Nielsen S, King LS, Christensen BM, Agre P. Aquaporins in complex tissues. II. Subcellular distribution in respiratory and glandular tissues of rat. Am J Physiol Cell Physiol 273: C1549C1561, 1997.
26. Raina S, Preston GM, Guggino WB, Agre P. Molecular cloning and characterization of an aquaporin cDNA from salivary, lacrimal, and respiratory tissues. J Biol Chem 270: 19081912, 1995.
27. Richard DE, Berra E, Gothie E, Roux D, Pouyssegur J. p42/p44 mitogen-activated protein kinases phosphorylate hypoxia-inducible factor 1
(HIF-1
) and enhance the transcriptional activity of HIF-1. J Biol Chem 274: 3263132637, 1999.
28. Richard DE, Berra E, Pouyssegur J. Nonhypoxic pathway mediates the induction of hypoxia-inducible factor 1
in vascular smooth muscle cells. J Biol Chem 275: 2676526771, 2000.
29. Semenza G. Signal transduction to hypoxia-inducible factor 1. Biochem Pharmacol 64: 993998, 2002.[CrossRef][ISI][Medline]
30. Semenza GL. Angiogenesis in ischemic and neoplastic disorders. Annu Rev Med 54: 1728, 2003.[CrossRef][Medline]
31. Semenza GL. HIF-1 and human disease: one highly involved factor. Genes Dev 14: 19831991, 2000.
32. Sheikh-Hamad D, Gustin MC. MAP kinases and the adaptive response to hypertonicity: functional preservation from yeast to mammals. Am J Physiol Renal Physiol 287: F1102F1110, 2004.
33. Shein NA, Horowitz M, Alexandrovich AG, Tsenter J, Shohami E. Heat acclimation increases hypoxia-inducible factor 1
and erythropoietin receptor expression: implication for neuroprotection after closed head injury in mice. J Cereb Blood Flow Metab 25: 14561465, 2005.[CrossRef][ISI][Medline]
34. Sidhaye V, Hoffert JD, King LS. cAMP has distinct acute and chronic effects on aquaporin-5 in lung epithelial cells. J Biol Chem 280: 35903596, 2005.
35. Song Y, Verkman AS. Aquaporin-5 dependent fluid secretion in airway submucosal glands. J Biol Chem 276: 4128841292, 2001.
36. Storm R, Klussmann E, Geelhaar A, Rosenthal W, Maric K. Osmolality and solute composition are strong regulators of AQP2 expression in renal principal cells. Am J Physiol Renal Physiol 284: F189F198, 2003.
37. Sugiyama Y, Ota Y, Hara M, Inoue S. Osmotic stress up-regulates aquaporin-3 gene expression in cultured human keratinocytes. Biochim Biophys Acta 1522: 8288, 2001.[Medline]
38. Tanaka T, Kojima I, Ohse T, Inagi R, Miyata T, Ingelfinger JR, Fujita T, Nangaku M. Hypoxia-inducible factor modulates tubular cell survival in cisplatin nephrotoxicity. Am J Physiol Renal Physiol 289: F1123F1133, 2005.
39. Treins C, Giorgetti-Peraldi S, Murdaca J, Semenza GL, Van Obberghen E. Insulin stimulates hypoxia-inducible factor 1 through a phosphatidylinositol 3-kinase/target of rapamycin-dependent signaling pathway. J Biol Chem 277: 2797527981, 2002.
40. Umenishi F, Schrier RW. Hypertonicity-induced aquaporin-1 (AQP1) expression is mediated by the activation of MAPK pathways and hypertonicity-responsive element in the AQP1 gene. J Biol Chem 278: 1576515770, 2003.
41. Umenishi F, Schrier RW. Identification and characterization of a novel hypertonicity-responsive element in the human aquaporin-1 gene. Biochem Biophys Res Commun 292: 771775, 2002.[CrossRef][ISI][Medline]
42. Umenishi F, Schrier RW. Induction of human aquaporin-1 gene by retinoic acid in human erythroleukemia HEL cells. Biochem Biophys Res Commun 293: 913917, 2002.[CrossRef][ISI][Medline]
43. Vaupel P. The role of hypoxia-induced factors in tumor progression. Oncologist 9, Suppl 5: 1017, 2004.
44. Wang GL, Semenza GL. Desferrioxamine induces erythropoietin gene expression and hypoxia-inducible factor 1 DNA-binding activity: implications for models of hypoxia signal transduction. Blood 82: 36103615, 1993.
45. Wenger RH. Cellular adaptation to hypoxia: O2-sensing protein hydroxylases, hypoxia-inducible transcription factors, and O2-regulated gene expression. FASEB J 16: 11511162, 2002.
46. Zagorska A, Dulak J. HIF-1: the knowns and unknowns of hypoxia sensing. Acta Biochim Pol 51: 563585, 2004.[ISI][Medline]
This article has been cited by other articles:
![]() |
X. Li, A. Azlina, M. R. Karabasil, N. Purwanti, T. Hasegawa, C. Yao, T. Akamatsu, and K. Hosoi Degradation of submandibular gland AQP5 by parasympathetic denervation of chorda tympani and its recovery by cevimeline, an M3 muscarinic receptor agonist Am J Physiol Gastrointest Liver Physiol, July 1, 2008; 295(1): G112 - G123. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Burg, J. D. Ferraris, and N. I. Dmitrieva Cellular Response to Hyperosmotic Stresses Physiol Rev, October 1, 2007; 87(4): 1441 - 1474. [Abstract] [Full Text] [PDF] |
||||
| ||||||