|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CELLULAR METABOLISM
Department of Pharmacology, Arizona Cancer Center, College of Medicine, University of Arizona, Tucson, Arizona
Submitted 13 December 2005 ; accepted in final form 4 November 2006
| ABSTRACT |
|---|
|
|
|---|
-phenyl-N-tert-butylnitrone, and lipoic acid prevent ANG II from activating NFAT3 promoter-luciferase. H2O2 induces a time- and dose-dependent activation of NFAT3 transcription factor. A dominant negative form of NFAT3 transcription factor inhibited H2O2 from activating NFAT3 promoter. An inhibitor of ERKs, but not phosphoinositide 3-kinase or p38 MAPKs, blocked NFAT3 activation by H2O2. The NFAT3 binding site in the promoters of most genes contains a weak activator protein-1 (AP-1) binding site adjacent to the core consensus NFAT binding sequence. ERK inhibitor PD98059 was found previously to inhibit AP-1 activation by H2O2. Inactivation of AP-1 transcription factor by cotransfection of a dominant negative c-Jun, TAM67, prevented H2O2 or ANG II from activating NFAT3 promoter. NFAT3 promoter containing the core NFAT cis-element without AP-1 binding site failed to show activation by H2O2 treatment. Our data suggest that hypertrophy inducers ANG II and H2O2 may activate NFAT3 in cardiomyocyte through an AP-1 transcription factor-dependent mechanism. activator protein-1; nuclear factor of activated T cells-3; cardiomyocytes; hypertrophy; antioxidants
Cardiomyocyte hypertrophy is associated with an altered profile of gene expression. Activation of several transcription factors, including the nuclear factor of activated T cells-3 (NFAT3), contributes in part to the changes in gene expression associated with hypertrophy (28, 29). NFAT3 belongs to the NFAT family of transcription factors, discovered as important regulators of immune responses in mammals (8, 25, 38). All members of the NFAT family contain an NH2-terminal transactivation domain, a conservative NFAT homologous domain, and a DNA binding domain that has a partial Rel homology. Several members of the NFAT family contain an additional transactivation domain in the COOH-terminal region. Four members of NFATs have been identified: NFAT1 (NFATp/NFATc2), NFAT2 (NFATc/NFATc1), NFAT3, and NFAT4. NFAT1 and NFAT2 are expressed predominantly in lymphoid tissues. While NFAT4 is mainly expressed in the thymus, the expression of NFAT3 occurs primarily in nonlymphoid tissues.
Nuclear translocation constitutes a necessary step in the mechanism of NFAT activation. NFATs usually reside in the cytosol and are constitutively phosphorylated by glycogen synthase kinase-3 (GSK3) at the conserved SPXX repeat motifs located in the regulatory domain (8, 15, 25, 33, 38). This domain contains a calcineurin docking site with a conserved sequence of PxIxIT. Calcineurin, a Ca2+- and calmodulin-dependent serine/threonine phosphatase (also called protein phosphatase 2B or PP2B), can dephosphorylate SPXX motifs and serine-rich regions located in the regulatory domain (8, 25, 38). As a result of dephosphorylation, NFAT proteins refold and expose a nuclear localization sequence. The calcineurin/NFAT3 pathway can be activated by classical hypertrophy inducers, including ANG II, endothelin-1 (ET-1), and catecholamines (27, 49). Inhibitors of calcineurin have been reported to prevent cardiac hypertrophy in several experimental models (21, 27, 29, 31, 32, 41). It is commonly believed that these hypertrophy inducers activate phospholipase C (PLC) on binding to their G protein-coupled receptors, resulting in release of phosphoinositol from membrane phospholipids. Phosphoinositol in turn triggers an increase in cytoplasmic Ca2+ concentration. As a result, calcineurin and therefore NFAT3 are activated on exposure of cells to ANG II and other hypertrophy inducers.
Recent evidence suggests that binding of ANG II to its receptor in the plasma membrane of cells is coupled to activation of a membrane-associated NADPH oxidase (12, 13). This enzyme produces superoxide from oxygen and NADPH. In vascular smooth muscle cells, oxidants appear to mediate ANG II-induced signaling events and hypertrophy (12). Oxidant production contributes to ANG II-induced gene expression, including activation of NFATs in cardiac fibroblasts (11). In cardiomyocytes, evidence suggests that oxidants may mediate hypertrophy induced by ANG II (39). Oxidants have been shown to induce hypertrophy of cardiomyocytes in vitro (4, 40). Whether oxidants mediate the signaling pathways and NFAT3 activation induced by ANG II in cardiomyocytes has not been demonstrated.
We found that the majority of cardiomyocytes in culture can survive a pulse treatment with low or mild doses of H2O2 but become enlarged over a course of 47 days (4). H2O2 activates the phosphoinositide 3-kinase (PI3K) pathway and MAPK pathways (45, 46). Because PI3K is a kinase regulating multiple signaling pathways including PLC, it is likely that H2O2 may increase intracellular Ca2+ concentration. In fact, intracellular Ca2+ overload has been demonstrated with H2O2 treatment in cardiomyocytes (20). Transient activation of calcineurin has been observed in cardiomyocytes following treatment with H2O2 (7), suggesting that oxidants may activate NFATs. H2O2 has been shown to activate three branches of MAPKs, i.e., JNKs, p38, and ERKs, among which ERKs appear to regulate the activation of activator protein-1 (AP-1) transcription factor (46). AP-1 transcription factor has been shown to be essential for NFAT activation in the immune system (8, 24, 25, 38). With these lines of evidence, we test the involvement of oxidants and AP-1 transcription factor in NFAT3 activation induced by ANG II in cardiomyocytes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture and H2O2 or ANG II treatment. Cardiomyocytes were prepared from 1- to 2-day-old neonatal Sprague-Dawley rats (Harland, Indianapolis, IN) as previously described (7, 45). The cardiomyoctes were seeded at a density of 5 x 104 cells/cm2 and plated in DMEM with 1 mM pyruvate, 10% fetal bovine serum (FBS), 100 units/ml penicillin, and 100 units/ml streptomycin. Cells were pretreated with inhibitors for 1 h and then treated with H2O2 for 10 min. After H2O2 treatment, oxidized medium was changed to fresh 0.5% FBS-DMEM with or without inhibitor added back. When ANG II was used, cells were pretreated with antioxidants for 30 min before ANG II addition. After 12 h, the medium was changed, and ANG II and antioxidants were added back for 24-h harvesting.
Transfection and NFAT luciferase assay.
Cardiomyocytes were seeded at 0.5 x 106 per well in six-well plates (
960-mm2 culture area per well). At 24 h after plating, cells were incubated 5 h with 0.8 µg of the NFAT luciferase reporter construct pNFAT-luc (Stratagene, La Jolla, CA) and 0.4 µg of the NFAT3 expression vector RSV-NFAT3 per well using 3 µl of FuGene-6 liposomes (Roche, Mannheim, Germany). The transfection efficiency is generally low (310%) in cardiomyocytes and can vary because of the nature of primary culture. The low transfection efficiency and different batches of primary cultures of cardiomyocytes contribute to the variation in the data of promoter reporter gene assay. To correct for transfection efficiency, we cotransfected cardiomyocytes with the pRL-TK plasmid (0.04 µg/well), which encodes a Renilla luciferase gene under the control of a thymidine kinase (TK) promoter. After transfection, the cells were placed in 10% FBS-DMEM for 24 h and subsequently in 0.5% FBS-DMEM for 1824 h before H2O2 treatment, or in 0% FBS-DMEM for 1824 h before ANG II treatment. When cells were cotransfected with catalase, Tam67, or a dominant negative form of NFAT (dnNFAT), the amount of pNFAT-luc, RSV-NFAT3, or pRL-TK DNA was reduced to 50%. The activity of Firefly vs. Renilla luciferase was measured using a dual luciferase assay kit (Promega, Madison, WI) with a luminometer (Turner Designs, Sunnyvale, CA). Results were expressed as the ratio of the relative light unit (RLU) from the readings of Firefly vs. Renilla luciferase.
EMSA. Cardiomyocytes were harvested, and nuclear extracts were prepared as described previously (46). Briefly, cardiomyocytes were lysed on ice with lysis buffer (10 mM KCl, 1.5 mM MgCl2, 0.15% NP-40, 10 mM HEPES, pH 7.9, 0.5 mM DTT, 0.5 mM PMSF). After microscopic examination for the completion of cell lysis, the nuclei were collected by centrifugation at 2,000 g and resuspended in an ice-cold buffer [1.5 mM MgCl2, 0.2 mM EDTA, 26% glycerol (vol/vol), 5 mM HEPES, pH 7.9, 0.5 mM DTT, 0.5 mM PMSF]. NaCl was added to a final concentration of 0.3 M. After 30-min incubation on ice, samples were centrifuged at 20,000 g for 10 min for collection of nuclear extracts. DNA binding reactions were carried for 30 min at 4°C in a reaction volume of 20 µl containing 8 µg of nuclear protein, 4% glycerol, 5 mM MgCl2, 0.5 mM EDTA, 1 mM DTT, 50 mM NaCl, 10 mM Tris·HCl, pH 7.5, 0.05 mg/ml poly(dI-dC), and 30,000 counts/min (cpm) 32P-labeled oligonucleotide probes (GGAGGAAAAACTGTTTCATACAGAAGGCGT). When supershift assay was performed, nuclear extracts were preincubated with antibodies against NFAT3 from Dr. Nancy Rice (22) for 1 h in the reaction buffer at 4°C before the radiolabeled oligonucleotide probe was added to the reaction mixture. For competition assay, 50x unlabeled NFAT oligonucleotide probe was added to the binding mixture. The binding complexes were separated on nondenaturing 5% polyacrylamide gels. The gels were vacuum dried for autoradiography.
| RESULTS |
|---|
|
|
|---|
-phenyl-N-tert-butylnitrone (PBN), and lipoic acid. NAC is a precursor of reduced glutathion, and PBN is a free radical spin trap, while lipoic acid, a dithiol compound serving as a mitochondrial bioenergic enzyme cofactor, is known to exhibit antioxidant properties. Lipoic acid has been shown to reduce myocardial injury and cardiac hypertrophy in a transgenic hypertensive animal model (26). Unlike commonly known antioxidant vitamins, such as vitamin E and ascorbic acid, which become prooxidants because of oxidation in the air or tissue culture medium, the three compounds used in this study retain their antioxidant potential in tissue culture medium. Cardiomyocytes transfected with an NFAT promoter-luciferase construct were pretreated with NAC (10 mM), PBN (5 mM), or lipoid acid (200 µM) for 30 min before addition of ANG II (1 µM). Measurements of luciferase activity at 24 h after ANG II treatment indicate that NAC, PBN, and lipoic acid were capable of preventing ANG II from activating the NFAT3 promoter (Fig. 1A). A similar response was observed with ANG II at a 100 nM concentration.
|
We have used a luciferase reporter gene construct containing four repeats of a NFAT binding site derived from the interleukin-2 (IL-2) promoter for studying NFAT activation by ANG II (18). Because of the low expression level of NFAT3 in cardiomyocytes and low transfection efficiency of primary cultured cardiomyocytes, the NFAT3 expression vector RSV-NFAT3 was cotransfected with the NFAT promoter-luciferase construct to augment the promoter activity. Without NFAT3 expression, the basal and induced levels of NFAT3 promoter-luciferase were low (Table 1), suggesting that induction of NFAT3 promoter activity by ANG II was indeed associated with the activation of NFAT3 transcription factor.
|
|
|
|
|
We used a dominant negative mutant of c-Jun, TAM67. TAM67 lacks the transactivation domain of c-Jun but is able to dimerize with c-Jun or c-Fos family members to inhibit AP-1 activity (2, 43). This construct has been shown to inhibit AP-1 in various cellular responses (9, 10). We cotransfected cardiomyocytes with a TAM67 expression vector and the NFAT promoter-luciferase construct. The data show that H2O2-induced NFAT luciferase activity was blocked by TAM67 (Fig. 6). This inhibitory effect was TAM67 dose dependent, and a complete inhibition was observed with 0.8 µg of TAM67 plasmid (Fig. 6A).
|
To test that AP-1 also mediates ANG II-induced NFAT3 activation in cardiomyocytes, we performed TAM67 cotransfection experiments for measurements of NFAT promoter activation through luciferase reporter constructs. Although the activity of luciferase varies among independent experiments, the data suggest that TAM67 cotransfection can inhibit NFAT3 promoter activation by ANG II treatment (Fig. 7).
|
| DISCUSSION |
|---|
|
|
|---|
Cooperation of NFATs with other families of transcription factors is an important character of NFATs in regulating gene expression. There is evidence that AP-1 transcription factor is activated during the process of cardiac hypertrophy (30). In immune cells, NFAT1 and NFAT2 regulate the expression of cytokines including IL-2, IL-3, IL-4, IL-5, interferon-
(IFN-
), and tumor necrosis factor-
(TNF-
) and cell surface receptors such as CD40L and FasL (25, 34). Activation of the transcription of many of these genes results from the partnership of NFATs and AP-1 transcription factors (8, 24, 25, 38). For example, the expression of IL-2, IL-3, IL-4, granulocyte-macrophage colony-stimulating factor (GM-CSF), and FasL genes has been reported to require the interaction of NFATs with AP-1 (23). The AP-1 protein capable of mediating the activation of NFATs is usually the heterodimer of c-Fos:c-Jun (5, 24). For other genes, such as TNF-
, the AP-1 binding site is occupied by the c-Jun:ATF2 heterodimer in conjunction with NFATs (23). In either case, the core NFAT consensus sequence (GGAAA) is in a close proximity with a weak AP-1 binding site (TGTTTCA). The cooperation of NFATs and AP-1 to DNA binding greatly enhances the stability of the ternary complex compared with the DNA binding affinity of either NFATs or AP-1 alone (38). In fact, neither NFAT nor AP-1 alone binds to its consensus sequence in the composite promoter with high affinity (3, 19, 36). The binding of AP-1 or NFATs to their corresponding cis-element in the composite promoter is characterized by a relatively high dissociation rate. Deletion or mutation of the AP-1 cis-element results in a loss of NFAT transcription factor binding to the NFAT cis-element (24). A mutant NFAT protein unable to interact with c-Fos:c-Jun heterodimers failed to activate the NFAT promoter (23, 36). Interestingly, NFATs do not appear to interact with AP-1 proteins well in the absence of DNA (3, 19, 36). Because of this caveat, conventional immunochemical methods cannot be used to demonstrate the interaction between NFATs and AP-1. Regardless, although the synergistic interaction between NFATs and AP-1 transcription factors is a well-established phenomenon in immune cells, whether this interaction is present in cardiomyocytes has not been addressed previously. In cardiomyocytes, because hypertrophy inducers activate AP-1 as well as NFAT3, it becomes important to evaluate the cooperation between NFAT-3 and AP-1 in regulating gene expression associated with cardiomyocyte hypertrophy.
The cooperative physical interaction between NFATs and AP-1 has been found to regulate most but not all genes containing an NFAT binding consensus sequence in the promoter region (23, 24). In cardiomyocytes, NFAT3 has been shown to interact with the GATA transcription factor to regulate the expression of B-type natriuretic peptide (BPN) (29), a gene that elevates its expression in the early stage of cardiac hypertrophy. A potential binding site has been found in the BPN promoter (29). In addition, NFAT binding sites can appear to be NF-
B like, such as in the TNF-
promoter-
3 site (GGAGAACCC=NFAT/NF-
B). This NF-
B-like site also appears in the promoter region of the HIV-1 LTR gene (GGGACTTTCC), which is situated next to an Sp1 consensus sequence. The difference in the partners or DNA binding habit causes NFATs to regulate the expression of different sets of genes.
Recent evidence suggests that MAPKs participate in the regulation of NFATs and cardiac hypertrophy. Harris et al. (16) found that the Raf-1/ERKs pathway is essential for cardiomyocyte survival and cardiac hypertrophy in response to pressure overload. Tsatsanis et al. (44) reported that PD98059 prevented the Tpl-2 kinase from inducing NFAT activation in T-lymphocytes. Ichida and Finkel (18) demonstrated that activating the Ras/MEK1/ERK pathway results in NFAT activation in cardiomyocytes. MEKK3, an upstream kinase regulating MAPKs including ERKs, has been found to mediate ANG II-induced NFAT activation in T-lymphocytes (1). These reports are consistent with our finding in H2O2-induced NFAT3 activation. In our case, we have linked ERKs to activation of AP-1 transcription factor (46), which appears to serve as an important mechanism regulating NFAT3 activation. Additional evidence in the literature supporting this link includes the finding that MEKK3 regulates AP-1 as well as NFAT activation (1, 47). The interaction of NFAT3 with AP-1 probably occurs in the nuclei following nuclear translocation of NFAT3. Transfection experiments using green fluorescent protein-conjugated NFAT3 indicate that NFAT3 normally distributes in the nuclei as well as in the cytoplasm of cardiomyocytes (18). Therefore, an activated AP-1 transcription factor could recruit existing NFAT3 in the nuclei onto the NFAT/AP-1 composite site in DNA to cause transcriptional activation.
Proinflammatory interleukins, many of which are regulated by NFATs in cooperation with AP-1 transcription factors in lymphocytes, are indicated to play a role in myocardial remodeling after cardiac infarction, where oxidants are often overproduced (37). This suggests the possibility that oxidant-induced NFAT activation may serve as a mechanism of regulating interleukin expression in the myocardium following ischemia or ischemic reperfusion. Evidence suggests that interleukins, such as IL-6 and IL-1, contribute to myocardium remodeling, cardiac hypertrophy, and ultimately heart failure (17, 35, 42). The plasma level of these interleukins has been found elevated in hypertensive and heart failure patients (14, 37). If oxidants indeed induce or mediate the expression of these interleukins through an NFAT3-dependent mechanism in cardiomyocytes, there is additional evidence supporting that oxidants contribute to cardiac hypertrophy. It appears that the mechanism of oxidant-induced cardiomyocyte hypertrophy involves multiple pathways, some of which may intervene and overlap with those from other well-established hypertrophy inducers.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
Current address for V. C. Tu: Dept. of Toxicology, Avon Products, Inc., 1 Avon Pl., Suffern, NY 10901.
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Brown PH, Chen TK, Birrer MJ. Mechanism of action of a dominant-negative mutant of c-Jun. Oncogene 9: 791799, 1994.[Web of Science][Medline]
3. Chen L, Glover JN, Hogan PG, Rao A, Harrison SC. Structure of the DNA-binding domains from NFAT, Fos and Jun bound specifically to DNA. Nature 392: 4248, 1998.[CrossRef][Medline]
4. Chen Q, Tu V, Wu Y, Bahl J. Hydrogen peroxide dose dependent induction of cell death or hypertrophy in cardiomyocytes. Arch Biochem Biophys 373: 242248, 2000.[CrossRef][Web of Science][Medline]
5. Chinenov Y, Kerppola TK. Close encounters of many kinds: Fos-Jun interactions that mediate transcription regulatory specificity. Oncogene 20: 24382452, 2001.[CrossRef][Web of Science][Medline]
6. Chow CW, Rincon M, Davis RJ. Requirement for transcription factor NFAT in interleukin-2 expression. Mol Cell Biol 19: 23002307, 1999.
7. Coronella-Wood J, Terrand J, Sun H, Chen QM. c-Fos phosphorylation induced by H2O2 prevents proteasomal degradation of c-Fos in cardiomyocytes. J Biol Chem 279: 3356733574, 2004.
8. Crabtree GR. Generic signals and specific outcomes: signaling through Ca2+, calcineurin, and NF-AT. Cell 96: 611614, 1999.[CrossRef][Web of Science][Medline]
9. Dhar A, Hu J, Reeves R, Resar LM, Colburn NH. Dominant-negative c-Jun (TAM67) target genes: HMGA1 is required for tumor promoter-induced transformation. Oncogene 23: 44664476, 2004.[CrossRef][Web of Science][Medline]
10. Dong Z, Cmarik JL, Wendel EJ, Colburn NH. Differential transformation efficiency but not AP-1 induction under anchorage-dependent and -independent conditions. Carcinogenesis 15: 10011004, 1994.
11. Fujii T, Onohara N, Maruyama Y, Tanabe S, Kobayashi H, Fukutomi M, Nagamatsu Y, Nishihara N, Inoue R, Sumimoto H, Shibasaki F, Nagao T, Nishida M, Kurose H. Galpha12/13-mediated production of reactive oxygen species is critical for angiotensin receptor-induced NFAT activation in cardiac fibroblasts. J Biol Chem 280: 2304123047, 2005.
12. Griendling KK, Sorescu D, Ushio-Fukai M. NAD(P)H oxidase: role in cardiovascular biology and disease. Circ Res 86: 494501, 2000.
13. Griendling KK, Ushio-Fukai M. Reactive oxygen species as mediators of angiotensin II signaling. Regul Pept 91: 2127, 2000.[CrossRef][Web of Science][Medline]
14. Gullestad L, Aukrust P. The cytokine network in heart failure: pathogenetic importance and potential therapeutic targets. Heart Failure Monitor 2: 813, 2001.[Medline]
15. Haq S, Choukroun G, Kang ZB, Ranu H, Matsui T, Rosenzweig A, Molkentin JD, Alessandrini A, Woodgett J, Hajjar R, Michael A, Force T. Glycogen synthase kinase-3beta is a negative regulator of cardiomyocyte hypertrophy. J Cell Biol 151: 117130, 2000.
16. Harris IS, Zhang S, Treskov I, Kovacs A, Weinheimer C, Muslin AJ. Raf-1 kinase is required for cardiac hypertrophy and cardiomyocyte survival in response to pressure overload. Circulation 110: 718723, 2004.
17. Hirota H, Yoshida K, Kishimoto T, Taga T. Continuous activation of gp130, a signal-transducing receptor component for interleukin 6-related cytokines, causes myocardial hypertrophy in mice. Proc Natl Acad Sci USA 92: 48624866, 1995.
18. Ichida M, Finkel T. Ras regulates NFAT3 activity in cardiac myocytes. J Biol Chem 276: 35243530, 2001.
19. Jain J, McCaffrey PG, Miner Z, Kerppola TK, Lambert JN, Verdine GL, Curran T, Rao A. The T-cell transcription factor NFATp is a substrate for calcineurin and interacts with Fos and Jun. Nature 365: 352355, 1993.[CrossRef][Medline]
20. Josephson RA, Silverman HS, Lakatta EG, Stern MD, Zweier JL. Study of the mechanisms of hydrogen peroxide and hydroxyl free radical-induced cellular injury and calcium overload in cardiac myocytes. J Biol Chem 266: 23542361, 1991.
21. Lim HW, De Windt LJ, Steinberg L, Taigen T, Witt SA, Kimball TR, Molkentin JD. Calcineurin expression, activation, and function in cardiac pressure-overload hypertrophy. Circulation 101: 24312437, 2000.
22. Lyakh L, Ghosh P, Rice NR. Expression of NFAT-family proteins in normal human T cells. Mol Cell Biol 17: 24752484, 1997.[Abstract]
23. Macian F, Garcia-Rodriguez C, Rao A. Gene expression elicited by NFAT in the presence or absence of cooperative recruitment of Fos and Jun. EMBO J 19: 47834795, 2000.[CrossRef][Web of Science][Medline]
24. Macian F, Lopez-Rodriguez C, Rao A. Partners in transcription: NFAT and AP-1. Oncogene 20: 24762489, 2001.[CrossRef][Web of Science][Medline]
25. Masuda ES, Imamura R, Amasaki Y, Arai K, Arai N. Signalling into the T-cell nucleus: NFAT regulation. Cell Signal 10: 599611, 1998.[CrossRef][Web of Science][Medline]
26. Mervaala E, Finckenberg P, Lapatto R, Muller DN, Park JK, Dechend R, Ganten D, Vapaatalo H, Luft FC. Lipoic acid supplementation prevents angiotensin II-induced renal injury. Kidney Int 64: 501508, 2003.[CrossRef][Web of Science][Medline]
27. Molkentin JD. Calcineurin and beyond: cardiac hypertrophic signaling. Circ Res 87: 731738, 2000.
28. Molkentin JD, Dorn IG II. Cytoplasmic signaling pathways that regulate cardiac hypertrophy. Annu Rev Physiol 63: 391426, 2001.[CrossRef][Web of Science][Medline]
29. Molkentin JD, Lu JR, Antos CL, Markham B, Richardson J, Robbins J, Grant SR, Olson EN. A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell 93: 215228, 1998.[CrossRef][Web of Science][Medline]
30. Muller DN, Mervaala EM, Dechend R, Fiebeler A, Park JK, Schmidt F, Theuer J, Breu V, Mackman N, Luther T, Schneider W, Gulba D, Ganten D, Haller H, Luft FC. Angiotensin II (AT(1)) receptor blockade reduces vascular tissue factor in angiotensin II-induced cardiac vasculopathy. Am J Pathol 157: 111122, 2000.
31. Murat A, Pellieux C, Brunner HR, Pedrazzini T. Calcineurin blockade prevents cardiac mitogen-activated protein kinase activation and hypertrophy in renovascular hypertension. J Biol Chem 275: 4086740873, 2000.
32. Nagata K, Somura F, Obata K, Odashima M, Izawa H, Ichihara S, Nagasaka T, Iwase M, Yamada Y, Nakashima N, Yokota M. AT1 receptor blockade reduces cardiac calcineurin activity in hypertensive rats. Hypertension 40: 168174, 2002.
33. Neilson J, Stankunas K, Crabtree GR. Monitoring the duration of antigen-receptor occupancy by calcineurin/glycogen-synthase-kinase-3 control of NF-AT nuclear shuttling. Curr Opin Immunol 13: 346350, 2001.[CrossRef][Web of Science][Medline]
34. Northrop JP, Ho SN, Chen L, Thomas DJ, Timmerman LA, Nolan GP, Admon A, Crabtree GR. NF-AT components define a family of transcription factors targeted in T-cell activation. Nature 369: 497502, 1994.[CrossRef][Medline]
35. Palmer JN, Hartogensis WE, Patten M, Fortuin FD, Long CS. Interleukin-1 beta induces cardiac myocyte growth but inhibits cardiac fibroblast proliferation in culture. J Clin Invest 95: 25552564, 1995.[Web of Science][Medline]
36. Peterson BR, Sun LJ, Verdine GL. A critical arginine residue mediates cooperativity in the contact interface between transcription factors NFAT and AP-1. Proc Natl Acad Sci USA 93: 1367113676, 1996.
37. Prabhu SD. Cytokine-induced modulation of cardiac function. Circ Res 95: 11401153, 2004.
38. Rao A, Luo C, Hogan PG. Transcription factors of the NFAT family: regulation and function. Annu Rev Immunol 15: 707747, 1997.[CrossRef][Web of Science][Medline]
39. Shih NL, Cheng TH, Loh SH, Cheng PY, Wang DL, Chen YS, Liu SH, Liew CC, Chen JJ. Reactive oxygen species modulate angiotensin II-induced beta-myosin heavy chain gene expression via Ras/Raf/extracellular signal-regulated kinase pathway in neonatal rat cardiomyocytes. Biochem Biophys Res Commun 283: 143148, 2001.[CrossRef][Web of Science][Medline]
40. Siwik DA, Tzortzis JD, Pimental DR, Chang DL, Pagano PJ, Singh K, Sawyer DB, Colucci WS. Inhibition of copper-zinc superoxide dismutase induces cell growth, hypertrophic phenotype, and apoptosis in neonatal rat cardiac myocytes in vitro. Circ Res 85: 147153, 1999.
41. Sussman MA, Lim HW, Gude N, Taigen T, Olson EN, Robbins J, Colbert MC, Gualberto A, Wieczorek DF, Molkentin JD. Prevention of cardiac hypertrophy in mice by calcineurin inhibition. Science 281: 16901693, 1998.
42. Thaik CM, Calderone A, Takahashi N, Colucci WS. Interleukin-1 beta modulates the growth and phenotype of neonatal rat cardiac myocytes. J Clin Invest 96: 10931099, 1995.[Web of Science][Medline]
43. Thompson EJ, Gupta A, Stratton MS, Bowden GT. Mechanism of action of a dominant negative c-jun mutant in inhibiting activator protein-1 activation. Mol Carcinog 35: 157162, 2002.[CrossRef][Web of Science][Medline]
44. Tsatsanis C, Patriotis C, Tsichlis PN. Tpl-2 induces IL-2 expression in T-cell lines by triggering multiple signaling pathways that activate NFAT and NF-kappaB. Oncogene 17: 26092618, 1998.[CrossRef][Web of Science][Medline]
45. Tu V, Bahl J, Chen Q. Signals of oxidant-induced hypertrophy of cardiac myocytes: key activation of phosphatidylinositol 3-kinase and p70S6 kinase. J Pharmacol Exp Ther 300: 11011110, 2002.
46. Tu V, Chen Q. Distinct roles of ERKs and p38 MAPK in oxidant induced cardiomyocyte hypertrophy. Cardiovasc Tox 3: 119133, 2003.[CrossRef]
47. Xu LG, Li LY, Shu HB. TRAF7 potentiates MEKK3-induced AP1 and CHOP activation and induces apoptosis. J Biol Chem 279: 1727817282, 2004.
48. Zafari AM, Ushio-Fukai M, Akers M, Yin Q, Shah A, Harrison DG, Taylor WR, Griendling KK. Role of NADH/NADPH oxidase-derived H2O2 in angiotensin II-induced vascular hypertrophy. Hypertension 32: 488495, 1998.
49. Zhu W, Zou Y, Shiojima I, Kudoh S, Aikawa R, Hayashi D, Mizukami M, Toko H, Shibasaki F, Yazaki Y, Nagai R, Komuro I. Ca2+/calmodulin-dependent kinase II and calcineurin play critical roles in endothelin-1-induced cardiomyocyte hypertrophy. J Biol Chem 275: 1523915245, 2000.
This article has been cited by other articles:
![]() |
S.-Y. Kim, R. Gul, S.-Y. Rah, S. H. Kim, S. K. Park, M.-J. Im, H. J. Kwon, and U.-H. Kim Molecular mechanism of ADP-ribosyl cyclase activation in angiotensin II signaling in murine mesangial cells Am J Physiol Renal Physiol, April 1, 2008; 294(4): F982 - F989. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |