Am J Physiol Cell Physiol Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 292: C1024-C1032, 2007. First published November 1, 2006; doi:10.1152/ajpcell.00445.2006
0363-6143/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/3/C1024    most recent
00445.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Touw, K.
Right arrow Articles by Herring, B. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Touw, K.
Right arrow Articles by Herring, B. P.

MUSCLE CELL BIOLOGY AND CELL MOTILITY

Hprt-targeted transgenes provide new insights into smooth muscle-restricted promoter activity

Ketrija Touw, April M. Hoggatt, Gina Simon, and B. Paul Herring

Department of Cellular and Integrative Physiology, Indiana University School of Medicine, Indianapolis, Indiana

Submitted 18 August 2006 ; accepted in final form 31 October 2006


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Mouse telokin and SM22{alpha} promoters have previously been shown to direct smooth muscle cell-specific expression of transgenes in vivo in adult mice. However, the activity of these promoters is highly dependent on the integration site of the transgene. In the current study, we found that the ectopic expression of telokin promoter transgenes could be abolished by flanking the transgene with insulator elements from the H19 gene. However, the insulator elements did not increase the proportion of mouse lines that exhibited consistent, detectable levels of transgene expression. In contrast, when transgenes were targeted to the hprt locus, both telokin and SM22{alpha} promoters resulted in reproducible patterns and levels of transgene expression in all lines of mice examined. Telokin promoter transgene expression was restricted to smooth muscle tissues in adult and embryonic mice. As reported previously, SM22{alpha} transgenes were expressed at high levels specifically in arterial smooth muscle cells; however, in contrast to randomly integrated transgenes, the hprt-targeted SM22{alpha} transgenes were also expressed at high levels in smooth muscle cells in veins, bladder, and gallbladder. Using hprt-targeted transgenes, we further analyzed elements within the telokin promoter required for tissue specific activity in vivo. Analysis of these transgenes revealed that the CArG element in the telokin promoter is required for promoter activity in all tissues and that the CArG element and adjacent AT-rich region are sufficient to drive transgene expression in bladder but not intestinal smooth muscle cells.

visceral smooth muscle; development; myosin light chain kinase; embryos; CArG element


ANALYSIS OF TRANSGENE EXPRESSION driven by various fragments of smooth muscle-specific promoters has suggested that distinct cis-acting regulatory elements are required to direct expression of genes in different smooth muscle tissues (17, 19, 23, 25, 26, 28). It is thus likely that distinct transcription regulatory pathways control the expression of genes in different smooth muscle tissues. This hypothesis is supported by several observations; for example, differentiation of coronary artery smooth muscle cells is dependent on a complex of serum response factor (SRF), GATA4/6, and cysteine-rich LIM-only proteins (CRP) (3). In contrast, differentiation of aortic smooth muscle cells is dependent on myocardin (24), whereas myocardin-related transcription factor B (MRTF-B) plays a specific role in differentiation of cardiac neural crest-derived smooth muscle cells (21, 30).

To better understand the mechanisms regulating expression of genes in distinct smooth muscle tissues, it is necessary to carefully analyze the relative importance of individual cis-acting regulatory elements in regulating expression of these genes in each tissue in vivo. Previous studies that have analyzed the activity of smooth muscle-specific promoters in transgenic mice in vivo have utilized standard transgenic approaches. One of the limitations of this approach is that the site of integration of the transgene and the transgene copy number can greatly affect both the pattern and level of transgene expression. For example, in our analysis of telokin promoter transgenes, we observed that the majority of transgenic lines exhibited no detectable transgene expression (17). In addition, the pattern of transgene expression driven by an SM22{alpha} promoter was distinct in different transgenic lines, with most lines exhibiting artery-specific expression, whereas some showed additional expression in veins and in heart (17). In general, telokin promoter transgenes are expressed at highest levels in visceral smooth muscle tissues (17); in contrast, SM22{alpha} transgenes are most highly expressed in vascular smooth muscle tissues (19, 23, 28). The reciprocal expression of telokin and SM22{alpha} transgenes makes these two promoters good tools for identifying regulatory elements that direct transcription to distinct smooth muscle tissues. However, the variable patterns and levels of expression of these transgenes make analysis of regulatory elements within these promoters difficult, requiring the analysis of large numbers of independent founder lines. To be able to determine the relative importance of regulatory elements in different smooth muscle tissues, it is necessary to generate transgenic mice in which the activity of wild-type promoters are highly reproducible in terms of both their levels and tissue-specific patterns of activity.

In the current study we used two different approaches to decrease the variability in the pattern and level of transgene expression. In the first approach, we used a transgene cassette in which the transgene is flanked by insulator elements from the H19 gene. In a second approach, we targeted single-copy transgenes adjacent to the hypoxanthine phosphoribosyltransferase (hprt) locus, using homologous recombination in embryonic stem (ES) cells. Hprt is a housekeeping gene expressed in all cell types; hence, it would be anticipated that this locus would be transcriptionally favorable. Although this approach has not been utilized for smooth muscle-specific promoters, previous studies using endothelial cell-specific promoters demonstrated that, when targeted to this locus, these promoters exhibit very reproducible endothelium-specific expression (6, 8, 10, 27). Similarly, the myogenin promoter also exhibited appropriate skeletal muscle-specific expression when targeted to the hprt locus (31).

Results from the current studies demonstrate that telokin promoter-driven transgenes exhibited greatly reduced ectopic expression when flanked by insulator elements. However, the levels of transgene expression still remained highly variable between transgenic lines. In contrast, hprt-targeted telokin promoter transgenes exhibited faithful, reproducible patterns and levels of transgene expression in all animals examined. In hprt-targeted telokin promoter transgenes, similar to endogenous telokin, expression was restricted to visceral and, to a lesser extent, vascular smooth muscle tissues. The reproducible patterns and levels of transgene expression allowed us to begin to determine the importance of specific regulatory elements within the telokin promoter. We found that although mutation of the CArG box was sufficient to abolish transgene expression in all smooth muscle tissues, a core promoter extending from –90 to +180, which included an AT-rich region and the CArG box, was not sufficient for high levels of transgene expression in most smooth muscle tissues. Analysis of hprt-targeted SM22{alpha} promoter transgenes demonstrated that the hprt-targeting system is universally applicable to smooth muscle-restricted promoters. These transgenes also exhibited a very reproducible pattern of transgene expression in all animals analyzed. Hprt-targeted SM22{alpha} transgenes were transiently expressed in embryonic skeletal and cardiac muscle and robustly expressed specifically in embryonic and adult arterial, venous, and bladder smooth muscle tissues.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Transgenic mouse production. The 370-bp telokin promoter-AUG LAC transgenes contained the –180 to +190 fragment of the mouse telokin promoter fused to a modified beta-galactosidase gene, followed by an SV40 large T-antigen polyadenylation sequence, as described previously (17). To generate a transgene that is flanked by insulator elements, the 370-bp mouse telokin promoter fragment extending from –180 to +190 was amplified by PCR, digested with Xho, and ligated into the pWhere vector (InvivoGen, San Diego, CA). Restriction digestion and DNA sequencing were performed to confirm the orientation and integrity of the resultant plasmid such that the promoter is located in the 5'-3' orientation 5' of a modified LACz gene in which all CpG sequences are mutated and a SV40 nuclear localization is added (T370-pWhere). The Indiana University Transgenic Mouse Facility generated all standard transgenic lines in C3H mice; founders were then bred with DBA/2 mice to establish stable lines. Transgenic animals were identified by PCR.

To generate hprt-targeted transgenes, telokin promoter fragments extending from –190 to +180 (T370), –90 to +180 (T270), a –180 to +190 telokin promoter harboring a mutation in the CArG element, and a –475 to +61 SM22{alpha} promoter were cloned into the AUG-LAC beta-galactosidase vector. The AUG-LAC transgene vectors were then digested with appropriate restriction enzymes and cloned into the pMP8SKB hprt-targeting vector, kindly provided by Dr. Sara Bronson (1). This resulted in the placement of the promoter, LAC cDNA, and SV40 polyA sequence 5' of the hprt promoter (GoFig. 2). The resultant targeting constructs were linearized by digestion with SalI and electroporated into BK4 embryonic stem cells by the Indiana University Transgenic Mouse Facility (1). Correctly targeted embryonic stem cells have repaired the mutant hprt gene in BK4 ES cells and therefore can be selected using hypoxanthine and thymidine (HAT) medium. HAT-resistant clones were expanded, and genomic DNA was isolated (Puregene; Gentra Systems, Minneapolis, MN). Homologous recombination was then confirmed by Southern blot analysis of genomic DNA digested with BamHI. Wild-type BK4 cells have a 9-kb BamHI fragment that hybridizes to an exon 3-derived probe, whereas cells harboring the targeted telokin transgene have an ~12-kb fragment (Fig. 1). For all hprt-targeted transgenes (except T370 AUG LAC, in which chimeras derived from only 1 ES line transmitted the transgene), lines of mice were established from two independently targeted ES clones. Because the hprt gene is on the X chromosome, transgene expression was analyzed in hemizygous male mice or in homozygous female mice.


Figure 1
View larger version (26K):
[in this window]
[in a new window]

 
Fig. 1. Telokin promoter-hypoxanthine phosphoribosyltransferase (hprt) targeting scheme. A: schematic representation of the hprt targeting vector. B: Southern blot analysis of genomic DNA extracted from targeted hypoxanthine and thymidine (HAT)-resistant embryonic stem cell (ES) clones. Genomic DNA was digested with BamHI, separated on a 0.8% agarose gel, transferred to a nylon membrane, and then reacted with a probe to exon 3 of the mouse hprt gene (shown in A). A 9-kb band corresponding to the endogenous mouse hprt gene fragment was seen in wild-type cells, and bands of ~12 kb were seen in clones 2, 5, and 6 corresponding to the correctly targeted locus. The band obtained from clone 5 was slightly smaller than the bands obtained from clones 2 and 6; additional PCR and sequence analysis revealed that this clone contained a small deletion within the beta-galactosidase cDNA. ES clones 2 and 6 were used to generate chimeric mice. Chimeric mice derived from ES clone 2 did not transmit the transgene; hence, data presented are from mice derived from ES clone 6. Clone 3 contained a band significantly larger than 12 kb and likely represents an insertional event, rather than a replacement as described previously (1).

 

Figure 2
View larger version (71K):
[in this window]
[in a new window]

 
Fig. 2. Expression of hprt-targeted telokin 370AUG-LAC transgenes in adult mice. Tissues were rapidly dissected from a positive hemizygous male hprt-targeted telokin promoter 370-bp AUG-LAC transgenic mouse, fixed, and stained for beta-galactosidase expression as described in METHODS. This transgene resulted in high levels of beta-galactosidase expression in smooth muscle tissues of the bladder, colon, stomach, duodenum, bronchi (Br), trachea (Tr), and renal artery (RA) and low levels of expression in the abdominal aorta (aA), vena cava (V), and ureter (Ur) but no expression in the aortic arch (AA) or thoracic aorta (tA), as indicated. Images in the bottom three panels are from tissues that were frozen, showing serial sections that were stained for beta-galactosidase (blue stain) and hematoxylin and eosin (X-Gal/H&E) and smooth muscle myosin heavy chain (SM1; green stain). The arrows on the abdominal aorta section indicate beta-galactosidase-positive smooth muscle cells. Scale bars, 100 µm.

 
Transgenic mice were genotyped using PCR with transgene-specific primers. Primers used were as follows: telokin 370 AUG-LAC, telokin 370-hprt, and telokin 370 CArG mutant-hprt, (sense) ACTGTCTCTTTGACCACTTGAAATCC and (antisense) GGCAGGGTTTTCCCAGTCACGACGTTG; telokin 370-pWhere, (sense) same as T370 AUG-LAC and (antisense) CAACCCACCTGCCATTGCACCAGAGGTG; telokin 270-hprt, (sense) GAAGTAGGCTAAAGAGTTGAACGCA AAG and (antisense) GGCAGGGTTTTCCCAGTCACGACGTTG; and SM22{alpha}-hprt, (sense) GCACAGACTGCTCCAACTTGGTGTCTTTC and (antisense) CAACCCACCTGCCATTGCACCAGAGGTG. Male embryos were identified by using PCR primers (sense) GTACAAGTCTGCAGACTCTTCCAAC and (antisense) CCGAGGGTCTCCGGAATCCTTTCTTG that were designed to amplify the ZFY region on the Y chromosome.

beta-Galactosidase staining and histology. For whole mount analysis of beta-galactosidase expression in neonatal F1 mice and adult founder mice, tissues were rapidly excised and fixed for 1 h on ice in 2% paraformaldehyde-0.2% glutaraldehyde in phosphate-buffered saline (PBS). For analysis of expression in whole embryos, embryos were dissected free of the yolk sac and then treated as described for tissues. After fixation, tissues or embryos were washed four to six times with PBS and stained with X-Gal staining solution overnight at room temperature. X-Gal staining solution is composed of 0.5 mg/ml X-Gal, 5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6, 2 mM MgCl2, 0.2% Nonidet-P 40, 0.2% Tween 20, and 0.2% Triton X-100 in PBS. Tissues were then washed in PBS and further fixed in 4.0% paraformaldehyde overnight. After fixation, tissues were either directly photographed using a dissecting microscope and digital camera (Kodak MDS290) or dehydrated in increasing concentrations of ethanol and cleared in methyl salicylate before being photographed. Tissues for histological sections were excised, equilibrated in 20% sucrose in PBS overnight, frozen in tissue freezing medium (Triangle Biomedical Sciences), and sectioned at 8–12 µm. For analysis of beta-galactosidase expression, slides were fixed in 0.5% glutaraldehyde in PBS for 10 min at room temperature, washed in PBS, stained overnight with X-Gal staining solution, washed three times in PBS, and then counterstained with hematoxylin and eosin according to standard procedures. For analysis of smooth muscle myosin expression, sections were fixed in 3.7% formaldehyde and incubated with antibodies directed against SM1 smooth muscle myosin heavy chain; primary antibody was detected using fluorescein-conjugated anti-rabbit IgG, as described previously (13).


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Addition of insulator elements decreases ectopic expression of transgenes driven by the telokin promoter in embryos. Previously, work in our laboratory (17) has shown that a 370-bp mouse telokin promoter fragment can direct beta-galactosidase expression specifically to smooth muscle tissues in neonatal and adult mice. However, only 4 of 14 lines of transgenic mice harboring this transgene had detectable levels of transgene expression. In addition, we observed significant ectopic expression of the transgene at embryonic days (E)12.5 and E14.5 in these mice (Table 1 and data not shown). To determine whether the ectopic expression of telokin promoter-driven transgenes during embryonic development results from the influence of exogenous enhancer elements, we generated transgenic mice in which the transgene was flanked by insulator elements (see METHODS). Of the six positive transgenic lines obtained using this transgene cassette, only three lines had detectable levels of beta-galactosidase expression. In one of these three lines (line 3), expression levels were very low with onlya few smooth muscle cells staining in the gut and bladder (Table 1). The other two lines (lines 1 and 2) showed robust beta-galactosidase staining that was restricted to smooth muscle cells of the gastrointestinal (GI), genitourinary, and respiratory tracts in adult mice (Table 1). Low levels of expression also were observed in the abdominal aorta and mesenteric vessels. There was no detectable beta-galactosidase expression in the aortic arch, coronary or pulmonary vasculature, brain, cardiac muscle, or any other tissue examined (including liver, kidney, and skeletal muscle; data not shown). Only one of these lines (line 1) passed the transgene to the F1 generation, permitting analysis of embryonic expression. In embryos from this line, transgene expression was restricted to smooth muscle cells (Table 1). This pattern of expression mimics endogenous telokin, which also is restricted to smooth muscle cells throughout development (14).


View this table:
[in this window]
[in a new window]

 
Table 1. Relative expression levels of beta-galactosidase transgenes

 
Hprt-targeted transgenes recapitulate endogenous telokin expression in adult mice and during embryonic development. Because addition of insulator elements did not lead to increased numbers of mice exhibiting detectable levels of transgene expression, we next targeted transgenes to the X-linked hprt locus. Hprt is a housekeeping gene expressed in all cell types; hence, it would be anticipated that this locus would be transcriptionally favorable. The 370-bp AUG-LAC transgene, described previously (17), was introduced into the hprt-targeting vector pMP8SKB as shown in Fig. 1. Six chimeric male mice were generated from a telokin promoter transgene ES clone (clone 6, Fig. 1) and bred with C57/BL6J female mice. Five of these chimeras transmitted the transgene; three were used to establish transgenic lines. Four male hemizygous animals (F2–4) were analyzed from each line. To obtain homozygous transgenic female mice, we bred hemizygous male mice with heterozygous transgenic females. In all mice analyzed, beta-galactosidase was expressed at high levels in visceral smooth muscle cells throughout the GI tract, bladder, and bronchi. Low levels of expression were seen in the gallbladder, vascular smooth muscle cells of mesenteric vessels, vessels on the surface of the brain, abdominal aorta, vena cava, and renal vessels (Fig. 2 and Table 2). No transgene expression was detected in the thoracic aorta, pulmonary or coronary vasculature, or any other tissue such as heart, skeletal muscle, liver, or kidney. Within these tissues, transgene expression was restricted to smooth muscle cells (Fig. 2 and data not shown). The pattern of expression of this transgene mirrors that of endogenous telokin, which is expressed at high levels in visceral smooth muscle tissues and at lower levels in vascular smooth muscle (Table 2 and Refs. 5, 14). In contrast to endogenous telokin and transgene expression in T370 AUG-LAC and T370 pWhere mice, no beta-galactosidase activity was detected in the reproductive tract smooth muscle of the hprt-targeted mice.


View this table:
[in this window]
[in a new window]

 
Table 2. Hprt-targeted transgene expression pattern

 
The smooth muscle-specific pattern of transgene expression in T370-hprt mice was maintained throughout embryonic development. Expression was first detected at E11.5 in the umbilical artery (Fig. 3). By E12.5, expression also could be seen in the intestine and in a small group of cells at the apex of the heart. In E14.5 mice, robust expression was seen in the herniated gut and umbilical artery, and lower levels of expression could be seen in the bronchi, abdominal aorta, cerebral vasculature, and at the apex of the heart (Fig. 3). In sections obtained from E14.5 and E15.5 mice, beta-galactosidase expression was shown to be restricted to the smooth muscle cells in the bladder, gut, and umbilical vessels (Fig. 3 and data not shown). We were not able to detect the beta-galactosidase positive cells at the apex of the heart in histological sections; hence, the identity of these cells could not be determined.


Figure 3
View larger version (77K):
[in this window]
[in a new window]

 
Fig. 3. Expression of hprt-targeted telokin (–190 to +180) transgenes during embryonic development. Timed embryos were obtained from hprt-targeted 370-bp telokin promoter (–190 to +180) AUG-LAC transgenic mice as indicated. Positive male mice were identified by PCR, using transgene-specific primers and primers to the ZFY locus, which is located on the Y chromosome. Male embryos were processed for histochemical detection of beta-galactosidase expression as described in METHODS. Blue staining representing beta-galactosidase expression can be first seen at embryonic day (E)11.5 in the umbilical artery (UA). This staining is more pronounced at E12.5 and also can be seen in the intestine (I). Expression is further increased by E14.5, where staining can be seen in the intestine, umbilical artery, bronchi (Br), abdominal aorta (aA), cerebral and trunk vasculature (V), and on the surface of the apex of the heart (asterisk). No staining was detected in the thoracic aorta (tA), liver, or any other organ. Images in the bottom two panels are serial sections through an E14.5 embryo that were stained for beta-galactosidase (blue stain) and hematoxylin and eosin (X-Gal/H&E) or smooth muscle myosin heavy chain (SM1; green stain), as described in METHODS. Scale bar, 100 µm. beta-Galactosidase and SM1 staining can be seen in the midgut, umbilical artery (UA), and umbilical vein (UV).

 
Hprt-targeted SM22{alpha}-promoter driven transgenes are expressed in venous and bladder smooth muscle cells in addition to arterial smooth muscle cells. To determine whether the hprt-targeting system would be generally applicable to other smooth muscle-specific promoters, we also generated and characterized hprt transgenes driven by a –475 to +61 fragment of the SM22{alpha} promoter. Previously, workers in our laboratory (17) noted that transgenes driven by this SM22{alpha} promoter also exhibited variable patterns of expression in different lines of mice. In all of the hprt-targeted SM22{alpha} promoter-driven transgenic mice, derived from two independent ES clones, we observed an identical pattern of transgene expression. High levels of beta-galactosidase activity were detected in arteries and veins in small and large blood vessels, including mesenteric, abdominal, renal, thoracic, pulmonary, coronary, femoral, and brain vasculature. Little or no staining was observed in visceral smooth muscle tissues except in the bladder and gallbladder, which exhibited high levels of beta-galactosidase activity (Fig. 4 and Table 2). Some staining also was observed in the main branches of bronchi at the entrance to the lung but was not detected in the trachea or further along the bronchi or bronchioles. In E12.5 mice, we observed strong beta-galactosidase staining in dorsal aorta, umbilical artery and vein, vitelline vessels, heart, and somites. By E14.5, expression in heart and somites had declined and expression in small blood vessels throughout the head and limbs increased (Fig. 5).


Figure 4
View larger version (97K):
[in this window]
[in a new window]

 
Fig. 4. Expression of an hprt-targeted SM22{alpha} transgene in adult mice. Tissues were rapidly dissected from a positive hemizygous male hprt-targeted 536-bp SM22{alpha} promoter (–475 to +61) AUG-LAC transgenic mouse, fixed, and stained for beta-galactosidase expression as described in METHODS. This transgene resulted in high levels of beta-galactosidase expression in smooth muscle tissues of the mesenteric arteries (mA) and veins (mV), renal artery (RA) and vein (RV), abdominal aorta (aA) and vena cava (aV), thoracic aorta (tA) and vena cava (tV), pulmonary artery (PA) and vein (PV), bronchi (Br), atria (AT), coronary and brain vessels, bladder, and gallbladder. No expression was detected in colon, duodenum, stomach, jejunum, uterus, or skeletal muscle cells. Identical patterns of transgene expression were observed in 2 hemizygous male and 2 homozygous female mice obtained from each of two SM22{alpha} transgenic lines. Each of these lines was generated from an independently targeted ES cell clone.

 

Figure 5
View larger version (82K):
[in this window]
[in a new window]

 
Fig. 5. Expression of hprt-targeted SM22{alpha} transgenes in embryonic mice. Timed embryos were obtained from hprt-targeted 536-bp SM22{alpha} promoter (–475 to +61) AUG-LAC transgenic mice as indicated. Positive male mice were identified by PCR using transgene specific primers and primers to the ZFY locus, which is located on the Y chromosome. Embryos were processed for histochemical detection of beta-galactosidase expression as described in METHODS. Blue staining representing beta-galactosidase expression can be seen in umbilical artery (UA) and vein (UV), vitelline artery (VA) and vein (VV), abdominal aorta (aA), heart (H), and somites (S) at E12.5. By E14.5, expression decreased in the heart, somites, and abdominal aorta.

 
Cis-acting elements located 5' of the AT-rich/CArG core of the mouse telokin promoter are necessary for driving expression in GI smooth muscle cells. Previously, our group (18) showed that the –94 to –49 core of the telokin promoter, which includes an AT-rich region and CArG box, is required for telokin transcription in vivo. To determine whether this region is sufficient to drive telokin promoter activity, we generated an hprt-targeted transgene containing a fragment of the telokin promoter extending from –90 to +180. In all neonatal mice harboring this transgene, there was almost no transgene expression detected in intestinal smooth muscle cells (Fig. 6 and Table 2). Although expression in bladder smooth muscle cells was also reduced, compared with expression in transgenes driven by the larger –190 to +180 telokin promoter fragment (compare Figs. 2 and 6), it remained significantly higher than in intestinal smooth muscle cells (Fig. 6). Expression levels in mesenteric, renal, and brain vasculature also decreased slightly, and expression in bronchi, abdominal aorta, and vena cava was not detectable.


Figure 6
View larger version (90K):
[in this window]
[in a new window]

 
Fig. 6. Expression of hprt-targeted telokin 270-bp (–94 to +180) transgenes. Tissues were collected from a positive hemizygous neonatal male hprt-targeted 270-bp telokin promoter (–94 to +180) AUG-LAC transgenic mouse or from an E14.5 transgenic mouse. Tissues and embryos were processed for histochemical detection of beta-galactosidase expression as described in METHODS. Blue staining representing beta-galactosidase expression adult mice can be seen at low levels in bladder, mesenteric vessels, and brain vasculature. Blue staining in E14.5 is seen in umbilical artery (UA). An identical staining pattern also was observed in hemizygous male mice obtained from an independently targeted ES clone.

 
The CArG box in the mouse telokin promoter is required for telokin promoter activity in all smooth muscle tissues. Our group's (15) previous in vitro results suggest that a CArG element is crucial for telokin promoter activity. In addition, deletion of the CArG element together with the adjacent AT-rich region abolished the activity of the endogenous telokin promoter (18). To determine whether CArG element alone is required for telokin promoter activity, we mutated this element to ablate SRF binding within the context of the 370-bp –190 to +180 telokin promoter. Two lines of hprt-targeted transgenes were generated from independently targeted ES clones. In all adult and embryonic mice harboring this transgene, no specific beta-galactosidase expression was detected in any tissue (Table 2).


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Results demonstrate that a single copy of the telokin promoter targeted to the hprt locus is able to reproducibly drive high levels of transgene expression specifically in smooth muscle tissues throughout mouse development. Most importantly, the pattern of expression of this transgene largely recapitulated the expression of the endogenous telokin. Although flanking telokin promoter-driven transgenes with insulator elements abolished ectopic transgene expression, 50% of the lines of mice harboring these transgenes still did not exhibit detectable levels of transgene expression (Table 1). Because the insulators should block the activity of repressor elements, the lack of expression in many lines may be due to the integration of the transgene at sites of compact, inactive chromatin. If transgenes integrate into sites of compact chromatin structure, then the activity of the transgene will depend on the ability of the regulatory elements within the transgene to modify chromatin structure, allowing appropriate transcription factors to bind and activate the promoter. All of the telokin promoter-driven transgenic lines derived from a single ES clone in which the transgene was targeted to the hprt locus, exhibited high levels of transgene expression. We also observed a similar pattern of expression when this promoter was used to drive expression of an enhanced green fluorescent protein transgene targeted to the hprt locus (data not shown). Thus, when placed in a region of relaxed, open chromatin structure, such as the hprt locus, the 370-bp telokin promoter is able to mediate high levels of tissue-restricted transgene expression. This then raises the question of how the telokin promoter is active in its endogenous location if it is not able to remodel chromatin structure. The telokin gene locus is, however, rather unusual in that the telokin promoter is located within an intron of the larger mylk1 gene (9, 12, 16). In addition to telokin, the mylk1 gene encodes at least two myosin light chain kinase (MLCK) isoforms, the 220- and 130-kDa MLCK (12). Each of these protein kinases is transcribed from it's own independent promoter within the mylk1 gene, rather than arising from alternative splicing (12, 34). MLCKs are expressed in most, if not all, tissues in adult and embryonic mice (11); hence, it would be anticipated that the mlck/telokin locus would be expected to have a transcriptionally active, open chromatin configuration in most cells throughout development. This proposal suggests that upstream elements in the mylk1 gene exist that are responsible for maintaining the chromatin structure of the telokin promoter in a relatively open conformation. Further studies are required to confirm this possibility.

The visceral smooth muscle-selective pattern of expression of hprt-targeted telokin promoter-driven transgenes parallels endogenous telokin expression. In both adult and embryonic mice, endogenous telokin is expressed at higher levels in most visceral smooth muscle tissues compared with vascular smooth muscle tissues (5, 9, 14). Hprt-targeted telokin promoter transgene expression was observed in cells on the surface of the apex of the heart in E12.5-E14.5 mice (Fig. 3). This may reflect ectopic expression resulting from an influence of the hprt locus on the transgene, because endogenous telokin expression has not been observed in embryonic mouse heart (14). However, given that beta-galactosidase expression in these cells is low and could not be detected in tissue sections, it is possible that expression of endogenous telokin in these cells also may not have been detected in our group's previous in situ hybridization study (14). Our inability to detect beta-galactosidase expression in these cells on tissue sections has prevented us from further characterizing these cells to determine their identity. In contrast to endogenous telokin, hprt-targeted telokin promoter transgene expression was not observed in smooth muscles of the male or female reproductive tract (Table 2). Since both telokin promoter pWhere and AUG-LAC transgenes exhibit transgene expression in uterine smooth muscle (Table 1), this would suggest that the lack of expression of hprt-targeted transgene expression in uterine smooth muscle most likely results from ectopic influences of the hprt locus.

Although previous studies have shown that SM22{alpha} promoter transgenes are restricted to arterial smooth muscle, we also observed high levels of expression in bladder, gallbladder, and veins when the transgene was targeted to the hprt locus (Fig. 4). Moreover, venous expression was observed not only in adult animals but also through embryonic development at E12.5 and E14.5 in the umbilical veins (Fig. 5). Although the hprt-targeted SM22{alpha} transgenes more closely recapitulate endogenous SM22{alpha} expression, which is expressed in all smooth muscle tissues (2, 20, 22), the lack of transgene expression in GI and reproductive tract smooth muscle cells suggests that additional, more distal, regulatory elements are required to drive SM22{alpha} expression in these tissues. In support of this proposal, a BAC clone encompassing the SM22{alpha} gene was expressed in all smooth muscle tissues in transgenic mice (33). The expression of the hprt-targeted SM22{alpha} transgenes in bladder and veins also suggests that tissue-specific chromatin remodeling complexes may be important for regulating SM22{alpha} expression. Alternatively, it is possible that regulatory elements within the hprt locus are affecting the activity of the SM22{alpha} promoter to increase expression in veins and bladder smooth muscle.

The reproducible pattern of expression of telokin- and SM22{alpha}-driven transgenes targeted to the hprt locus permitted us to begin to dissect the role of individual elements within these promoters. A telokin promoter fragment extending from –90 to +180 exhibited a marked decrease in expression compared with a –190 to +180 transgene (Fig. 6). Transgene expression in the GI tract was particularly affected with only a few isolated cells staining positive for beta-galactosidase activity (Fig. 6). This result is in contrast to in vitro data in which deletion of the –190 to –94 region resulted in only a 30% decrease in reporter gene activity in A10 smooth muscle cells (17). However, the small change in activity in A10 cells may reflect cell-specific differences, because the low levels of transgene expression seen in the vasculature did not appear to be as significantly affected by deletion of the –190 to –90 region as transgene expression in the GI tract (Fig. 6). Together, these data suggest that the –190 to –90 region of the telokin promoter is required for high levels of telokin expression and that this fragment is particularly important in smooth muscle cells of the GI tract. Although we do not yet know which transcription factors bind to this region, analysis of the sequence of the –190 to –90 region using rVISTA revealed the presence of a conserved Sox binding site. Since Sox family members have been shown to play a role in GI tract development, it is tempting to propose that they may be contributing to telokin expression in the GI tract (29).

Previous studies have demonstrated that SRF binds to this CArG box in the telokin promoter, in intact chromatin, and in smooth muscle cells and that myocardin can strongly activate the promoter through its interaction with SRF bound to this site (36). Myocardin has been shown to be a powerful coactivator of SRF on smooth muscle-specific genes and to be required for vascular smooth muscle development (4, 7, 24, 32, 35). In the current study we also have shown that the CArG box is required for telokin expression in all smooth muscle tissues in vivo (Table 2). However, the CArG box and adjacent AT-rich region are not sufficient for telokin promoter activity in vivo in most smooth muscle tissues, because a –90 to +180 telokin transgene was not expressed at significant levels in the GI tract, reproductive tract, or airway smooth muscle. Together, these data suggest that, in these smooth muscle tissues, myocardin must cooperate with other factors to drive telokin expression.

In summary, the reproducibility of hprt-targeted telokin and SM22{alpha} promoter transgene expression will greatly facilitate analysis of the tissue-specific roles of cis-acting elements within these promoters. The advantage of this approach is that a single copy of the transgene integrates at a defined locus; this thus permits quantitative comparison of transgene expression driven by wild-type and mutant promoters.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Institutes of Health Grants HL-58571, DK-61130, and DK-65644 (to B. P. Herring).


    ACKNOWLEDGMENTS
 
We thank Hong Fang for expert technical support, Jiliang Zhou for the T370 CArG mutant plasmid, and Dr. Patricia Gallagher for critical comments on this manuscript.


    FOOTNOTES
 

Address for reprint requests and other correspondence: B. P. Herring, Dept. of Cellular and Integrative Physiology, Indiana Univ. School of Medicine, 635 Barnhill Drive, Indianapolis, IN 46202 (e-mail: pherring{at}iupui.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Bronson SK, Plaehn EG, Kluckman KD, Hagaman JR, Maeda N, Smithies O. Single-copy transgenic mice with chosen-site integration. Proc Natl Acad Sci USA 93: 9067–9072, 1996.[Abstract/Free Full Text]

2. Camoretti-Mercado B, Forsythe SM, LeBeau MM, Espinosa R 3rd, Vieira JE, Halayko AJ, Willadsen S, Kurtz B, Ober C, Evans GA, Thweatt R, Shapiro S, Niu Q, Qin Y, Padrid PA, Solway J. Expression and cytogenetic localization of the human SM22 gene (TAGLN). Genomics 49: 452–457, 1998.[CrossRef][Web of Science][Medline]

3. Chang DF, Belaguli NS, Iyer D, Roberts WB, Wu SP, Dong XR, Marx JG, Moore MS, Beckerle MC, Majesky MW, Schwartz RJ. Cysteine-rich LIM-only proteins CRP1 and CRP2 are potent smooth muscle differentiation cofactors. Dev Cell 4: 107–118, 2003.[CrossRef][Web of Science][Medline]

4. Chen J, Kitchen CM, Streb JW, Miano JM. Myocardin: a component of a molecular switch for smooth muscle differentiation. J Mol Cell Cardiol 34: 1345–1356, 2002.[CrossRef][Web of Science][Medline]

5. Choudhury N, Khromov AS, Somlyo AP, Somlyo AV. Telokin mediates Ca2+-desensitization through activation of myosin phosphatase in phasic and tonic smooth muscle. J Muscle Res Cell Motil 25: 657–665, 2004.[CrossRef][Web of Science][Medline]

6. Cvetkovic B, Yang B, Williamson RA, Sigmund CD. Appropriate tissue- and cell-specific expression of a single copy human angiotensinogen transgene specifically targeted upstream of the HPRT locus by homologous recombination. J Biol Chem 275: 1073–1078, 2000.[Abstract/Free Full Text]

7. Du KL, Ip HS, Li J, Chen M, Dandre F, Yu W, Lu MM, Owens GK, Parmacek MS. Myocardin is a critical serum response factor cofactor in the transcriptional program regulating smooth muscle cell differentiation. Mol Cell Biol 23: 2425–2437, 2003.[Abstract/Free Full Text]

8. Evans V, Hatzopoulos A, Aird WC, Rayburn HB, Rosenberg RD, Kuivenhoven JA. Targeting the Hprt locus in mice reveals differential regulation of Tie2 gene expression in the endothelium. Physiol Genomics 2: 67–75, 2000.[Abstract/Free Full Text]

9. Gallagher PJ, Herring BP. The carboxyl terminus of the smooth muscle myosin light chain kinase is expressed as an independent protein, telokin. J Biol Chem 266: 23945–23952, 1991.[Abstract/Free Full Text]

10. Guillot PV, Liu L, Kuivenhoven JA, Guan J, Rosenberg RD, Aird WC. Targeting of human eNOS promoter to the Hprt locus of mice leads to tissue-restricted transgene expression. Physiol Genomics 2: 77–83, 2000.[Abstract/Free Full Text]

11. Herring BP, Dixon S, Gallagher PJ. Smooth muscle myosin light chain kinase expression in cardiac and skeletal muscle. Am J Physiol Cell Physiol 279: C1656–C1664, 2000.[Abstract/Free Full Text]

12. Herring BP, El-Mounayri O, Gallagher PJ, Yin F, Zhou J. Regulation of myosin light chain kinase and telokin expression in smooth muscle tissues. Am J Physiol Cell Physiol 291: C817–C827, 2006.[Abstract/Free Full Text]

13. Herring BP, Hoggatt AM, Smith AF, Gallagher PJ. Targeted expression of SV40 large T-antigen to visceral smooth muscle induces proliferation of contractile smooth muscle cells and results in megacolon. J Biol Chem 274: 17725–17732, 1999.[Abstract/Free Full Text]

14. Herring BP, Lyons GE, Hoggatt AM, Gallagher PJ. Telokin expression is restricted to smooth muscle tissues during mouse development. Am J Physiol Cell Physiol 280: C12–C21, 2001.[Abstract/Free Full Text]

15. Herring BP, Smith AF. Telokin expression in A10 smooth muscle cells requires serum response factor. Am J Physiol Cell Physiol 272: C1394–C1404, 1997.[Abstract/Free Full Text]

16. Herring BP, Smith AF. Telokin expression is mediated by a smooth muscle cell-specific promoter. Am J Physiol Cell Physiol 270: C1656–C1665, 1996.[Abstract/Free Full Text]

17. Hoggatt AM, Simon GM, Herring BP. Cell-specific regulatory modules control expression of genes in vascular and visceral smooth muscle tissues. Circ Res 91: 1151–1159, 2002.[Abstract/Free Full Text]

18. Khromov AS, Wang H, Choudhury N, McDuffie M, Herring BP, Nakamoto R, Owens GK, Somlyo AP, Somlyo AV. Smooth muscle of telokin-deficient mice exhibits increased sensitivity to Ca2+ and decreased cGMP-induced relaxation. Proc Natl Acad Sci USA 103: 2440–2445, 2006.[Abstract/Free Full Text]

19. Kim S, Ip HS, Lu MM, Clendenin C, Parmacek MS. A serum response factor-dependent transcriptional regulatory program identifies distinct smooth muscle cell sublineages. Mol Cell Biol 17: 2266–2278, 1997.[Abstract]

20. Lees-Miller JP, Heeley DH, Smillie LB. An abundant and novel protein of 22 kDa (SM22) is widely distributed in smooth muscles. Purification from bovine aorta. Biochem J 244: 705–709, 1987.[Web of Science][Medline]

21. Li J, Zhu X, Chen M, Cheng L, Zhou D, Lu MM, Du K, Epstein JA, Parmacek MS. Myocardin-related transcription factor B is required in cardiac neural crest for smooth muscle differentiation and cardiovascular development. Proc Natl Acad Sci USA 102: 8916–8921, 2005.[Abstract/Free Full Text]

22. Li L, Miano JM, Cserjesi P, Olson EN. SM22{alpha}, a marker of adult smooth muscle, is expressed in multiple myogenic lineages during embryogenesis. Circ Res 78: 188–195, 1996.[Abstract/Free Full Text]

23. Li L, Miano JM, Mercer B, Olson EN. Expression of the SM22{alpha} promoter in transgenic mice provides evidence for distinct transcriptional regulatory programs in vascular and visceral smooth muscle cells. J Cell Biol 132: 849–859, 1996.[Abstract/Free Full Text]

24. Li S, Wang DZ, Wang Z, Richardson JA, Olson EN. The serum response factor coactivator myocardin is required for vascular smooth muscle development. Proc Natl Acad Sci USA 100: 9366–9370, 2003.[Abstract/Free Full Text]

25. Manabe I, Owens GK. CArG elements control smooth muscle subtype-specific expression of smooth muscle myosin in vivo. J Clin Invest 107: 823–834, 2001.[Web of Science][Medline]

26. Manabe I, Owens GK. The smooth muscle myosin heavy chain gene exhibits smooth muscle subtype-selective modular regulation in vivo. J Biol Chem 276: 39076–39087, 2001.[Abstract/Free Full Text]

27. Minami T, Donovan DJ, Tsai JC, Rosenberg RD, Aird WC. Differential regulation of the von Willebrand factor and Flt-1 promoters in the endothelium of hypoxanthine phosphoribosyltransferase-targeted mice. Blood 100: 4019–4025, 2002.[Abstract/Free Full Text]

28. Moessler H, Mericskay M, Li Z, Nagl S, Paulin D, Small JV. The SM 22 promoter directs tissue-specific expression in arterial but not in venous or visceral smooth muscle cells in transgenic mice. Development 122: 2415–2425, 1996.[Abstract]

29. Moniot B, Biau S, Faure S, Nielsen CM, Berta P, Roberts DJ, de Santa Barbara P. SOX9 specifies the pyloric sphincter epithelium through mesenchymal-epithelial signals. Development 131: 3795–3804, 2004.[Abstract/Free Full Text]

30. Oh J, Richardson JA, Olson EN. Requirement of myocardin-related transcription factor-B for remodeling of branchial arch arteries and smooth muscle differentiation. Proc Natl Acad Sci USA 102: 15122–15127, 2005.[Abstract/Free Full Text]

31. Vivian JL, Klein WH, Hasty P. Temporal, spatial and tissue-specific expression of a myogenin-lacZ transgene targeted to the Hprt locus in mice. Biotechniques 27: 154–162, 1999.[Web of Science][Medline]

32. Wang Z, Wang DZ, Pipes GC, Olson EN. Myocardin is a master regulator of smooth muscle gene expression. Proc Natl Acad Sci USA 100: 7129–7134, 2003.[Abstract/Free Full Text]

33. Xu R, Ho YS, Ritchie RP, Li L. Human SM22{alpha} BAC encompasses regulatory sequences for expression in vascular and visceral smooth muscles at fetal and adult stages. Am J Physiol Heart Circ Physiol 284: H1398–H1407, 2003.[Abstract/Free Full Text]

34. Yin F, Hoggatt AM, Zhou J, Herring BP. 130-kDa smooth muscle myosin light chain kinase is transcribed from a CArG-dependent, internal promoter within the mouse mylk gene. Am J Physiol Cell Physiol 290: C1599–C1609, 2006.[Abstract/Free Full Text]

35. Yoshida T, Sinha S, Dandre F, Wamhoff BR, Hoofnagle MH, Kremer BE, Wang DZ, Olson EN, Owens GK. Myocardin is a key regulator of CArG-dependent transcription of multiple smooth muscle marker genes. Circ Res 92: 856–864, 2003.[Abstract/Free Full Text]

36. Zhou J, Herring BP. Mechanisms responsible for the promoter-specific effects of myocardin. J Biol Chem 280: 10861–10869, 2005.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Physiol. GenomicsHome page
G. Palais, A. Nguyen Dinh Cat, H. Friedman, N. Panek-Huet, A. Millet, F. Tronche, B. Gellen, J.-J. Mercadier, A. Peterson, and F. Jaisser
Targeted transgenesis at the HPRT locus: an efficient strategy to achieve tightly controlled in vivo conditional expression with the tet system
Physiol Genomics, April 10, 2009; 37(2): 140 - 146.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/3/C1024    most recent
00445.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Touw, K.
Right arrow Articles by Herring, B. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Touw, K.
Right arrow Articles by Herring, B. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.