|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MUSCLE CELL BIOLOGY AND CELL MOTILITY
Department of Cellular and Integrative Physiology, Indiana University School of Medicine, Indianapolis, Indiana
Submitted 18 August 2006 ; accepted in final form 31 October 2006
| ABSTRACT |
|---|
|
|
|---|
promoters have previously been shown to direct smooth muscle cell-specific expression of transgenes in vivo in adult mice. However, the activity of these promoters is highly dependent on the integration site of the transgene. In the current study, we found that the ectopic expression of telokin promoter transgenes could be abolished by flanking the transgene with insulator elements from the H19 gene. However, the insulator elements did not increase the proportion of mouse lines that exhibited consistent, detectable levels of transgene expression. In contrast, when transgenes were targeted to the hprt locus, both telokin and SM22
promoters resulted in reproducible patterns and levels of transgene expression in all lines of mice examined. Telokin promoter transgene expression was restricted to smooth muscle tissues in adult and embryonic mice. As reported previously, SM22
transgenes were expressed at high levels specifically in arterial smooth muscle cells; however, in contrast to randomly integrated transgenes, the hprt-targeted SM22
transgenes were also expressed at high levels in smooth muscle cells in veins, bladder, and gallbladder. Using hprt-targeted transgenes, we further analyzed elements within the telokin promoter required for tissue specific activity in vivo. Analysis of these transgenes revealed that the CArG element in the telokin promoter is required for promoter activity in all tissues and that the CArG element and adjacent AT-rich region are sufficient to drive transgene expression in bladder but not intestinal smooth muscle cells. visceral smooth muscle; development; myosin light chain kinase; embryos; CArG element
To better understand the mechanisms regulating expression of genes in distinct smooth muscle tissues, it is necessary to carefully analyze the relative importance of individual cis-acting regulatory elements in regulating expression of these genes in each tissue in vivo. Previous studies that have analyzed the activity of smooth muscle-specific promoters in transgenic mice in vivo have utilized standard transgenic approaches. One of the limitations of this approach is that the site of integration of the transgene and the transgene copy number can greatly affect both the pattern and level of transgene expression. For example, in our analysis of telokin promoter transgenes, we observed that the majority of transgenic lines exhibited no detectable transgene expression (17). In addition, the pattern of transgene expression driven by an SM22
promoter was distinct in different transgenic lines, with most lines exhibiting artery-specific expression, whereas some showed additional expression in veins and in heart (17). In general, telokin promoter transgenes are expressed at highest levels in visceral smooth muscle tissues (17); in contrast, SM22
transgenes are most highly expressed in vascular smooth muscle tissues (19, 23, 28). The reciprocal expression of telokin and SM22
transgenes makes these two promoters good tools for identifying regulatory elements that direct transcription to distinct smooth muscle tissues. However, the variable patterns and levels of expression of these transgenes make analysis of regulatory elements within these promoters difficult, requiring the analysis of large numbers of independent founder lines. To be able to determine the relative importance of regulatory elements in different smooth muscle tissues, it is necessary to generate transgenic mice in which the activity of wild-type promoters are highly reproducible in terms of both their levels and tissue-specific patterns of activity.
In the current study we used two different approaches to decrease the variability in the pattern and level of transgene expression. In the first approach, we used a transgene cassette in which the transgene is flanked by insulator elements from the H19 gene. In a second approach, we targeted single-copy transgenes adjacent to the hypoxanthine phosphoribosyltransferase (hprt) locus, using homologous recombination in embryonic stem (ES) cells. Hprt is a housekeeping gene expressed in all cell types; hence, it would be anticipated that this locus would be transcriptionally favorable. Although this approach has not been utilized for smooth muscle-specific promoters, previous studies using endothelial cell-specific promoters demonstrated that, when targeted to this locus, these promoters exhibit very reproducible endothelium-specific expression (6, 8, 10, 27). Similarly, the myogenin promoter also exhibited appropriate skeletal muscle-specific expression when targeted to the hprt locus (31).
Results from the current studies demonstrate that telokin promoter-driven transgenes exhibited greatly reduced ectopic expression when flanked by insulator elements. However, the levels of transgene expression still remained highly variable between transgenic lines. In contrast, hprt-targeted telokin promoter transgenes exhibited faithful, reproducible patterns and levels of transgene expression in all animals examined. In hprt-targeted telokin promoter transgenes, similar to endogenous telokin, expression was restricted to visceral and, to a lesser extent, vascular smooth muscle tissues. The reproducible patterns and levels of transgene expression allowed us to begin to determine the importance of specific regulatory elements within the telokin promoter. We found that although mutation of the CArG box was sufficient to abolish transgene expression in all smooth muscle tissues, a core promoter extending from 90 to +180, which included an AT-rich region and the CArG box, was not sufficient for high levels of transgene expression in most smooth muscle tissues. Analysis of hprt-targeted SM22
promoter transgenes demonstrated that the hprt-targeting system is universally applicable to smooth muscle-restricted promoters. These transgenes also exhibited a very reproducible pattern of transgene expression in all animals analyzed. Hprt-targeted SM22
transgenes were transiently expressed in embryonic skeletal and cardiac muscle and robustly expressed specifically in embryonic and adult arterial, venous, and bladder smooth muscle tissues.
| METHODS |
|---|
|
|
|---|
-galactosidase gene, followed by an SV40 large T-antigen polyadenylation sequence, as described previously (17). To generate a transgene that is flanked by insulator elements, the 370-bp mouse telokin promoter fragment extending from 180 to +190 was amplified by PCR, digested with Xho, and ligated into the pWhere vector (InvivoGen, San Diego, CA). Restriction digestion and DNA sequencing were performed to confirm the orientation and integrity of the resultant plasmid such that the promoter is located in the 5'-3' orientation 5' of a modified LACz gene in which all CpG sequences are mutated and a SV40 nuclear localization is added (T370-pWhere). The Indiana University Transgenic Mouse Facility generated all standard transgenic lines in C3H mice; founders were then bred with DBA/2 mice to establish stable lines. Transgenic animals were identified by PCR.
To generate hprt-targeted transgenes, telokin promoter fragments extending from 190 to +180 (T370), 90 to +180 (T270), a 180 to +190 telokin promoter harboring a mutation in the CArG element, and a 475 to +61 SM22
promoter were cloned into the AUG-LAC
-galactosidase vector. The AUG-LAC transgene vectors were then digested with appropriate restriction enzymes and cloned into the pMP8SKB hprt-targeting vector, kindly provided by Dr. Sara Bronson (1). This resulted in the placement of the promoter, LAC cDNA, and SV40 polyA sequence 5' of the hprt promoter (
Fig. 2). The resultant targeting constructs were linearized by digestion with SalI and electroporated into BK4 embryonic stem cells by the Indiana University Transgenic Mouse Facility (1). Correctly targeted embryonic stem cells have repaired the mutant hprt gene in BK4 ES cells and therefore can be selected using hypoxanthine and thymidine (HAT) medium. HAT-resistant clones were expanded, and genomic DNA was isolated (Puregene; Gentra Systems, Minneapolis, MN). Homologous recombination was then confirmed by Southern blot analysis of genomic DNA digested with BamHI. Wild-type BK4 cells have a 9-kb BamHI fragment that hybridizes to an exon 3-derived probe, whereas cells harboring the targeted telokin transgene have an
12-kb fragment (Fig. 1). For all hprt-targeted transgenes (except T370 AUG LAC, in which chimeras derived from only 1 ES line transmitted the transgene), lines of mice were established from two independently targeted ES clones. Because the hprt gene is on the X chromosome, transgene expression was analyzed in hemizygous male mice or in homozygous female mice.
|
|
-hprt, (sense) GCACAGACTGCTCCAACTTGGTGTCTTTC and (antisense) CAACCCACCTGCCATTGCACCAGAGGTG. Male embryos were identified by using PCR primers (sense) GTACAAGTCTGCAGACTCTTCCAAC and (antisense) CCGAGGGTCTCCGGAATCCTTTCTTG that were designed to amplify the ZFY region on the Y chromosome.
-Galactosidase staining and histology.
For whole mount analysis of
-galactosidase expression in neonatal F1 mice and adult founder mice, tissues were rapidly excised and fixed for 1 h on ice in 2% paraformaldehyde-0.2% glutaraldehyde in phosphate-buffered saline (PBS). For analysis of expression in whole embryos, embryos were dissected free of the yolk sac and then treated as described for tissues. After fixation, tissues or embryos were washed four to six times with PBS and stained with X-Gal staining solution overnight at room temperature. X-Gal staining solution is composed of 0.5 mg/ml X-Gal, 5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6, 2 mM MgCl2, 0.2% Nonidet-P 40, 0.2% Tween 20, and 0.2% Triton X-100 in PBS. Tissues were then washed in PBS and further fixed in 4.0% paraformaldehyde overnight. After fixation, tissues were either directly photographed using a dissecting microscope and digital camera (Kodak MDS290) or dehydrated in increasing concentrations of ethanol and cleared in methyl salicylate before being photographed. Tissues for histological sections were excised, equilibrated in 20% sucrose in PBS overnight, frozen in tissue freezing medium (Triangle Biomedical Sciences), and sectioned at 812 µm. For analysis of
-galactosidase expression, slides were fixed in 0.5% glutaraldehyde in PBS for 10 min at room temperature, washed in PBS, stained overnight with X-Gal staining solution, washed three times in PBS, and then counterstained with hematoxylin and eosin according to standard procedures. For analysis of smooth muscle myosin expression, sections were fixed in 3.7% formaldehyde and incubated with antibodies directed against SM1 smooth muscle myosin heavy chain; primary antibody was detected using fluorescein-conjugated anti-rabbit IgG, as described previously (13).
| RESULTS |
|---|
|
|
|---|
-galactosidase expression specifically to smooth muscle tissues in neonatal and adult mice. However, only 4 of 14 lines of transgenic mice harboring this transgene had detectable levels of transgene expression. In addition, we observed significant ectopic expression of the transgene at embryonic days (E)12.5 and E14.5 in these mice (Table 1 and data not shown). To determine whether the ectopic expression of telokin promoter-driven transgenes during embryonic development results from the influence of exogenous enhancer elements, we generated transgenic mice in which the transgene was flanked by insulator elements (see METHODS). Of the six positive transgenic lines obtained using this transgene cassette, only three lines had detectable levels of
-galactosidase expression. In one of these three lines (line 3), expression levels were very low with onlya few smooth muscle cells staining in the gut and bladder (Table 1). The other two lines (lines 1 and 2) showed robust
-galactosidase staining that was restricted to smooth muscle cells of the gastrointestinal (GI), genitourinary, and respiratory tracts in adult mice (Table 1). Low levels of expression also were observed in the abdominal aorta and mesenteric vessels. There was no detectable
-galactosidase expression in the aortic arch, coronary or pulmonary vasculature, brain, cardiac muscle, or any other tissue examined (including liver, kidney, and skeletal muscle; data not shown). Only one of these lines (line 1) passed the transgene to the F1 generation, permitting analysis of embryonic expression. In embryos from this line, transgene expression was restricted to smooth muscle cells (Table 1). This pattern of expression mimics endogenous telokin, which also is restricted to smooth muscle cells throughout development (14).
|
-galactosidase was expressed at high levels in visceral smooth muscle cells throughout the GI tract, bladder, and bronchi. Low levels of expression were seen in the gallbladder, vascular smooth muscle cells of mesenteric vessels, vessels on the surface of the brain, abdominal aorta, vena cava, and renal vessels (Fig. 2 and Table 2). No transgene expression was detected in the thoracic aorta, pulmonary or coronary vasculature, or any other tissue such as heart, skeletal muscle, liver, or kidney. Within these tissues, transgene expression was restricted to smooth muscle cells (Fig. 2 and data not shown). The pattern of expression of this transgene mirrors that of endogenous telokin, which is expressed at high levels in visceral smooth muscle tissues and at lower levels in vascular smooth muscle (Table 2 and Refs. 5, 14). In contrast to endogenous telokin and transgene expression in T370 AUG-LAC and T370 pWhere mice, no
-galactosidase activity was detected in the reproductive tract smooth muscle of the hprt-targeted mice.
|
-galactosidase expression was shown to be restricted to the smooth muscle cells in the bladder, gut, and umbilical vessels (Fig. 3 and data not shown). We were not able to detect the
-galactosidase positive cells at the apex of the heart in histological sections; hence, the identity of these cells could not be determined.
|
-promoter driven transgenes are expressed in venous and bladder smooth muscle cells in addition to arterial smooth muscle cells. To determine whether the hprt-targeting system would be generally applicable to other smooth muscle-specific promoters, we also generated and characterized hprt transgenes driven by a 475 to +61 fragment of the SM22
promoter. Previously, workers in our laboratory (17) noted that transgenes driven by this SM22
promoter also exhibited variable patterns of expression in different lines of mice. In all of the hprt-targeted SM22
promoter-driven transgenic mice, derived from two independent ES clones, we observed an identical pattern of transgene expression. High levels of
-galactosidase activity were detected in arteries and veins in small and large blood vessels, including mesenteric, abdominal, renal, thoracic, pulmonary, coronary, femoral, and brain vasculature. Little or no staining was observed in visceral smooth muscle tissues except in the bladder and gallbladder, which exhibited high levels of
-galactosidase activity (Fig. 4 and Table 2). Some staining also was observed in the main branches of bronchi at the entrance to the lung but was not detected in the trachea or further along the bronchi or bronchioles. In E12.5 mice, we observed strong
-galactosidase staining in dorsal aorta, umbilical artery and vein, vitelline vessels, heart, and somites. By E14.5, expression in heart and somites had declined and expression in small blood vessels throughout the head and limbs increased (Fig. 5).
|
|
|
-galactosidase expression was detected in any tissue (Table 2). | DISCUSSION |
|---|
|
|
|---|
The visceral smooth muscle-selective pattern of expression of hprt-targeted telokin promoter-driven transgenes parallels endogenous telokin expression. In both adult and embryonic mice, endogenous telokin is expressed at higher levels in most visceral smooth muscle tissues compared with vascular smooth muscle tissues (5, 9, 14). Hprt-targeted telokin promoter transgene expression was observed in cells on the surface of the apex of the heart in E12.5-E14.5 mice (Fig. 3). This may reflect ectopic expression resulting from an influence of the hprt locus on the transgene, because endogenous telokin expression has not been observed in embryonic mouse heart (14). However, given that
-galactosidase expression in these cells is low and could not be detected in tissue sections, it is possible that expression of endogenous telokin in these cells also may not have been detected in our group's previous in situ hybridization study (14). Our inability to detect
-galactosidase expression in these cells on tissue sections has prevented us from further characterizing these cells to determine their identity. In contrast to endogenous telokin, hprt-targeted telokin promoter transgene expression was not observed in smooth muscles of the male or female reproductive tract (Table 2). Since both telokin promoter pWhere and AUG-LAC transgenes exhibit transgene expression in uterine smooth muscle (Table 1), this would suggest that the lack of expression of hprt-targeted transgene expression in uterine smooth muscle most likely results from ectopic influences of the hprt locus.
Although previous studies have shown that SM22
promoter transgenes are restricted to arterial smooth muscle, we also observed high levels of expression in bladder, gallbladder, and veins when the transgene was targeted to the hprt locus (Fig. 4). Moreover, venous expression was observed not only in adult animals but also through embryonic development at E12.5 and E14.5 in the umbilical veins (Fig. 5). Although the hprt-targeted SM22
transgenes more closely recapitulate endogenous SM22
expression, which is expressed in all smooth muscle tissues (2, 20, 22), the lack of transgene expression in GI and reproductive tract smooth muscle cells suggests that additional, more distal, regulatory elements are required to drive SM22
expression in these tissues. In support of this proposal, a BAC clone encompassing the SM22
gene was expressed in all smooth muscle tissues in transgenic mice (33). The expression of the hprt-targeted SM22
transgenes in bladder and veins also suggests that tissue-specific chromatin remodeling complexes may be important for regulating SM22
expression. Alternatively, it is possible that regulatory elements within the hprt locus are affecting the activity of the SM22
promoter to increase expression in veins and bladder smooth muscle.
The reproducible pattern of expression of telokin- and SM22
-driven transgenes targeted to the hprt locus permitted us to begin to dissect the role of individual elements within these promoters. A telokin promoter fragment extending from 90 to +180 exhibited a marked decrease in expression compared with a 190 to +180 transgene (Fig. 6). Transgene expression in the GI tract was particularly affected with only a few isolated cells staining positive for
-galactosidase activity (Fig. 6). This result is in contrast to in vitro data in which deletion of the 190 to 94 region resulted in only a 30% decrease in reporter gene activity in A10 smooth muscle cells (17). However, the small change in activity in A10 cells may reflect cell-specific differences, because the low levels of transgene expression seen in the vasculature did not appear to be as significantly affected by deletion of the 190 to 90 region as transgene expression in the GI tract (Fig. 6). Together, these data suggest that the 190 to 90 region of the telokin promoter is required for high levels of telokin expression and that this fragment is particularly important in smooth muscle cells of the GI tract. Although we do not yet know which transcription factors bind to this region, analysis of the sequence of the 190 to 90 region using rVISTA revealed the presence of a conserved Sox binding site. Since Sox family members have been shown to play a role in GI tract development, it is tempting to propose that they may be contributing to telokin expression in the GI tract (29).
Previous studies have demonstrated that SRF binds to this CArG box in the telokin promoter, in intact chromatin, and in smooth muscle cells and that myocardin can strongly activate the promoter through its interaction with SRF bound to this site (36). Myocardin has been shown to be a powerful coactivator of SRF on smooth muscle-specific genes and to be required for vascular smooth muscle development (4, 7, 24, 32, 35). In the current study we also have shown that the CArG box is required for telokin expression in all smooth muscle tissues in vivo (Table 2). However, the CArG box and adjacent AT-rich region are not sufficient for telokin promoter activity in vivo in most smooth muscle tissues, because a 90 to +180 telokin transgene was not expressed at significant levels in the GI tract, reproductive tract, or airway smooth muscle. Together, these data suggest that, in these smooth muscle tissues, myocardin must cooperate with other factors to drive telokin expression.
In summary, the reproducibility of hprt-targeted telokin and SM22
promoter transgene expression will greatly facilitate analysis of the tissue-specific roles of cis-acting elements within these promoters. The advantage of this approach is that a single copy of the transgene integrates at a defined locus; this thus permits quantitative comparison of transgene expression driven by wild-type and mutant promoters.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Camoretti-Mercado B, Forsythe SM, LeBeau MM, Espinosa R 3rd, Vieira JE, Halayko AJ, Willadsen S, Kurtz B, Ober C, Evans GA, Thweatt R, Shapiro S, Niu Q, Qin Y, Padrid PA, Solway J. Expression and cytogenetic localization of the human SM22 gene (TAGLN). Genomics 49: 452457, 1998.[CrossRef][Web of Science][Medline]
3. Chang DF, Belaguli NS, Iyer D, Roberts WB, Wu SP, Dong XR, Marx JG, Moore MS, Beckerle MC, Majesky MW, Schwartz RJ. Cysteine-rich LIM-only proteins CRP1 and CRP2 are potent smooth muscle differentiation cofactors. Dev Cell 4: 107118, 2003.[CrossRef][Web of Science][Medline]
4. Chen J, Kitchen CM, Streb JW, Miano JM. Myocardin: a component of a molecular switch for smooth muscle differentiation. J Mol Cell Cardiol 34: 13451356, 2002.[CrossRef][Web of Science][Medline]
5. Choudhury N, Khromov AS, Somlyo AP, Somlyo AV. Telokin mediates Ca2+-desensitization through activation of myosin phosphatase in phasic and tonic smooth muscle. J Muscle Res Cell Motil 25: 657665, 2004.[CrossRef][Web of Science][Medline]
6. Cvetkovic B, Yang B, Williamson RA, Sigmund CD. Appropriate tissue- and cell-specific expression of a single copy human angiotensinogen transgene specifically targeted upstream of the HPRT locus by homologous recombination. J Biol Chem 275: 10731078, 2000.
7. Du KL, Ip HS, Li J, Chen M, Dandre F, Yu W, Lu MM, Owens GK, Parmacek MS. Myocardin is a critical serum response factor cofactor in the transcriptional program regulating smooth muscle cell differentiation. Mol Cell Biol 23: 24252437, 2003.
8. Evans V, Hatzopoulos A, Aird WC, Rayburn HB, Rosenberg RD, Kuivenhoven JA. Targeting the Hprt locus in mice reveals differential regulation of Tie2 gene expression in the endothelium. Physiol Genomics 2: 6775, 2000.
9. Gallagher PJ, Herring BP. The carboxyl terminus of the smooth muscle myosin light chain kinase is expressed as an independent protein, telokin. J Biol Chem 266: 2394523952, 1991.
10. Guillot PV, Liu L, Kuivenhoven JA, Guan J, Rosenberg RD, Aird WC. Targeting of human eNOS promoter to the Hprt locus of mice leads to tissue-restricted transgene expression. Physiol Genomics 2: 7783, 2000.
11. Herring BP, Dixon S, Gallagher PJ. Smooth muscle myosin light chain kinase expression in cardiac and skeletal muscle. Am J Physiol Cell Physiol 279: C1656C1664, 2000.
12. Herring BP, El-Mounayri O, Gallagher PJ, Yin F, Zhou J. Regulation of myosin light chain kinase and telokin expression in smooth muscle tissues. Am J Physiol Cell Physiol 291: C817C827, 2006.
13. Herring BP, Hoggatt AM, Smith AF, Gallagher PJ. Targeted expression of SV40 large T-antigen to visceral smooth muscle induces proliferation of contractile smooth muscle cells and results in megacolon. J Biol Chem 274: 1772517732, 1999.
14. Herring BP, Lyons GE, Hoggatt AM, Gallagher PJ. Telokin expression is restricted to smooth muscle tissues during mouse development. Am J Physiol Cell Physiol 280: C12C21, 2001.
15. Herring BP, Smith AF. Telokin expression in A10 smooth muscle cells requires serum response factor. Am J Physiol Cell Physiol 272: C1394C1404, 1997.
16. Herring BP, Smith AF. Telokin expression is mediated by a smooth muscle cell-specific promoter. Am J Physiol Cell Physiol 270: C1656C1665, 1996.
17. Hoggatt AM, Simon GM, Herring BP. Cell-specific regulatory modules control expression of genes in vascular and visceral smooth muscle tissues. Circ Res 91: 11511159, 2002.
18. Khromov AS, Wang H, Choudhury N, McDuffie M, Herring BP, Nakamoto R, Owens GK, Somlyo AP, Somlyo AV. Smooth muscle of telokin-deficient mice exhibits increased sensitivity to Ca2+ and decreased cGMP-induced relaxation. Proc Natl Acad Sci USA 103: 24402445, 2006.
19. Kim S, Ip HS, Lu MM, Clendenin C, Parmacek MS. A serum response factor-dependent transcriptional regulatory program identifies distinct smooth muscle cell sublineages. Mol Cell Biol 17: 22662278, 1997.[Abstract]
20. Lees-Miller JP, Heeley DH, Smillie LB. An abundant and novel protein of 22 kDa (SM22) is widely distributed in smooth muscles. Purification from bovine aorta. Biochem J 244: 705709, 1987.[Web of Science][Medline]
21. Li J, Zhu X, Chen M, Cheng L, Zhou D, Lu MM, Du K, Epstein JA, Parmacek MS. Myocardin-related transcription factor B is required in cardiac neural crest for smooth muscle differentiation and cardiovascular development. Proc Natl Acad Sci USA 102: 89168921, 2005.
22. Li L, Miano JM, Cserjesi P, Olson EN. SM22
, a marker of adult smooth muscle, is expressed in multiple myogenic lineages during embryogenesis. Circ Res 78: 188195, 1996.
23. Li L, Miano JM, Mercer B, Olson EN. Expression of the SM22
promoter in transgenic mice provides evidence for distinct transcriptional regulatory programs in vascular and visceral smooth muscle cells. J Cell Biol 132: 849859, 1996.
24. Li S, Wang DZ, Wang Z, Richardson JA, Olson EN. The serum response factor coactivator myocardin is required for vascular smooth muscle development. Proc Natl Acad Sci USA 100: 93669370, 2003.
25. Manabe I, Owens GK. CArG elements control smooth muscle subtype-specific expression of smooth muscle myosin in vivo. J Clin Invest 107: 823834, 2001.[Web of Science][Medline]
26. Manabe I, Owens GK. The smooth muscle myosin heavy chain gene exhibits smooth muscle subtype-selective modular regulation in vivo. J Biol Chem 276: 3907639087, 2001.
27. Minami T, Donovan DJ, Tsai JC, Rosenberg RD, Aird WC. Differential regulation of the von Willebrand factor and Flt-1 promoters in the endothelium of hypoxanthine phosphoribosyltransferase-targeted mice. Blood 100: 40194025, 2002.
28. Moessler H, Mericskay M, Li Z, Nagl S, Paulin D, Small JV. The SM 22 promoter directs tissue-specific expression in arterial but not in venous or visceral smooth muscle cells in transgenic mice. Development 122: 24152425, 1996.[Abstract]
29. Moniot B, Biau S, Faure S, Nielsen CM, Berta P, Roberts DJ, de Santa Barbara P. SOX9 specifies the pyloric sphincter epithelium through mesenchymal-epithelial signals. Development 131: 37953804, 2004.
30. Oh J, Richardson JA, Olson EN. Requirement of myocardin-related transcription factor-B for remodeling of branchial arch arteries and smooth muscle differentiation. Proc Natl Acad Sci USA 102: 1512215127, 2005.
31. Vivian JL, Klein WH, Hasty P. Temporal, spatial and tissue-specific expression of a myogenin-lacZ transgene targeted to the Hprt locus in mice. Biotechniques 27: 154162, 1999.[Web of Science][Medline]
32. Wang Z, Wang DZ, Pipes GC, Olson EN. Myocardin is a master regulator of smooth muscle gene expression. Proc Natl Acad Sci USA 100: 71297134, 2003.
33. Xu R, Ho YS, Ritchie RP, Li L. Human SM22
BAC encompasses regulatory sequences for expression in vascular and visceral smooth muscles at fetal and adult stages. Am J Physiol Heart Circ Physiol 284: H1398H1407, 2003.
34. Yin F, Hoggatt AM, Zhou J, Herring BP. 130-kDa smooth muscle myosin light chain kinase is transcribed from a CArG-dependent, internal promoter within the mouse mylk gene. Am J Physiol Cell Physiol 290: C1599C1609, 2006.
35. Yoshida T, Sinha S, Dandre F, Wamhoff BR, Hoofnagle MH, Kremer BE, Wang DZ, Olson EN, Owens GK. Myocardin is a key regulator of CArG-dependent transcription of multiple smooth muscle marker genes. Circ Res 92: 856864, 2003.
36. Zhou J, Herring BP. Mechanisms responsible for the promoter-specific effects of myocardin. J Biol Chem 280: 1086110869, 2005.
This article has been cited by other articles:
![]() |
G. Palais, A. Nguyen Dinh Cat, H. Friedman, N. Panek-Huet, A. Millet, F. Tronche, B. Gellen, J.-J. Mercadier, A. Peterson, and F. Jaisser Targeted transgenesis at the HPRT locus: an efficient strategy to achieve tightly controlled in vivo conditional expression with the tet system Physiol Genomics, April 10, 2009; 37(2): 140 - 146. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |