Am J Physiol Cell Physiol Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Cell Physiol 292: C919-C926, 2007. First published September 27, 2006; doi:10.1152/ajpcell.00477.2006
0363-6143/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/2/C919    most recent
00477.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Junaid, A.
Right arrow Articles by Zahradka, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Junaid, A.
Right arrow Articles by Zahradka, P.

PROTEIN AND VESICLE TRAFFICKING, CYTOSKELETON

Osteopontin localizes to the nucleus of 293 cells and associates with polo-like kinase-1

Asad Junaid,1,4 Michael C. Moon,2,3,4 Gregory E. J. Harding,2,3,4 and Peter Zahradka2,4

Departments of 1Internal Medicine, 2Physiology, and 3Surgery, University of Manitoba, and 4St. Boniface General Hospital Research Centre, Winnipeg, Manitoba, Canada

Submitted 4 September 2006 ; accepted in final form 20 September 2006


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Osteopontin (OPN) is a secreted phosphoprotein involved in cellular proliferation and associated with tumor progression. Although an intracellular form of OPN has been described, its function remains unknown. In this study, a novel nuclear location for intracellular OPN and a correlation with cell division were demonstrated. OPN distinctly localized to the nucleus in a subset of transiently transfected human embryonic kidney 293 cells. Immunoblotting confirmed the nuclear location of native OPN, and results from immunofluorescence studies suggested an association between nuclear OPN and cell cycle progression. Flow cytometry revealed that nuclear and cellular OPN content rose significantly during the S and G2/M phases, respectively. Treatment of cells with the DNA polymerase inhibitor aphidicolin prevented cell cycling and greatly reduced cellular OPN content. The intracellular location of OPN coincided with polo-like kinase-1 (Plk-1), a member of the polo-like kinase family, which, in part through their regulation of centrosome-related events, are integral to successful cellular mitosis. OPN and Plk-1 were coimmunoprecipitated from nuclear, but not cystoslic, extracts, demonstrating an interaction that is limited to the nucleus, presumably during mitosis. Deletion of the COOH terminus of OPN militated against nuclear localization and Plk-1 interaction. Elevated expression of OPN was also associated with an increase in the number of multinucleate 293 cells, whereas transfection of the COOH-terminal-deleted OPN decreased the percentage of multinucleate cells below basal levels. These findings implicate intranuclear OPN as a participant in the process of cell duplication.

cell cycle; spindle; nuclear

OSTEOPONTIN (OPN) is a phosphorylated glycoprotein highly expressed in bone tissue (9), where it regulates mineralization through its actions on bone cell adhesion and osteoclast function (11). OPN is also present in other tissues and is associated with a wide array of cellular processes, including, but not limited to, development, carcinogenesis, immunity, inflammation, and tissue repair (for review see Ref. 4). In nonbone tissues, OPN expression occurs only in response to a stimulus such as inflammation. Secretion of OPN under these conditions has been correlated with increased tissue calcification; however, secreted OPN also operates as a chemoattractant for various cell types, including endothelial cells and monocytes/macrophages. OPN may be the primary factor in the recruitment of macrophages to sites of injury. This function is mediated by the RGD domain of OPN, which is required for integrin binding. OPN has also been reported to influence cell proliferation, differentiation, and activation state, although the specific mechanisms by which it operates have not been completely elucidated.

Tumor growth has been shown to be directly enhanced by OPN, at least partially through its ability to facilitate tumor invasion by invoking matrix-degrading enzymes (18). OPN expression has also been associated with the growth of nonneoplastic cells (10). Inhibition of OPN or antagonism of its {alpha}vbeta3-integrin receptor abrogates mitogen-induced DNA synthesis in cardiac fibroblasts and NIH 3T3 cells (2, 23). Similarly, glucose- and hypoxia-induced DNA synthesis in mesangial cells is inhibited by OPN neutralization (20). More direct evidence for OPN's mitogenic capacity was provided by its ability to stimulate division of previously quiescent prostatic cells (8). Enhanced expression of OPN is not limited to isolated cells in culture, inasmuch as OPN localizes to actively proliferating cells in animal models of renal, vascular, and periodontal tissue injury and regeneration (16, 17, 27, 29).

In an attempt to identify the contribution of OPN to cell proliferation, we transfected OPN as a fusion construct with green fluorescent protein (GFP) into 293 cells. In addition to being present in the cytosol, the OPN-GFP fusion protein was found to localize to cell nuclei. Examination of native OPN indicated that its nuclear location correlated with chromatin condensation during cell division, exhibiting a subcellular distribution that coincided with polo-like kinase-1 (Plk-1), an established regulator of mitosis (12). Evidence that OPN and Plk-1 coimmunoprecipitate raises the possibility that these proteins may function cooperatively to modulate cell division cycles.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
OPN expression vectors. The coding region for full-length human OPN was amplified by PCR with primers [ATGAGAATTGCAGTGATTTGCTTTTGC (forward) and TTAATTGACCTCAGAAGATGCACTATC (reverse)] from a human kidney cDNA library (Clontech) and ligated into the mammalian expression vector pcDNA3.1/NT-GFP-TOPO (construct designated GFP-OPN; InVitrogen). In addition, OPN cDNA was cloned out of frame with GFP into pcDNA3.1/NT-GFP-TOPO, providing a vector closely matched in size and capable of producing GFP, but not OPN (construct designated GFP-CON). A COOH-terminal deletion of the last 101 amino acids (bases 601–903) of GFP-OPN (designated GFP-OPN-C) was made with a site-directed mutagenesis kit (Clontech), and its sequence was verified by cycle sequencing. Cycle sequencing was also used to verify that GFP-OPN and GFP-CON constructs would and would not express OPN, respectively, according to proper reading frame orientation in relation to the coding region for GFP.

Cell culture. 293 cells were obtained from the American Type Culture Collection and propagated in DMEM containing 10% FBS. Cells were used when 60% confluent. For microscopy, cells were prepared in chamber slides coated with collagen type I. Cell growth was arrested by placement of the cells in DMEM containing 0.25% FBS for 48 h.

Transfection and expression analysis. Transfection of GFP-OPN, GFP-CON, or GFP-OPN-C was achieved with Effectine reagent according to the manufacturer's suggested protocol (Qiagen). At 48 h after transfection, the cells were washed in PBS, treated with Hoechst 33342 stain to facilitate nuclear identification, and fixed with 4% paraformaldehyde. Sections were examined for fluorescence with an Olympus BH-2 microscope, and images were captured with a Dage-MTI 330 digital camera. Transfection efficiency was determined by dividing the number of fluorescent cells by the total number of cells. All transfections were repeated a minimum of three times.

Immunofluorescence studies. After treatment, cells were washed with PBS and fixed with 4% paraformaldehyde as previously described (30). Cells were permeabilized with Tris-buffered saline (TBS)-1% Triton X-100 for 10 min, washed with TBS-0.05% Tween 20 (TBS-T), and then incubated with TBS-T-1% BSA for 60 min at room temperature. A 1:100 dilution of monoclonal anti-OPN antibody (catalog no. MPIIIB10, Developmental Studies Hybridoma Bank) or an equal concentration of isotype-specific mouse IgG (Sigma) was then applied for 1 h at room temperature. After the cells were washed with TBS-T, a Cy2- or Cy3-conjugated secondary antibody (Molecular Probes; 1:500 dilution) was applied for 30 min at room temperature. For OPN-Plk-1 double-labeling experiments, a polyclonal anti-Plk-1 antibody (Santa Cruz Biotechnology; 1:100 dilution) was used. Nuclei were visualized by Hoechst 33342 staining and then examined by fluorescence microscopy as described above. All studies were performed in triplicate.

Flow cytometry analysis of the cell cycle. For intact cell studies, 293 cells growth arrested in the G0/G1 phase were treated, trypsinized, and fixed in 4% paraformaldehyde. The cells were washed and permeabilized for 5 min on ice with 0.25% (vol/vol) Triton X-100 in PBS (pH 7.4) and then incubated with a 1:100 dilution of anti-OPN antibody or an equivalent concentration of isotype-specific mouse IgG in PBS-1% BSA overnight at 4°C with gentle agitation. After they were washed, cells were incubated for 30 min at room temperature with Oregon green-conjugated secondary antibody (1:500 dilution; Molecular Probes), washed with PBS-1% BSA, and incubated with propidium iodide (PI) staining solution (5 µg/ml PI and 200 µg/ml DNase-free RNase A in PBS) in the dark for 20 min.

For nuclear studies, randomly cycling 293 cells were scraped from dish surfaces and suspended in ice-cold nuclear extraction buffer [320 mM sucrose, 5 mM MgCl2, 10 mM HEPES, and 1% Triton X-100 (pH 7.4)] at ~1 x 106 cells/ml. The suspension was vortexed gently for 10 s and incubated on ice for 10 min. Nuclei were collected by centrifugation at 2,000 g and washed twice with nuclear wash buffer [320 mM sucrose, 5 mM MgCl2, and 10 mM HEPES (pH 7.4)]. Nuclear yield and integrity were confirmed by microscopic examination after trypan blue staining. Freshly isolated nuclei were incubated with a 1:100 dilution of anti-OPN antibody or mouse IgG in nuclear wash buffer overnight at 4°C with gentle agitation. Secondary antibody incubation and PI staining were conducted as described for intact cells, except nuclear wash buffer was used as the diluent.

Flow cytometry was performed using an Epics XL-MCL flow cytometer (Coulter). Fluorescence values obtained from cells or nuclei incubated with nonspecific mouse IgG served as a measure of background fluorescence and were subtracted from fluorescence values of cells incubated with anti-OPN antibody. Intensity of Oregon green fluorescence above background values, which represents the OPN-specific signal, was correlated with cell cycle phase (as determined by PI fluorescence) by analysis with FCAP software (version 1.32, Soft Flow Hungary).

Immunoprecipitation and Western blotting. Immunoprecipitation and Western blotting were performed as described previously (30, 31). Briefly, aliquots containing equal amounts of nuclear or cytosolic protein (100 µg) were incubated with anti-OPN or anti-Plk-1 antibody (3 µg) overnight at 4°C. Precleared protein G-Sepharose was used to isolate antibody-bound proteins. After the aliquots were washed and eluted from Sepharose, equal aliquots of immunoprecipitates were mixed with bromphenol blue and 2-mercaptoethanol [1% (vol/vol) final concentration] and loaded onto 7.5% polyacrylamide gels after they were heated at 95°C. After electrophoresis, proteins were transferred to polyvinylidene difluoride membranes that were subsequently blocked with PBS-3% (wt/vol) BSA. The membranes were incubated with anti-OPN antibody (anti-Plk-1 immunoprecipitate) or anti-Plk-1 antibody (anti-OPN precipitate) in PBS-1% (wt/vol) BSA (diluted 1:100) at 37°C for 1 h. After the membranes were washed three times and incubated for 1 h at 37°C in blocking solution with horseradish peroxidase-conjugated secondary antibody, the horseradish peroxidase signal was detected using the enhanced chemiluminescence system (Amersham). Nuclear extract purity was confirmed by the absence of cytoskeletal actin (Sigma) and the presence of Oct-1 (Upstate Biotechnology). Both antibodies were used at a dilution of 1:250.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Transfected OPN localizes to the nucleus. As has been previously described for native OPN (34), expression of an OPN-GFP fusion protein in 293 cells resulted primarily in cytoplasmic fluorescence in the transfectants (Fig. 1A). However, cells that fluoresced in nuclear and cytoplasmic compartments, as well as cells that exhibited predominantly nuclear fluorescence, were also observed (Fig. 1, B and C). The homogeneous distribution between the cytosol and the nucleus after transfection of a GFP that was out of frame with OPN demonstrated that the nuclear OPN localization is not an artifact of the GFP tag (Fig. 1D). Interestingly, noncytosolic OPN-GFP fluorescence appeared greatest within nuclei with condensed chromatin, suggesting a possible relation between intracellular OPN distribution and mitotic bodies.


Figure 1
View larger version (80K):
[in this window]
[in a new window]

  		Fig. 1. Localization of transiently transfected osteopontin (OPN) in 293 cells. Examination of spontaneously cycling 293 cells 48 h after transient transfection with OPN fused to green fluorescent protein (GFP-OPN) revealed 3 patterns of fluorescence. A: predominantly cytoplasmic fluorescence without evidence of chromatin condensation. B and C: nuclear and cytoplasmic and predominantly nuclear GFP-OPN fluorescence, respectively. D: typical diffuse cytoplasmic and nuclear fluorescence in cells transfected with GFP out of frame with OPN (GFP-CON). Scale bar, 5 µm.

 
Native OPN localizes to the nucleus during mitosis. Since intracellular trafficking of endogenously produced OPN and GFP-OPN fusion protein may be regulated differently, the intracellular distribution of native OPN was studied by immunofluorescence imaging. OPN staining typically revealed an eccentric, nonnuclear, polar distribution in the majority of cells (Fig. 2, A and B). However, consistent with the results of the transfection experiments, nuclei of cells exhibiting chromatin condensation stained strongly for OPN (arrows in Fig. 2, A and B). An examination of these cells at higher magnification suggested a relation between the location of nuclear OPN and specific stages of mitosis: OPN surrounded the condensed chromatin of prometaphase and metaphase figures (white arrows in Fig. 2, C and D), whereas it was present within the cleavage furrow of mitotic cells in anaphase (green arrow in Fig. 2, C and D). To further investigate this relation between mitosis and nuclear OPN, the subcellular localization of OPN was monitored after treatment with aphidicolin, which blocks cell cycle progression into the S phase and, consequently, reduced the number of mitotic figures (data not shown). Nevertheless, OPN fluorescence remained visible in nuclei with condensed chromatin, consistent with mitosis (arrows in Fig. 2, E and F). On the other hand, aphidicolin treatment produced a visible diminution in cytosolic OPN (cf. Fig. 2, B and F). These data suggest that the intracellular distribution of OPN (within nuclear or nonnuclear compartments), as well as OPN synthesis, may correlate with specific stages of the cell cycle.


Figure 2
View larger version (114K):
[in this window]
[in a new window]

  		Fig. 2. Subcellular distribution of native OPN in 293 cells. Representative fields of 293 cells were stained with Hoechst (blue) alone to visualize chromatin structure (A, C, and E) and with OPN (red) fluorescence superimposed on the Hoechst images (B, D, and F). OPN was confined to a polar region of nuclei without evidence of condensed chromatin (arrow in F). Higher magnification in C and D than in A and B highlights nuclear location of OPN in replicating cells. Cells treated with 10–3 M aphidicolin for 24 h showed a marked reduction in cellular OPN fluorescence; those undergoing active cell division retained a strong signal for OPN within the mitotic spindle [C and D, white arrow (anaphase) and yellow arrow (metaphase)]. Scale bars, 5 µm.

 
Cell cycle-dependent expression and localization of OPN. The relation between OPN expression and distribution with cell cycle progression was examined by flow cytometry. The DNA content of normally cycling 293 cells indicated that the majority of cells were in the G0/G1 phase (61%), with the remainder in the S (14%) or the G2/M (25%) phase (data not shown). Serum deprivation (0.25% FBS) for 48 h greatly diminished S (5%) and G2/M (15%) phase populations and cellular OPN content (Fig. 3, A and B). At 18 h after stimulation with 10% FBS, there was a significant increase in DNA synthesis (25% of cells in the S phase) and a concomitant increase in OPN expression (Fig. 3, C and D). Cell cycle phase distribution and OPN expression profiles had completely normalized by 64 h (Fig. 3, E and F). The relation between DNA replication and OPN expression was confirmed by the fact that addition of 10% FBS to cells arrested with aphidicolin did not induce appreciable expression of OPN after 64 h (Fig. 3, G and H).


Figure 3
View larger version (18K):
[in this window]
[in a new window]

  		Fig. 3. Correlation of cellular OPN content with cell cycle phase by flow cytometry. Propidium iodide (PI). A, C, E, and G: cell cycle phase profiles; B, D, F, and H: OPN fluorescence. Representative cell cycle phase profiles and OPN expression of serum-deprived (0.25% FBS) 293 cells are shown before (A and B) and 18 h (C and D) and 64 h (E and F) after addition of 10% FBS. There was a steady increase in OPN fluorescence as cells proliferated and cell cycle phase profiles normalized by 64 h. G and H: despite serum stimulation for 64 h, cells incubated with 10–3 M aphidicolin failed to proliferate or express appreciable amounts of OPN. All experiments were repeated ≥3 times.

 
The data presented in Fig. 3 suggest that the appearance of intracellular OPN is dependent on cell cycle stage, with expression primarily associated with the S and G2/M phases. To determine whether the subcellular localization of OPN is similarly modulated in relation to the cell cycle, flow cytometry was used to measure total cellular and nuclear-specific fluorescence in the G0/G1, S, and G2/M phases. The fluorescence intensity of cellular OPN was significantly greater in the G2/M phase than in the G0/G1 and S phases (Fig. 4, A and B). Similarly, nuclear OPN was more intense in the G2/M than in the G0/G1 phase (Fig. 4, C and D); however, nuclear OPN was also significantly higher in the S than in the G0/G1 phase. Nevertheless, OPN intensity was greater in the G2/M than in the S phase. The purity of the nuclei used in this experiment was established by Western blotting. OPN and the constitutive transcription factor Oct-1 were present (Fig. 4E), but actin could not be detected (data not shown).


Figure 4
View larger version (26K):
[in this window]
[in a new window]

  		Fig. 4. Dynamics of cellular and nuclear OPN expression during cell cycle progression. A and B: flow cytometric analysis for cellular and nuclear OPN, respectively. Black, G0/G1 phase; red, S phase; green, G2/M phase. C and D: statistical analysis of correlation of cell cycle phase with OPN fluorescence for cells and nuclei, with means calculated from 5 individual experiments. *P ≤ 0.01 vs. G0/G1. E: immunoblot showing OPN signal from 3 separate 293 cell nuclear protein extracts. Confirmation of purity and integrity of nuclear extracts was assessed by determination of signals for cytoskeletal actin (undetectable, data not shown) and nuclear transcription factor Oct-1.

 
Exportin-1 (CRM1)-dependent nuclear export of OPN. The possibility that nuclear transit of OPNs occurred via the exportin-1 pathway was examined with the selective inhibitor leptomycin B. Accumulation of OPN in nonmitotic nuclei of proliferating 293 cells was observed by 1 h after addition of leptomycin B relative to control (Fig. 5, A and B). By 2 h, the majority of nuclei stained strongly for OPN (Fig. 5C). Nuclear cyclin B1 content, which is reduced during interphase largely due to exportin-1-mediated exit (13), similarly increased during the observation period (Fig. 5, D–F). These data indicate that nuclear accretion of OPN is likely controlled by modulation of protein export, rather than import.


Figure 5
View larger version (43K):
[in this window]
[in a new window]

  		Fig. 5. Leptomycin B-dependent export of nuclear OPN. Representative micrographs of OPN (A–C) and cyclin B1 (D–F) immunofluorescence (red) superimposed on images of Hoechst nuclear staining (blue) of 293 cells before (A and D) and after 1 h (B and E), 2 h (C), and 4 h (F) of exposure to the exportin-1 inhibitor leptomycin B (10 ng/ml). Scale bar, 5 µm.

 
Interaction of OPN with Plk-1. The distinct pattern of OPN distribution in nondividing and dividing cells is highly analogous to that seen with the polo-like kinases, which oscillate between polar and mitotic spindle locations (12). Thus, given the similar spatial and temporal distribution of these proteins, we investigated the possibility that Plk-1 and OPN were physically associated. In nondividing cells, Plk-1 and OPN showed an asymmetric distribution with close proximity to the nucleus (Fig. 6, A and B). Colocalization of these proteins was evident when the images were superimposed (Fig. 6C). This spatial overlap was maintained during cell division, where OPN and Plk-1 colocalized to regions consistent with centrosomes and the midzones of mitotic spindles (Fig. 6, D–F). The position of the centrosome was confirmed by staining for {gamma}-tubulin (data not shown).


Figure 6
View larger version (45K):
[in this window]
[in a new window]

  		Fig. 6. Comparative distribution of nuclear OPN and Plk-1 in 293 cells. Representative photomicrographs are shown for nondividing (A–C) and dividing (D–F) 293 cells. A and B: Plk-1 staining. B and E: OPN staining. C and F: merged Plk-1, OPN, and Hoechst nuclear staining. C: polar distribution of Plk-1 and OPN in nondividing cells that is highlighted when individual colors are overlapped with nuclear Hoechst staining. In dividing cells, OPN and Plk-1 signals overlap at locations consistent with centrioles (corroborated by {gamma}-tubulin staining, data not shown) of mitotic spindles (white arrows) and midzone (green arrow).

 
Although immunostaining indicates that OPN and Plk-1 may associate with the centrosome and mitotic spindle at similar time points during the cell cycle, this technique provides no information with respect to a physical interaction. When nuclear extracts immunoprecipitated with anti-Plk-1 antibody were examined by Western blot analysis, OPN could be detected (Fig. 7). Conversely, Plk-1 could be immunoprecipitated from the nuclear extracts with anti-OPN antibody (Fig. 7). However, coprecipitation did not occur when a cytosolic fraction, instead of the nuclear extract, was used (data not shown). Consequently, the potential physical interaction between these proteins is likely restricted to the nucleus during periods of cell division.


Figure 7
View larger version (19K):
[in this window]
[in a new window]

  		Fig. 7. Interaction of nuclear OPN and Plk-1. Immunoprecipitation was employed to assess physical interaction of OPN and Plk-1. Top: anti-Plk-1 antibody immunoprecipitate of 293 cell nuclear protein probed with anti-OPN antibody. Middle: anti-OPN antibody immunoprecipitate probed with anti-Plk-1 antibody (converse of A). Bottom: control immunoprecipitation with rabbit IgG.

 
To determine whether the physical interaction of OPN and Plk-1 is a determinant of spatial distribution, we examined the effect of GFP-OPN-C on their association. Cells were transfected with GFP-OPN or GFP-OPN-C, and their subcellular distribution was compared with that of Plk-1. GFP-OPN was prominent in the nuclei of cells exhibiting condensed chromatin (Fig. 8, A and B). Immunostaining for Plk-1 showed a similar distribution (Fig. 8C). In contrast, GFP-OPN-C was dispersed through the cytosol, although it was most abundant in cells with condensed chromatin (Fig. 8, D and E). Plk-1, in contrast, retained its nuclear proximity. These results support the view that entry of OPN into the nucleus may be the outcome of a physical interaction with Plk-1.


Figure 8
View larger version (101K):
[in this window]
[in a new window]

  		Fig. 8. Effect of a COOH-terminal deletion on OPN localization. Cells were transiently transfected with GFP-OPN (A–C) or GFP-OPN-C (D–E), an OPN mutant from which 100 amino acids from the COOH-terminal region were deleted, and examined after 48 h. A and D: cells with condensed chromatin identified by staining with Hoechst 33342. B and E: location of GFP in the same field of cells shown in A and D. C and F: immunostaining for Plk-1. GFP-OPN and Plk-1 colocalized in all successfully transfected cells, but no colocalization was observed with the mutant OPN. Scale bars, 5 µm.

 
Association of OPN expression with multinucleation. Plk-1 regulates spindle formation and cytokinesis, and interference with its activity results in mitotic aberrations (12). We therefore examined 293 cells to determine whether expression of OPN resulted in visible mitotic defects. A significant number of multinucleated 293 cells were observed under normal culture conditions (Fig. 9A), in accordance with previous reports indicating that multinucleation is a common event in transformed cells (15, 21). No change in multinucleation could be discerned in 293 cells after transfection with empty vector; however, there was a sixfold increase in the cells that were transfected with GFP-OPN (Fig. 9B). Interestingly, there was a 67% decrease in basal multinucleation in cells transfected with GFP-OPN-C (Fig. 9B). These data suggest that translocation of OPN to the nucleus may interfere with proper spindle formation by Plk-1.


Figure 9
View larger version (24K):
[in this window]
[in a new window]

  		Fig. 9. Effect of OPN expression on multinucleation. Cells were transiently transfected with empty vector, GFP-OPN, or GFP-OPN-C and examined after 96 h. Multinucleated cells (A) were visually identified, and percentage of multinucleation was quantified (B). Five fields were examined per transfection (≥500 cells viewed), and means were calculated from 3 individual experiments. *P ≤ 0.05 vs. empty vector.

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
In this report, we have demonstrated by complementary techniques, that OPN accumulates in the nuclei of 293 cells via an exportin-1-dependent mechanism. Entry of OPN into the nucleus coincides with the S phase and precedes significant increases in cellular OPN content in the G2/M phase. Furthermore, progression through the S phase was required for intracellular OPN expression, since inhibition of DNA replication with aphidicolin correlated with low levels of OPN. It was also shown that OPN interacts with Plk-1 and that this association may be necessary for retaining OPN in the nucleus. Finally, we show that overexpression of OPN correlates with multinucleation, which suggests that OPN likely affects spindle formation by Plk-1.

Most of OPN's actions at the cellular level have been attributed to the extracellular effects that occur after secretion, where receptor binding results in the activation of specific intracellular signaling pathways. Indeed, OPN receptors include {alpha}v (beta1, beta3 or beta5) and ({alpha}4, {alpha}5, {alpha}8 or {alpha}9) beta1-integrins and variants 6 and 7 of the hyaluronan receptor CD44 (5). However, evidence for the existence of an intracellular form of OPN localized to the perimembranous region has been accumulating, and a specific role for this protein in cell migration has been reported (33). Furthermore, the inability to internalize secreted OPN (34) indicates that intracellular OPN originates by a distinct mechanism that has yet to be identified.

The intracellular form of OPN is primarily associated with the ERM (ezrin, radixin, moesin) proteins that connect the cortical cytoskeleton with the plasma membrane (34). Furthermore, OPN associates with these proteins only in the presence of CD44 (34). These interactions may explain how intracellular OPN mediates cell migration. However, there is also evidence that suggests that intracellular OPN has other cellular functions, particularly in relation to cell proliferation (8, 25, 26, 28).

A Reinhardt analysis of the amino acid composition of human OPN yielded a reliability score of 94.1, a value strongly supporting the likelihood of a nuclear location for this protein (19). Nevertheless, our data suggest that OPN is detectable within the nucleus only during mitosis. Since mitosis is not a frequent event, it may be presumed that evidence for an OPN presence in the nucleus could have been interpreted as an anomaly by other investigators. Our advantage is likely related to the fact that 293 cells are high proliferative and, therefore, have an abundance of mitotic bodies in a typical heterogeneous population.

Since nuclear OPN content peaked when the S phase was highest, whereas whole cell OPN content did not increase until the G2/M phase, it is likely that nuclear translocation of OPN precedes the increase in cellular OPN content. Thus the mechanisms regulating nuclear OPN content may be similar to those of proteins such as cyclin B and beta-catenin, which rely on exportin-1-dependent and -independent nuclear export pathways (7). This interpretation is supported by the nuclear accumulation of OPN in the presence of leptomycin B (Fig. 5).

In agreement with the data demonstrating occupancy of nuclei by OPN only during periods of DNA synthesis, aphidicolin-treated cell nuclei did not stain for OPN (data not shown). Additionally, the finding that proliferating aortic vascular smooth muscle cells suppress OPN expression on cell cycle arrest reinforces the premise that OPN expression is intimately related to not just induction but also maintenance of cell cycle progression (24). These findings are in agreement with those of Zohar and colleagues (33), who noted an increase in fetal rat calvarial cell OPN content during cell cycle progression.

Cell cycle-dependent translocation between the cytosol and the nucleus, particularly during mitosis, is a characteristic of only a few proteins. Postulating a connection to the polo-like kinases was therefore to be expected given our data. However, establishing the existence of a physical association between OPN and Plk-1 is not sufficient to define a function for OPN during mitosis. Polo-like kinases regulate several key aspects of mitotic progression (12), and mutations in Plk-1 have been reported to cause multinucleation in response to a spindle defect that prevents cytokinesis (32). Similar to most transformed cells, 293 cells exhibit a high basal rate of multinucleation. However, 293 cells also express an unusually high background level of OPN. Given the association between OPN and Plk-1 that was observed in this study, it is plausible to reason that OPN might influence that activity of Plk-1. Indeed, OPN has been reported to prevent and promote multinucleation in different cell types (1, 22). Also, osteoclasts and macrophages from OPN-deficient mice contain fewer nuclei (3). Thus the fact that both proteins have been shown to influence multinucleation (Fig. 9) supports our speculation that Plk-1 and OPN may operate in tandem.

Our data point to a unique connection between OPN and cell cycle progression and are consistent with reports of correlating intracellular OPN with squamous cell hyperplasia and carcinoma and the transformation of chondrocytes and small round cells (6, 14). Further examination of the function of intracellular OPN during cell division should serve to provide significant insights into the intricacies of cell cycle progression and tumor biology.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by grants from the St. Boniface Hospital Research Foundation and Manitoba Health Research Council (to A. Junaid) and the Canadian Institutes for Health Research (to P. Zahradka). M. C. Moon and G. E. J. Harding were supported by fellowships from the Manitoba Health Research Council.


   ACKNOWLEDGMENTS
 
We thank Xueping Xie and Brenda Wright for excellent technical support.


   FOOTNOTES
 

Address for reprint requests and other correspondence: A. Junaid, Grace General Hospital, 4W-300 Booth Dr., Winnipeg, MB, Canada R3J 3M7 (e-mail: junaid{at}cc.umanitoba.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Aitken CJ, Hodge JM, Nicholson GC. Adenoviral down-regulation of osteopontin inhibits human osteoclast differentiation in vitro. J Cell Biochem 93: 896–903, 2004.[CrossRef][ISI][Medline]

2. Ashizawa N, Graf K, Do YS, Nunohiro T, Giachelli CM, Meehan WP, Tuan TL, Hsueh WA. Osteopontin is produced by rat cardiac fibroblasts and mediates A(II)-induced DNA synthesis and collagen gel contraction. J Clin Invest 98: 2218–2227, 1996.[ISI][Medline]

3. Bourassa B, Monaghan S, Rittling SR. Impaired anti-tumor cytotoxicity of macrophages from osteopontin-deficient mice. Cell Immunol 227: 1–11, 2004.[CrossRef][ISI][Medline]

4. Denhardt DT, Noda M. Osteopontin expression and function: role in bone remodeling. J Cell Biochem Suppl 30–31: 92–102, 1998.

5. Denhardt DT, Noda M, O'Regan AW, Pavlin D, Berman JS. Osteopontin as a means to cope with environmental insults: regulation of inflammation, tissue remodeling, and cell survival. J Clin Invest 107: 1055–1061, 2001.[ISI][Medline]

6. Devoll RE, Li W, Woods KV, Pinero GJ, Butler WT, Farach-Carson MC, Happonen RP. Osteopontin (OPN) distribution in premalignant and malignant lesions of oral epithelium and expression in cell lines derived from squamous cell carcinoma of the oral cavity. J Oral Pathol Med 28: 97–101, 1999.[ISI][Medline]

7. Eleftheriou A, Yoshida M, Henderson BR. Nuclear export of human beta-catenin can occur independent of CRM1 and the adenomatous polyposis coli tumor suppressor. J Biol Chem 276: 25883–25888, 2001.[Abstract/Free Full Text]

8. Elgavish A, Prince C, Chang PL, Lloyd K, Lindsey R, Reed R. Osteopontin stimulates a subpopulation of quiescent human prostate epithelial cells with high proliferative potential to divide in vitro. Prostate 35: 83–94, 1998.[CrossRef][ISI][Medline]

9. Franzen A, Heinegard D. Isolation and characterization of two sialoproteins present only in bone calcified matrix. Biochem J 232: 715–724, 1985.[ISI][Medline]

10. Gadeau AP, Campan M, Millet D, Candresse T, Desgranges C. Osteopontin overexpression is associated with arterial smooth muscle cell proliferation in vitro. Arterioscler Thromb 13: 120–125, 1993.[Abstract/Free Full Text]

11. Giachelli CM, Steitz S. Osteopontin: a versatile regulator of inflammation and biomineralization. Matrix Biol 19: 615–622, 2000.[CrossRef][ISI][Medline]

12. Glover DM, Hagan IM, Tavares AA. Polo-like kinases: a team that plays throughout mitosis. Genes Dev 12: 3777–3787, 1998.[Free Full Text]

13. Hagting A, Karlsson C, Clute P, Jackman M, Pines J. MPF localization is controlled by nuclear export. EMBO J 17: 4127–4138, 1998.[CrossRef][ISI][Medline]

14. Ishizeki K, Nomura S, Takigawa M, Shioji H, Nawa T. Expression of osteopontin in Meckel's cartilage cells during phenotypic transdifferentiation in vitro, as detected by in situ hybridization and immunocytochemical analysis. Histochem Cell Biol 110: 457–466, 1998.[CrossRef][ISI][Medline]

15. Jin J, Woodgett JR. Chronic activation of protein kinase Bbeta/Akt2 leads to multinucleation and cell fusion in human epithelial kidney cells: events associated with tumorigenesis. Oncogene 24: 5459–5470, 2005.[CrossRef][ISI][Medline]

16. Lekic P, Sodek J, McCulloch CA. Relationship of cellular proliferation to expression of osteopontin and bone sialoprotein in regenerating rat periodontium. Cell Tissue Res 285: 491–500, 1996.[CrossRef][ISI][Medline]

17. Liaw L, Lindner V, Schwartz SM, Chambers AF, Giachelli CM. Osteopontin and beta3 integrin are coordinately expressed in regenerating endothelium in vivo and stimulate Arg-Gly-Asp-dependent endothelial migration in vitro. Circ Res 77: 665–672, 1995.[Abstract/Free Full Text]

18. Philip S, Bulbule A, Kundu GC. Osteopontin stimulates tumor growth and activation of promatrix metalloproteinase-2 through nuclear factor-{kappa}B-mediated induction of membrane type 1 matrix metalloproteinase in murine melanoma cells. J Biol Chem 276: 44926–44935, 2001.[Abstract/Free Full Text]

19. Reinhardt A, Hubbard T. Using neural networks for prediction of the subcellular location of proteins. Nucleic Acids Res 26: 2230–2236, 1998.[Abstract/Free Full Text]

20. Sodhi CP, Phadke SA, Batlle D, Sahai A. Hypoxia and high glucose cause exaggerated mesangial cell growth and collagen synthesis: role of osteopontin. Am J Physiol Renal Physiol 280: F667–F674, 2001.[Abstract/Free Full Text]

21. Somers KD, Murphey MM. Multinucleation in the presence of cytochalasin B by RNA tumor virus-transformed cells. Cancer Res 40: 4410–4414, 1980.[Abstract/Free Full Text]

22. Sterling H, Saginario C, Vignery A. CD44 occupancy prevents macrophage multinucleation. J Cell Biol 143: 837–847, 1998.[Abstract/Free Full Text]

23. Takahashi F, Takahashi K, Okazaki T, Maeda K, Ienaga H, Maeda M, Kon S, Uede T, Fukuchi Y. Role of osteopontin in the pathogenesis of bleomycin-induced pulmonary fibrosis. Am J Respir Cell Mol Biol 24: 264–271, 2001.[Abstract/Free Full Text]

24. Thyberg J, Hultgardh-Nilsson A, Kallin B. Inhibitors of ADP-ribosylation suppress phenotypic modulation and proliferation of smooth muscle cells cultured from rat aorta. Differentiation 59: 243–252, 1995.[CrossRef][ISI][Medline]

25. Tuck AB, Arsenault DM, O'Malley FP, Hota C, Ling MC, Wilson SM, Chambers AF. Osteopontin induces increased invasiveness and plasminogen activator expression of human mammary epithelial cells. Oncogene 18: 4237–4246, 1999.[CrossRef][ISI][Medline]

26. Tuck AB, O'Malley FP, Singhal H, Tonkin KS, Harris JF, Bautista D, Chambers AF. Osteopontin and p53 expression are associated with tumor progression in a case of synchronous, bilateral, invasive mammary carcinomas. Arch Pathol Lab Med 121: 578–584, 1997.[ISI][Medline]

27. Verstrepen WA, Persy VP, Verhulst A, Dauwe S, De Broe ME. Renal osteopontin protein and mRNA upregulation during acute nephrotoxicity in the rat. Nephrol Dial Transplant 16: 712–724, 2001.[Abstract/Free Full Text]

28. Weintraub AS, Schnapp LM, Lin X, Taubman MB. Osteopontin deficiency in rat vascular smooth muscle cells is associated with an inability to adhere to collagen and increased apoptosis. Lab Invest 80: 1603–1615, 2000.[ISI][Medline]

29. Xie Y, Nishi S, Iguchi S, Imai N, Sakatsume M, Saito A, Ikegame M, Iino N, Shimada H, Ueno M, Kawashima H, Arakawa M, Gejyo F. Expression of osteopontin in gentamicin-induced acute tubular necrosis and its recovery process. Kidney Int 59: 959–974, 2001.[CrossRef][ISI][Medline]

30. Yau L, Zahradka P. PGE2 stimulates vascular smooth muscle cell proliferation via the EP2 receptor. Mol Cell Endocrinol 203: 77–90, 2003.[CrossRef][ISI][Medline]

31. Zahradka P, Litchie B, Storie B, Helwer G. Transactivation of the insulin-like growth factor-I receptor by angiotensin II mediates downstream signaling from the angiotensin II type 1 receptor to phosphatidylinositol 3-kinase. Endocrinology 145: 2978–2987, 2004.[Abstract/Free Full Text]

32. Zhou T, Aumais JP, Liu X, Yu-Lee LY, Erikson RL. A role for Plk1 phosphorylation of NudC in cytokinesis. Dev Cell 5: 127–138, 2003.[CrossRef][ISI][Medline]

33. Zohar R, Lee W, Arora P, Cheifetz S, McCulloch C, Sodek J. Single cell analysis of intracellular osteopontin in osteogenic cultures of fetal rat calvarial cells. J Cell Physiol 170: 88–100, 1997.[CrossRef][ISI][Medline]

34. Zohar R, Suzuki N, Suzuki K, Arora P, Glogauer M, McCulloch CA, Sodek J. Intracellular osteopontin is an integral component of the CD44-ERM complex involved in cell migration. J Cell Physiol 184: 118–130, 2000.[CrossRef][ISI][Medline]




This article has been cited by other articles:


Home page
 BloodHome page
H. W. Tun, D. Personett, K. A. Baskerville, D. M. Menke, K. A. Jaeckle, P. Kreinest, B. Edenfield, A. C. Zubair, B. P. O'Neill, W. R. Lai, et al.
Pathway analysis of primary central nervous system lymphoma
Blood, March 15, 2008; 111(6): 3200 - 3210.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
P. Zahradka
Novel Role for Osteopontin in Cardiac Fibrosis
Circ. Res., February 15, 2008; 102(3): 270 - 272.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/2/C919    most recent
00477.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Junaid, A.
Right arrow Articles by Zahradka, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Junaid, A.
Right arrow Articles by Zahradka, P.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.