| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CELLULAR METABOLISM
1Institute of Clinical Pharmacology and Toxicology, Department of Internal Medicine, University Hospital, and 2Institute of Pharmaceutical Chemistry, Department of Applied Biosciences, Swiss Federal Institute of Technology, Zurich, Switzerland
Submitted 30 November 2005 ; accepted in final form 8 September 2006
 |
ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
peptide; transport; neuron
Finally, OATP3A1 (previously called OATP-D) has been identified and characterized mainly as a PG transporter with a very broad tissue expression profile (3, 35). A unique feature of human OATP3A1 is its 97% amino acid sequence identity with its rat and mouse orthologs (3, 11). This high conservation during evolution as well as its wide tissue distribution indicate that the SLCO3A1/Slco3a1 gene products might serve important physiological functions in mammalian species. In this study we have identified two alternatively spliced variants of OATP3A1, which have been called OATP3A1_v1 (= original OATP3A1) and OATP3A1_v2. The two OATP3A1 variants are compared with respect to their tissue distribution, cellular expression in brain, and functional transport properties. Interestingly, the two splice variants show a distinct cerebral expression pattern in human brain slices, while their substrate specificities are similar and include prostaglandin PGE1 and PGE2, T4, and the oligopeptides BQ-123 (endothelin receptor antagonist) and vasopressin.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Materials. [prolyl-3,4(N)-3H]-BQ-123 (36 Ci/mmol) and [tyrosyl-3,5(N)-3H]-vasopressin[Arg8] (28 Ci/mmol) were purchased from Amersham Biosciences Europe (Otelfingen, Switzerland). 125I-labeled angiotensin I (5-L-isoleucine) (2,000 Ci/mmol), [5.6.8.9.11.12.14.15-3H(N)]-298-arachidonic acid (100 Ci/mmol), sodium-[1,2,6,7-3H(N)]-dehydroepiandrosterone sulfate (DHEAS, 60–74 Ci/mmol), [tyrosyl-3,5-3H]deltorphin II (2-D-Ala, 34–38.5 Ci/mmol), [3H(G)]digoxin (19–37 Ci/mmol), [tyrosyl-2,6-3H(N)]enkephalin (DPDPE, 34–40 Ci/mmol), ammonium-[6,7-3H(N)]-estrone-3-sulfate (57.3 Ci/mmol), [tyrosyl-2,6-3H]oxytocin (33 Ci/mmol), [5,6-3H(N)]-PGE1 (46–56 Ci/mmol), [5,6,8,11,12,14,15-3H(N)]-PGE2 (200 Ci/mmol), [3H(G)]taurocholic acid (3.5 Ci/mmol), L-[125I]-T4 (969 Ci/mmol), and L-3,5,3'-[125I]triiodothyronine (T3, 779 Ci/mmol) were obtained from Perkin Elmer Life Sciences (Boston, MA). All other reagents were of analytical grade and readily available from commercial sources.
Isolation of OATP3A1_v1 and OATP3A1_v2. A human adult brain Rapid-screen cDNA library panel (OriGene Technologies, Rockville, MD) was screened by PCR using primers specific for OATP3A1 (GenBank accession no. AB031050) (forward primer 5'-GCTGAGAACGCAACCGTGGTTCC-3', reverse primer 5'-GACTTGAGTTCAGGGCTGACTGTCC-3'). A single clone was isolated and sequenced with ALF Express (Amersham Biosciences Europe). This single clone contained a complete open reading frame (ORF) starting at the initiation codon and had a 3'-untranslated region (UTR) that was different from the published OATP3A1 sequence (35). This new variant 2 of OATP3A1 was called OATP3A1_v2, whereas the original variant 1 of OATP3A1 was renamed as OATP3A1_v1. To clone the complete ORF of the published OATP3A1_v1, two additional primers were designed. The forward primer covered bases 1927–1946 of the published sequence (5'-TCTCCTCCTTCGTTTGTTGG-3'), and the reverse primer included the stop codon (5'-CTATAAAACGGACTCCATGTT-3'). Total RNA from human kidney was used as a template for RT-PCR, which resulted in a 400-bp piece including the specific 3'-end region of the OATP3A1_v1 ORF.
In an additional PCR reaction, the ORF of OATP3A1_v1 was constructed with the forward primer containing the 5'-end of the ORF without the start codon (5'-CAGGGGAAGAAGCCGGG-3'), the reverse primer including the stop codon (5'-CTATAAAACGGACTCCATGTT-3'), and as templates the two cDNAs covering the whole ORF (i.e., the isolated OATP3A1_v2 and the RT-PCR 400-bp amplicon). PCR was performed with a proofreading DNA polymerase (Pfu DNA polymerase, Stratagene Cloning Systems, La Jolla, CA). The resulting PCR product was cloned into the Xenopus laevis expression vector, which contained the initiation codon and the 5'- and 3'-UTRs of Oatp1a1 (4). This construct was then used to prepare cRNA for oocyte expression experiments (see below). The ORF of OATP3A1_v2 was amplified in a similar way with the following primers: forward 5'-CAGGGGAAGAAGCCGGG-3', reverse 5'-TCAGCTTCTCACAAAGGAGTCTT-3'.
Multiple tissue expression array. A fragment of 164 bp of OATP3A1 (bases 1742–1905) was RT-PCR amplified with human kidney RNA and the following primers: forward 5'-GCTGAG AACGCAACCGTGGTTCC-3', reverse 5'-GACTTGAGTTCAGGGCTGACTGTCC-3'. After cloning and sequencing, the fragment was used to hybridize a Multiple Tissue Expression (MTE) Array (BD Biosciences Clontech, Basel, Switzerland) containing normalized poly(A)+ RNA from different human tissues. After a 30-min prehybridization at 65°C in ExpressHyb (BD Biosciences Clontech) hybridization solution, the blot was hybridized overnight at 65°C (2 x 106 cpm/ml). After five washes for 20 min with 2x SSC-1% SDS at 55°C and two washes of 20 min with 0.1x SSC-0.5% SDS at 55°C, the blot was exposed to autoradiography film for 3 days at –70°C with an intensifying screen.
Determination of mRNAs. One microgram of total RNA from each tissue (Clontech, Mountain View, CA) was used to generate cDNA with random primers, using the Reverse Transcription System from Promega (Madison, WI). The reaction time was 59 min at 59°C, followed by 5 min at 99°C. The cDNA was stored at –20°C until use. For the detection of the two splice variants, TaqMan real-time PCR with an ABI PRISM 7900 HT detector was performed according to the instructions of the manufacturer (AB Applied Biosystems, Rotkreuz, Switzerland) and following the method outlined in Ref. 32. Primers and probes designed with Primer Express Sequence Detection System Software (AB Applied Biosystems) were OATP3A1_v1: forward GAAAAACTATAAACGCTACATCAAAAACC, probe AGGGTCAGAGTAGAGGCAAAGAAC, reverse GAGGGCGGGCTGAGCACCAGTG; OATP3A1_v2: forward GAAAAACTATAAACGCTACATCAAAAACC, probe GGTTTTCTCAGTCTCAATGTCTTGGT, reverse CGGGCTGAGCACCAGCACAGAG. The probes for the two splice variants were labeled with FAM as reporter dye at the 5'-end and BHQ1 as quencher dye at the 3'-end. The probe for the 18S rRNA was labeled with VIC as reporter dye at the 5'-end and TAMRA as quencher dye at the 3'-end.
Preparation of rabbit polyclonal antibodies and Western blotting.
To produce specific antibodies against the two OATP3A1 splice variants, the following peptides corresponding to the COOH-terminal 15 amino acids of both proteins were purchased from Neosystem (Strasbourg, France): NH2-NLEDHEWCENMESVL-COOH for OATP3A1_v1 and NH2-CPESHSPSEDSFVRS-COOH for OATP3A1_v2. Polyclonal antibodies against both oligopeptides were raised in rabbits as described previously (34). The antibodies were affinity purified with the AminoLink Plus Immobilization Kit (Pierce Biotechnology, Rockford, IL) for OATP3A1_v1 and the SulfoLink Kit (Pierce Biotechnology) for OATP3A1_v2 according to the manufacturer's protocols. The specificity of the two antibody preparations was tested with cell membranes isolated from OATP-expressing cell lines such as Sf9 cells (i.e., OATP1A2, OATP3A1_v1, OATP3A1_v2, OATP1C1), Chinese hamster ovary (CHO) cells (i.e., OATP1B1, OATP1B3, OATP2B1) and human embryonic kidney (HEK) cells (i.e., OATP4A1) (see 
Fig. 2). Cell membranes were isolated by differential centrifugation. Confluent cell plates were washed three times with 0.9% NaCl, followed by a washing step with 0.25 mmol/l sucrose. Cells were scraped with a rubber policeman and resuspended in 5 mmol/l sucrose containing 2 mmol/l phenylmethylsulfonyl fluoride (PMSF) and 1 mg/ml antipain-leupeptin. Cells were homogenized and centrifuged for 10 min at 800g. The supernatant was centrifuged for 20 min at 8,500g and the resulting supernatant again for 1 h at 100,000g. The final pellet was resuspended in 250 mmol/l sucrose supplemented with the proteinase inhibitors PMSF and antipain-leupeptin. The protein content of the membrane fraction was determined by bicinchoninic acid assay. Western blots were performed as described previously (10), and reactions were visualized with the ECL Plus Western Blot Detection Kit (Amersham Biosciences).
|
|
Paraffin-embedded brain sections (5 µm) of human frontal cortex and hippocampal formation were obtained from the Department of Neuropathology, University Hospital Zurich. The specimens were from two patients, a 39-yr-old woman and a 79-yr-old man, without any evidence for central nervous disease. The postmortem periods until sampling of the brain tissue were between 30 and 48 h. The sections were first dewaxed with xylol and hydrated with descending serial ethanol solutions. They were then treated with 0.1 mol/l HCl for 10 min, followed by 0.1% saponin in PBS for 30 min. To eliminate endogenous peroxidase activity, the sections were incubated with 1.5% H2O2 for 10 min. Afterwards, sections were incubated overnight at 4°C with affinity-purified antibodies to OATP3A1_v1 (1:300) or OATP3A1_v2 (1:30) diluted in 50 mmol/l Tris-100 mmol/l NaCl (Tris-saline, pH 7.4) containing 2% normal goat serum and 0.05% Triton X-100. After being washed in Tris-saline, the sections were stained by the Avidin: Biotinylated enzyme Complex immunoperoxidase method with the Vectastain Elite Kit (Vector Laboratories, Burlingame, CA). Diaminobenzidine hydrochloride was used as the chromogen.
Double-immunofluorescence staining of rat brain tissue sections. Rats were anesthetized with pentobarbital sodium (40 mg/kg) and perfused through the ascending aorta with 4% paraformaldehyde and 15% saturated picric acid in 0.15% phosphate buffer. Brains were removed, postfixed in the perfusion solution at 4°C for 2 h, and cryoprotected in 30% sucrose overnight at 4°C. Sections of 40 µm were cut with a sliding microtome and collected in PBS. They were incubated overnight at 4°C in PBS containing 2% normal goat serum, 0.2% Triton X-100, and the affinity-purified OATP3A1_v1 antibody (1:500) combined with a mouse monoclonal antibody either to glial fibrillary acidic protein (GFAP, 1:5,000, CHEMICON, Temecula, CA) or to 2',3'-cyclic nucleotide 3'-phosphodiesterase (1:100, CHEMICON). After being washed in PBS, the sections were incubated at room temperature with affinity-purified secondary goat antibodies (Jackson Immunoresearch, West Grove, PA) labeled with Cy2 (1:100) and Cy3 (1:300) diluted in the same buffer as the primary antibody. Sections were washed several times with PBS before being coverslipped with Immu-mount (Shandon, Pittsburgh, PA) and analyzed by confocal laser microscopy (MRC 600 confocal imaging system, Bio-Rad Laboratories, Richmond, CA) with a Zeiss Axioplan microscope (Oberkochen, Germany) at the Laboratory of Electron Microscopy of the University of Zurich.
Stable expression and immunofluorescent detection of OATP31_v1 and OATP3A1_v2 in CHO FlpIn cells. CHO FlpIn Cells were grown in Ham's F-12 medium supplemented with 10% fetal calf serum, 2 mmol/l L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin at 37°C with 5% CO2 and 95% humidity. The cells were transfected with OATP3A1_v1 and OATP3A1_v2 cDNAs that were first subcloned into the pIRESneo2 expression vector (CLONTECH Laboratories) with EcoRI and NotI together with a Kozak sequence in front of their start codon (Kozak-ORF). These OATP3A1_v1 and OATP3A1_v2 Kosak-ORFs were then cut out of the pIRESneo2 expression vector with NotI and BfrI (AflII). After gel purification the cDNA probes were directly subcloned into the NotI/BfrI-digested and dephosphorylated pcDNA5/FRT expression vector of the Flp-In System (Invitrogen Life Technologies, Paisley, UK). Both constructs were controlled by digestion with BglII (2.5 h, 37°C) and sequencing of both cDNA strands. The constructs were then introduced into the CHO FlpIn cells according to the manual of the Flp-In system. Stably transfected CHO FlpIn cells were selected after 24 h by adding hygromycin (500 µg/ml). Wild-type cells were grown in the presence of zeozin (100 µg/ml). For immunofluorescence, wild-type and stably transfected CHO FlpIn cells were grown to confluence on coverslips, treated with 5 mmol/l sodium butyrate for 24 h (27), and then fixed directly in the culture dishes (room temperature, 30 min) with 200 mmol/l PBS supplemented with 2% paraformaldehyde, 0.1% glutaraldehyde, and 0.5% Triton X-100. The cells were then washed 2 x 10 min with PBS and incubated for 5 min with ammonium chloride (0.25% wt/vol) in PBS. Subsequently, the cell membranes were permeabilized for 10 min with saponin (0.1% wt/vol) in PBS (PBS-saponin). After blocking with gelatin (2% wt/vol) in PBS-saponin for 1 h, the coverslips were washed twice with PBS-saponin for 10 min and once more with PBS-saponin containing 1% (wt/vol) IgG-free bovine serum albumin (BSA) (PBS-saponin-BSA) (10 min). The coverslips were then incubated with the purified OATP3A1_v1 or OATP3A1_v2 antisera, diluted 1:50 in PBS-saponin-BSA for 2 h at room temperature. After three washing steps with PBS-saponin-BSA, the cells were incubated for 1 h with the secondary antibody [Cy3-coupled goat anti-rabbit F(ab')2 fragment] diluted 1:500 in PBS-saponin-BSA. Finally, the coverslips were washed sequentially with PBS-saponin-BSA (10 min), PBS-saponin (10 min), and PBS (10 min). After mounting with Glycergel (DakoCytomation, Glostrup, Denmark) immunofluorescence was analyzed with confocal laser scanning microscopy using a Leica TCS 4D microscope (Leica, Wetzlar, Germany) (34).
Transport experiments in Xenopus laevis oocytes. Capped cRNA was synthesized from the OATP3A1_v1- and OATP3A1_v2-containing X. laevis expression vectors (see above) with the mMESSAGE mMACHINE T7 Kit (Ambion, Austin, TX) for both splice variants from NotI-linearized cDNA. Oocytes were prepared as described previously (13). After an overnight incubation at 18°C, viable oocytes were selected and injected with 50 nl of water or 5 ng of cRNA dissolved in the same volume of water. After 3 days of incubation at 18°C with a daily change of the incubation solution, uptake of radiolabeled substrates was measured at 25°C in 100 µl of uptake solution (mmol/l: 100 NaCl, 2 KCl, 1 MgCl2, 1 CaCl2, and 10 HEPES adjusted to pH 7.5 with Tris) as previously described (29). For kinetic analysis, the Michaelis-Menten constant (Km) was calculated by nonlinear regression analysis (Systat version 8.0, SPSS, Chicago, IL).
Transport experiments in OATP3A1_v1- and OATP3A1_v2-transfected CHO FlpIn cells. CHO FlpIn cells were grown in Ham's F-12 medium supplemented with 10% fetal calf serum, 2 mmol/l L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin at 37°C in the presence of 5% CO2 and 95% humidity. Wild-type cells were grown in the presence of zeozin (100 µg/ml), and stably transfected cells were selected with hygromycin (500 µg/ml). Substrate uptake into OATP3A1_v1- and OATP3A1_v2-expressing CHO FlpIn cells was determined as described previously (5). For all transport experiments, expression of OATP3A1_v1 and OATP3A1_v2 was induced by preincubation of the cells for 24 h in the presence of 5 mmol/l sodium butyrate (27). The uptake medium consisted of (mmol/l) 116 NaCl, 5.3 KCl, 1 NaH2PO4, 0.8 MgSO4, 5.5 D-glucose, and 20 HEPES (pH 7.4). Uptake experiments were performed in 800 µl of solution containing the labeled substrates and, where required, additional unlabeled compound to reach the indicated concentrations. Transport was stopped with 2 ml of ice-cold buffer (mmol/l: 116 choline Cl, 5.3 KCl, 1 KH2PO4, 0.8 MgSO4, 5.5 D-glucose, and 20 HEPES), followed by three additional washes. The cells were solubilized in 1 ml of 1% Triton X-100, and the radioactivity was measured by liquid scintillation counting. Specific OATP3A1 variant uptake was determined by subtracting values from identical experiments conducted in wild-type CHO FlpIn cells.
Statistics.
Statistical significance between uptake values in cRNA- and water-injected oocytes (see Table 3) or between OATP3A1 variant-expressing CHO FlpIn and wild-type CHO FlpIn cells (see Table 4) was determined by unpaired Student's t-test.
|
|
|
|
|
RESULTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Gene structure of SLCO3A1. The SLCO3A1 gene is localized on chromosome 15q26. To understand its genomic structures, the two OATP3A1 splice variants were aligned with a human genomic sequence. Table 1 shows the organization of the ORF of the SLCO3A1 gene. All intron/exon boundaries fit with the canonical donor and acceptor consensus motifs. The ORF of OATP3A1_v1 is composed of 10 exons, while the shorter OATP3A1_v2 has 11 exons. The first 9 exons are spliced identically. The difference between the two variants is caused by the use of an additional splice donor site in exon 10, resulting in a different COOH-terminal end of the proteins.
Tissue distribution of OATP3A1_v1 and OATP3A1_v2.
To compare the tissue distribution of the two OATP3A1 splice variants we first performed a commercially available MTE Array analysis. Since the initial primers used (see MATERIALS AND METHODS) could not differentiate between the two splice variants, the signals detected in Fig. 1B indicate expression of OATP3A1_v1 and/or OATP3A1_v2 in the various tissues. The latter include especially testis, various brain regions, heart, lung, spleen, peripheral blood leukocytes, and thyroid gland. To differentiate between expression of OATP3A1_v1 and OATP3A1_v2 in various tissues, real-time PCR with total RNAs was performed as described in MATERIALS AND METHODS. The data in Table 2 show detection of both splice variants of OATP3A1 in the tissues examined. Specifically, OATP3A1_v1 is generally expressed at higher levels in all investigated tissues compared with OATP3A1_v2. About three more cycles were needed to detect OATP3A1_v2 in lung, thyroid, spleen, and liver, corresponding to an 
10-fold lower expression level compared with OATP3A1_v1.
Immunolocalization of human OATP3A1_v1 and OATP3A1_v2 in testis and different brain regions. To investigate the expression and distribution of the two OATP3A1 splice variants in more detail, we performed immunolocalization studies in human testis, choroid plexus, and various brain regions. For this purpose we developed OATP3A1 variant-specific polyclonal antibodies that did not cross-react with any other human OATPs (Fig. 2). In testis, different developmental stages of germ cells were stained by both antibody preparations (Fig. 3, A–F). However, the cellular distribution of OATP3A1_v1 immunoreactivity was more restricted (Fig. 3B) than the expression of OATP3A1_v2, the distribution pattern of which was consistent with possible OATP3A1_v2 expression in Sertoli cells (marked by an arrow in Fig. 3E) as well. Different cellular locations of the two OATP3A1 variants were also detected in the human choroid plexus (Fig. 3, G–M). Thus, while OATP3A1_v1 expression could be clearly localized to the basolateral plasma membrane (indicated by an arrowhead) of choroid plexus epithelial cells (Fig. 3H), OATP3A1_v2 immunoreactivity showed a more intracellular and apically oriented (indicated by an arrow) distribution (Fig. 3L), suggesting its expression at the apical plasma membrane as well as in subapical intracellular vesicular compartments.
|
|
|
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
OATP3A1_v1 corresponds in sequence to one of the previously described OATP3A1s (OATP-D) (3), but differs from another published sequence (35) by a single tyrosine to isoleucine mutation at position 202. Our study confirms that OATP3A1_v1 exhibits a broad tissue distribution, with predominant expression in testis, brain, and vascular tissue, and that its preferred substrates include PGE1 and PGE2. When fine-localized in human tissues by immunohistochemistry with variant-specific antibodies, the tissue distribution of OATP3A1_v1 was found to be only partially consistent with the cerebral expression of the homologous rat Oatp3a1, which in addition to some expression in astrocytes is also expressed in somatoneurons. Thus rat Oatp3a1 combines the cerebral expression patterns of OATP3A1_v1 and OATP3A1_v2 and thus qualifies as a precursor of both human splice variants. Functionally, OATP3A1_v1 was found to transport, in addition to PGE1 and PGE2, also T4 and the cyclic oligopeptides BQ-123 and vasopressin. While transport of T4 and BQ-123 is shared by other members of the OATP/SLCO superfamily (11, 28, 34), the cyclic nonapeptide vasopressin has so far not been identified as an OATP substrate. However, transport activity was rather small, suggesting that vasopressin might not necessarily represent a physiological substrate of OATP3A1_v1. Also, and interestingly, the closely related oligopeptide oxytocin was not transported by the OATP3A1 variants.
The newly identified human OATP3A1_v2 variant is generated by the use of an additional splice donor site in exon 10 of the SLCO3A1 gene on chromosome 15q26. OATP3A1_v2 differs from OATP3A1_v1 in several aspects including 1) a shorter COOH-terminal end amino acid sequence (minus 18 amino acids), 2) more restricted tissue distribution with predominant expression in brain and testis, 3) apical and/or subapical expression in human choroid plexus epithelial cells, and 4) expression in somatoneurons of grey and white matter of human frontal cortex. In contrast to these differences in expression, transport kinetics and spectrum of transport substrates are similar between the two OATP3A1 splice variants. Thus the transporter variants transport the prostaglandins PGE1 and PGE2, T4, and the oligopeptides BQ-123 and vasopressin to a similar extent and with similar affinities. Only arachidonic acid was slightly better transported by OATP3A1_v2 than by OATP3A1_v1 (Table 4). While the definitive transport mechanism(s) as well as the role of potential driving force(s) are not yet firmly established, evidence is accumulating that OATPs might act as anion exchangers. For example, intracellular bicarbonate (30) and intracellular pH (23) have been shown to be important in substrate uptake by rat Oatp1a1. Others have shown that transport activity of OATP2B1 is stimulated by a lowering of the extracellular pH (15) concomitant with an increase of the Vmax (26), which points to a role of bicarbonate as a counterion during the OATP-mediated organic anion transport. Furthermore, rat Oatp1a1 utilizes glutathione as a driving force (21), while rat Oatp1a4 mediates exchange of substrates against glutathione and glutathione conjugates (22). Rat Oatp1a1 and Oatp1a4 can be transstimulated by substrates (22), further supporting the concept that OATPs act as anion exchangers. These data suggest that OATP3A1_v1 and OATP3A1_v2 can functionally complement each other at the various expression sites. For example, since OATPs function as bidirectional organic anion exchangers, the polarized surface expression of the two OATP3A1 splice variants in human choroid plexus epithelial cells could account for vectorial transcellular substrate transport from blood into cerebrospinal fluid or vice versa. This assumption, however, remains to be verified by functional transport studies in isolated human choroid plexus epithelial cells.
The present study demonstrates that the spectrum of transport substrates of OATP3A1_v1 and OATP3A1_v2 is not restricted to PGs as previously suggested (3), but includes in addition some cyclic oligopeptides such as the endothelin antagonist BQ-123 and vasopressin, albeit at low transport rates. Together with the previous findings of OATP-mediated transport of other neuropeptides such as, for example, cholecystokinin octapeptide and various opioid peptides (9), the data suggest that both OATP3A1 splice variants might be involved in neuropeptide transport in human brain. Although the latter suggestion is not consistent with the traditional view that, in contrast to classic neurotransmitters, no reuptake mechanisms exist for neuropeptides in neuronal synapses, neuropeptides (including vasopressin) that are released from neuronal membrane sites seem to persist in the extracellular fluid for relatively long periods of time and are thus able to diffuse considerable distances, indicating that their degradation by peptidases is less efficient than generally assumed (20). Hence, it is possible that the neuromodulatory role of vasopressin (and other neuropeptides) in classic neurotransmitter actions is regulated by OATP3A1-mediated vasopressin transport through neuronal reuptake of vasopressin itself and/or of its degradation products (20). In this regard it is noteworthy that neurotoxicity of the cyclic oligopeptide microcystin is dependent on OATP1A2-mediated brain uptake of microcystin (6). Furthermore, the proton-dependent di- and tripeptide transporter PEPT2 was recently identified in astrocytes of rat cerebral cortex, where it is supposed to play a role in the removal of degraded peptides from the extracellular space (7). And finally, the organic cation transporter 3 (OCT3/Slc22a3), which is widely expressed in brain and exhibits transport functions similar to those of the OATPs, has been shown to exert an important function in central regulation of salt and water intake (37). Hence, it is quite possible that OATP3A1 transporters play a similar important role in the central regulation of vasopressin-dependent physiological processes, especially if one considers the high conservation of the OATP3A subfamily during evolution (11). Obviously, this latter assumption requires further experimental validation, for example, by testing the influence of a physiological in-to-out glutathione gradient on vasopressin transport.
In conclusion, the present study has identified two splice variants of human OATP3A1. The data suggest that the two OATP3A1 variants exhibit similar transport functions, but exhibit distinct cellular and subcellular expression in testis, choroid plexus, and human brain frontal cortex. Although the findings indicate an involvement of OATP3A1_v1 and OATP3A1_v2 in neuroglial and neuronal transport of neuropeptides such as vasopressin, the suggested role of the OATP3A1 variants in the modulation of neurotransmission by neuropeptides requires further investigation.
|
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
|
REFERENCES |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
2. Abe T, Unno M, Onogawa T, Tokui T. [Molecular identification of organic anion transporter oatp/LST family]. Tanpakushitsu Kakusan Koso 46: 612–620, 2001.[Medline]
3. Adachi H, Suzuki T, Abe M, Asano N, Mizutamari H, Tanemoto M, Nishio T, Onogawa T, Toyohara T, Kasai S, Satoh F, Suzuki M, Tokui T, Unno M, Shimosegawa T, Matsuno S, Ito S, Abe T. Molecular characterization of human and rat organic anion transporter OATP-D. Am J Physiol Renal Physiol 285: F1188–F1197, 2003.
4. Cattori V, Hagenbuch B, Hagenbuch N, Stieger B, Ha R, Winterhalter KE, Meier PJ. Identification of organic anion transporting polypeptide 4 (Oatp4) as a major full-length isoform of the liver-specific transporter-1 (rlst-1) in rat liver. FEBS Lett 474: 242–245, 2000.[CrossRef][Web of Science][Medline]
5. Eckhardt U, Schroeder A, Stieger B, Hochli M, Landmann L, Tynes R, Meier PJ, Hagenbuch B. Polyspecific substrate uptake by the hepatic organic anion transporter Oatp1 in stably transfected CHO cells. Am J Physiol Gastrointest Liver Physiol 276: G1037–G1042, 1999.
6. Fischer WJ, Altheimer S, Cattori V, Meier PJ, Dietrich DR, Hagenbuch B. Organic anion transporting polypeptides expressed in liver and brain mediate uptake of microcystin. Toxicol Appl Pharmacol 203: 257–263, 2004.
7. Fujita T, Kishida T, Wada M, Okada N, Yamamoto A, Leibach FH, Ganapathy V. Functional characterization of brain peptide transporter in rat cerebral cortex: identification of the high-affinity type H+/peptide transporter PEPT2. Brain Res 997: 52–61, 2004.[CrossRef][Web of Science][Medline]
8. Fujiwara K, Adachi H, Nishio T, Unno M, Tokui T, Okabe M, Onogawa T, Suzuki T, Asano N, Tanemoto M, Seki M, Shiiba K, Suzuki M, Kondo Y, Nunoki K, Shimosegawa T, Iinuma K, Ito S, Matsuno S, Abe T. Identification of thyroid hormone transporters in humans: different molecules are involved in a tissue-specific manner. Endocrinology 142: 2005–2012, 2001.
9. Gao B, Hagenbuch B, Kullak-Ublick GA, Benke D, Aguzzi A, Meier PJ. Organic anion-transporting polypeptides mediate transport of opioid peptides across blood-brain barrier. J Pharmacol Exp Ther 294: 73–79, 2000.
10. Gao B, Huber RD, Wenzel A, Vavricka SR, Ismair MG, Reme CE, Meier PJ. Localization of organic anion transporting polypeptides in the rat and human ciliary body epithelium. Exp Eye Res 80: 61–72, 2005.[CrossRef][Web of Science][Medline]
11. Hagenbuch B, Meier PJ. Organic anion transporting polypeptides of the OATP/SLC21 family: phylogenetic classification as OATP/SLCO superfamily, new nomenclature and molecular/functional properties. Pflügers Arch 447: 653–665, 2004.[CrossRef][Web of Science][Medline]
12. Hagenbuch B, Meier PJ. The superfamily of organic anion transporting polypeptides. Biochim Biophys Acta 1609: 1–18, 2003.[Medline]
13. Hagenbuch B, Scharschmidt BF, Meier PJ. Effect of antisense oligonucleotides on the expression of hepatocellular bile acid and organic anion uptake systems in Xenopus laevis oocytes. Biochem J 316: 901–904, 1996.
14. Hsiang B, Zhu Y, Wang Z, Wu Y, Sasseville V, Yang WP, Kirchgessner TG. A novel human hepatic organic anion transporting polypeptide (OATP2). Identification of a liver-specific human organic anion transporting polypeptide and identification of rat and human hydroxymethylglutaryl-CoA reductase inhibitor transporters. J Biol Chem 274: 37161–37168, 1999.
15. Kobayashi D, Nozawa T, Imai K, Nezu J, Tsuji A, Tamai I. Involvement of human organic anion transporting polypeptide OATP-B (SLC21A9) in pH-dependent transport across intestinal apical membrane. J Pharmacol Exp Ther 306: 703–708, 2003.
16. König J, Cui Y, Nies AT, Keppler D. Localization and genomic organization of a new hepatocellular organic anion transporting polypeptide. J Biol Chem 275: 23161–23168, 2000.
17. König J, Cui Y, Nies AT, Keppler D. A novel human organic anion transporting polypeptide localized to the basolateral hepatocyte membrane. Am J Physiol Gastrointest Liver Physiol 278: G156–G164, 2000.
18. Kullak-Ublick GA, Hagenbuch B, Stieger B, Schteingart CD, Hofmann AF, Wolkoff AW, Meier PJ. Molecular and functional characterization of an organic anion transporting polypeptide cloned from human liver. Gastroenterology 109: 1274–1282, 1995.[CrossRef][Web of Science][Medline]
19. Kullak-Ublick GA, Ismair MG, Stieger B, Landmann L, Huber R, Pizzagalli F, Fattinger K, Meier PJ, Hagenbuch B. Organic anion-transporting polypeptide B (OATP-B) and its functional comparison with three other OATPs of human liver. Gastroenterology 120: 525–533, 2001.[CrossRef][Web of Science][Medline]
20. Landgraf R, Neumann ID. Vasopressin and oxytocin release within the brain: a dynamic concept of multiple and variable modes of neuropeptide communication. Front Neuroendocrinol 25: 150–176, 2004.[CrossRef][Web of Science][Medline]
21. Li L, Lee TK, Meier PJ, Ballatori N. Identification of glutathione as a driving force and leukotriene C4 as a substrate for oatp1, the hepatic sinusoidal organic solute transporter. J Biol Chem 273: 16184–16191, 1998.
22. Li L, Meier PJ, Ballatori N. Oatp2 mediates bidirectional organic solute transport: a role for intracellular glutathione. Mol Pharmacol 58: 335–340, 2000.
23. Marin JJ, Mangas D, Martinez-Diez MC, El-Mir MY, Briz O, Serrano MA. Sensitivity of bile acid transport by organic anion-transporting polypeptides to intracellular pH. Biochim Biophys Acta 1611: 249–257, 2003.[Medline]
24. Meier-Abt F, Faulstich H, Hagenbuch B. Identification of phalloidin uptake systems of rat and human liver. Biochim Biophys Acta 1664: 64–69, 2004.[Medline]
25. Mikkaichi T, Suzuki T, Onogawa T, Tanemoto M, Mizutamari H, Okada M, Chaki T, Masuda S, Tokui T, Eto N, Abe M, Satoh F, Unno M, Hishinuma T, Inui K, Ito S, Goto J, Abe T. Isolation and characterization of a digoxin transporter and its rat homologue expressed in the kidney. Proc Natl Acad Sci USA 101: 3569–3574, 2004.
26. Nozawa T, Imai K, Nezu J, Tsuji A, Tamai I. Functional characterization of pH-sensitive organic anion transporting polypeptide OATP-B in human. J Pharmacol Exp Ther 308: 438–445, 2004.
27. Palermo DP, DeGraaf ME, Marotti KR, Rehberg E, Post LE. Production of analytical quantities of recombinant proteins in Chinese hamster ovary cells using sodium butyrate to elevate gene expression. J Biotechnol 19: 35–47, 1991.[CrossRef][Web of Science][Medline]
28. Pizzagalli F, Hagenbuch B, Stieger B, Klenk U, Folkers G, Meier PJ. Identification of a novel human organic anion transporting polypeptide as a high affinity thyroxine transporter. Mol Endocrinol 16: 2283–2296, 2002.
29. Reichel C, Gao B, van Montfoort J, Cattori V, Rahner B, Hagenbuch B, Stieger B, Kamisako T, Meier PJ. Localization and function of the organic anion-transporting polypeptide Oatp2 in rat liver. Gastroenterology 117: 688–695, 1999.[CrossRef][Web of Science][Medline]
30. Satlin LM, Amin V, Wolkoff AW. Organic anion transporting polypeptide mediates organic anion/HCO3– exchange. J Biol Chem 272: 26340–26345, 1997.
31. Schuster VL. Molecular mechanisms of prostaglandin transport. Annu Rev Physiol 60: 221–242, 1998.[CrossRef][Web of Science][Medline]
32. Sidler Pfandler MA, Hochli M, Inderbitzin D, Meier PJ, Stieger B. Small hepatocytes in culture develop polarized transporter expression and differentiation. J Cell Sci 117: 4077–4087, 2004.
33. St-Pierre MV, Hagenbuch B, Ugele B, Meier PJ, Stallmach T. Characterization of an organic anion-transporting polypeptide (OATP-B) in human placenta. J Clin Endocrinol Metab 87: 1856–1863, 2002.
34. Stieger B, Hagenbuch B, Landmann L, Hochli M, Schroeder A, Meier PJ. In situ localization of the hepatocytic Na+/taurocholate cotransporting polypeptide in rat liver. Gastroenterology 107: 1781–1787, 1994.[Web of Science][Medline]
35. Tamai I, Nezu J, Uchino H, Sai Y, Oku A, Shimane M, Tsuji A. Molecular identification and characterization of novel members of the human organic anion transporter (OATP) family. Biochem Biophys Res Commun 273: 251–260, 2000.[CrossRef][Web of Science][Medline]
36. Tamai I, Nozawa T, Koshida M, Nezu J, Sai Y, Tsuji A. Functional characterization of human organic anion transporting polypeptide B (OATP-B) compared with liver-specific OATP-C. Pharm Res 18: 1262–1269, 2001.[CrossRef][Web of Science][Medline]
37. Vialou V, Amphoux A, Zwart R, Giros B, Gautron S. Organic cation transporter 3 (Slc22a3) is implicated in salt-intake regulation. J Neurosci 17: 2846–2851, 2004.
This article has been cited by other articles:
|
|
 |
|
  S. Leuthold, B. Hagenbuch, N. Mohebbi, C. A. Wagner, P. J. Meier, and B. Stieger Mechanisms of pH-gradient driven transport mediated by organic anion polypeptide transporters Am J Physiol Cell Physiol, March 1, 2009; 296(3): C570 - C582. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |
) were calculated by subtracting the values of water-injected oocytes from the values of cRNA-injected oocytes. Values represent the means ± SE of 8–10 uptake measurements in 1 representative of 2 oocyte preparations. The data were analyzed and fitted to the Michaelis-Menten equation with nonlinear regression analysis.