|
|
||||||||
RECEPTORS AND SIGNAL TRANSDUCTION
B
1Department of Medicine, School of Medicine, CURE: Digestive Diseases Research Center and Molecular Biology Institute, University of California, Los Angeles, California; and 2INCELL Corporation, San Antonio, Texas
Submitted 2 June 2006 ; accepted in final form 16 August 2006
| ABSTRACT |
|---|
|
|
|---|
B activation, as measured by NF-
B-DNA binding, NF-
B-driven luciferase reporter activity, and I
B
phosphorylation. PKD2 gene silencing utilizing small interfering RNAs targeting distinct PKD2 sequences dramatically reduced LPA-stimulated NF-
B promoter activity and IL-8 production. PKD2 activation is a novel early event in the biological action of LPA and mediates LPA-stimulated IL-8 secretion in NCM460 cells through a NF-
B-dependent pathway. Our results demonstrate, for the first time, the involvement of a member of the PKD family in the production of IL-8, a potent proinflammatory chemokine, by epithelial cells. NCM460 cells; protein kinase C; CXCL8; phorbol esters
PKC, a major target for the tumor-promoting phorbol esters, has been implicated in the signal-transduction pathways that mediate important functions in intestinal epithelial cells, including proliferation (1, 14) and carcinogenesis (35). It is known that intestinal epithelial cells express multiple isoforms of the PKC family, including
,
,
,
, and
(11). Transgenic overexpression of PKC-
II in murine colonic epithelium (32) or overexpression of certain PKCs in intestinal epithelial cells in culture has been shown to promote growth (26). In addition to its effects on colonic epithelial cell proliferation, multiple PKCs have also been shown to stimulate NF-
B activation (34, 43, 55, 56) in various cell types and thus mediate cell survival as well as proinflammatory signaling (22, 61). Despite the critical role of PKCs in intestinal epithelial cell function and specifically, in initiating the pathway leading to NF-
B activation, downstream signaling targets of PKCs within the NF-
B pathway in intestinal epithelial cells remain poorly understood.
Protein kinase D (PKD; also known initially as PKCµ) has emerged as a major target in the signal-transduction pathways initiated by diacylglycerol and PKC in a variety of cell types (40). PKD is the founding member of a new family of serine/threonine protein kinases, including PKD, PKD2, and PKD3 (reviewed in Ref. 40). These kinases share similarities in overall structure, primary sequence, and enzymological properties (16, 39, 52). PKD has been implicated in the regulation of multiple important cell functions, including signal transduction via MAPK kinase pathways (5, 18, 19), chromatin remodeling via histone deacetylase phosphorylation (10, 20, 27), polarized Golgi function (6, 15, 25), NF-
B activation in response to oxidative stress (29, 4750), and cell proliferation (46, 64). Although much less is known about the regulation and function of the other PKD isoforms, recent studies revealed interesting differences in the subcellular distribution (38, 39), embryonic expression (33), and regulation (59) of these isoforms. However, studies on the physiological functions of specific PKD isoforms have been hampered by the endogenous expression of more than one isoform in the same cell type and frequently involved the overexpression of wild-type and mutant PKDs in transient transfection systems. The identification of cell types that endogenously express a single member of the PKD family would be of great value to clarify the regulation and physiological function of that isoform.
In this study, we identified PKD2 as the predominant PKD isoform in nontransformed human colonic epithelial NCM460 cells. This provided a unique opportunity to examine the regulation and function of endogenous PKD2 without the potential contribution of the other PKD isoforms. Initially, we showed that stimulation of intact NCM460 cells with the G-protein-coupled receptor (GPCR) agonist lysophosphatidic acid (LPA), a major bioactive lipid of serum (3), induced a rapid and striking PKC-dependent PKD2 activation and promoted the production of the potent proinflammatory chemokine interleukin 8 (IL-8; designated CXCL8 in current chemokine nomenclature). Subsequently, we used small interfering RNA (siRNA)-mediated knockdown of PKD2 to determine the contribution of this PKD isoform in mediating NF-
B activation and IL-8/CXCL8 production in response to LPA in NCM460 cells. Our results demonstrate that endogenous PKD2 mediates a substantial component of LPA-induced IL-8/CXCL8 production in NCM460 cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Western blot analysis for PKD isoforms and PKD2 phosphorylation. Serum-starved cultures of NCM460 cells grown on plastic dishes were washed twice with DMEM and then treated as described in the individual experiments. The cells were lysed in 2x SDS-PAGE sample buffer. After SDS-PAGE, proteins were transferred to Immobilon-P membranes (Millipore) and blocked by 3- to 6-h incubation with 5% nonfat milk in PBS (pH 7.2). Membranes were then incubated overnight with the respective primary antibody. Bound primary antibodies to immunoreactive bands were visualized by enhanced chemiluminescence detection with horseradish peroxidase-conjugated anti-mouse or anti-rabbit antibodies. Autoradiograms were scanned with a GS-710 scanner (Bio-Rad), and the labeled bands were quantified with the Quantity One software program (Bio-Rad).
In vitro kinase assay of PKD2. Cultures of NCM460 cells, treated as described in the individual experiments, were washed and lysed in 50 mM Tris·HCl (pH 7.6), 2 mM EGTA, 2 mM EDTA, 1 mM DTT, 10 µg/ml aprotinin, 10 µg/ml leupeptin, 1 mM 4-(2-aminoethyl)-benzenesulfonyl fluoride hydrochloride, and 1% Triton X-100 (lysis buffer A). Cell lysates were clarified by centrifugation at 15,000 g for 10 min at 4°C. PKD2 was immunoprecipitated at 4°C for 24 h with PKD2 antibody (1:200). The immune complexes were recovered by protein A coupled to agarose.
PKD2 autophosphorylation was determined in an in vitro kinase assay by mixing 20 µl of PKD2 immunocomplexes with 10 µl of a phosphorylation mixture containing (final concentration) 100 µM [
-32P]ATP (specific activity of 400600 cpm/pmol), 30 mM Tris·HCl (pH 7.4), 10 mM MgCl2, and 1 mM DTT. After 10 min of incubation at 30°C, the reaction was stopped by washing with 200 µl of kinase buffer and then adding an equal volume of 2x SDS-PAGE sample buffer (200 mM Tris·HCl, pH 6.8, 2 mM EDTA, 0.1 M Na3VO4, 6% SDS, 10% glycerol, and 4% 2-mercaptoethanol), followed by SDS-PAGE analysis. The gels were dried, and the 105-kDa radioactive band corresponding to autophosphorylated PKD2 was visualized by autoradiography. Autoradiographs were scanned in a GS-710 calibrated imaging densitometer (Bio-Rad), and the labeled band was quantified by the Quantity One software program.
Exogenous substrate phosphorylation by purified PKD2 was carried out by mixing 20 µl of the washed immunocomplexes with 20 µl of a phosphorylation mixture containing 2.5 mg/ml syntide-2 (PLARTLSVAGLPGKK), a peptide based on phosphorylation site two of glycogen synthase. After 10 min of incubation at 30°C, the reaction was stopped by adding 100 µl of 75 mM H3PO4 and spotting 75 µl of the supernatant on P-81 phosphocellulose paper. Free [
-32P]ATP was separated from the labeled substrate by washing the P-81 paper four times for 5 min in 75 mM H3PO4. The papers were dried, and the radioactivity incorporated into syntide-2 was determined by Cerenkov counting.
EMSA procedures.
Nuclear extracts were prepared, and EMSA was performed according to the instructions of the manufacturer (Panomics, Redwood City, CA). The EMSA "Gel-Shift" kit (Panomics) was used. The oligonucleotide probes (biotin labeled and cold) encoding the consensus sequence of NF-
B (5'-AGTTGAGGGGACTTTCCCAGGC-3') transcription factor was purchased from Panomics. EMSAs were performed by incubating biotin-labeled NF-
B probe with nuclear extracts (5 µg) from cells with or without LPA treatment in binding buffer containing nonspecific blocker poly(dI-dC) at 20°C for 30 min. The protein-DNA complexes were analyzed by electrophoresis through a 6% nondenaturing polyacrylamide gel. The protein-DNA complexes were then transferred onto a nylon membrane using a semi-dry method at 300 mA for 30 min. After transfer, the nylon membrane was subjected to a UV cross-linker oven for 3 min. The membrane was blocked, followed by addition of streptavidin-horseradish peroxidase conjugate (1:1,000). The shifted bands corresponding to the protein-DNA complex were visualized relative to the unbound double-strand DNA after exposure to film.
PKD2 siRNA. To inhibit PKD2 protein expression, subconfluent cultures of NCM460 cells were transfected with siRNAs. PKD2 siRNAs from Dharmacon (Chicago, IL) and from Ambion (Austin, TX) were used. The sequence for the siRNA oligonucleotides (sense strands) are as follows: UGAGACACCUUCACUUCAUU, CAAGAACAUUGUCCACUGUUU, and GGAAGAUGGGAGAGCGAUAUU. siCONTROL nontargeting siRNA pool (pool of 4 duplexes) was purchased from Dharmacon and used as a control. Transfection of duplex siRNAs was performed with Lipofectamine 2000 according to the manufacturers protocol. Forty-eight hours after transfection, cells were used for experiments and subsequent analyses.
Luciferase assay.
Cells (4 x 105/well) were plated onto six-well dishes (Nunc). The next day, a transfection mixture was prepared by adding 1 µg of the NF-
B luciferase construct (pNF-
B-Luc plasmid; Stratagene, La Jolla, CA), 0.25 µg of control luciferase construct phRG-TK (Promega, Madison, WI), and either PKD2 siRNA (as indicated above) or siCONTROL nontargeting siRNA pool to serum-free medium. After a 20-min incubation and addition of Lipofectamine 2000 (Invitrogen, Carlsbad, CA), the transfection mixture was combined with 0.2 ml of complete DMEM and placed on the cells in each well.
Two days after transfection, the cells were treated with agonists. After the indicated times, the cells were washed with PBS and then lysed with passive lysis buffer (150 µl; Promega). The relative light units from firefly and Renilla luciferases (20 µl) were measured with the use of the dual-luciferase activity assay kit (100 µl; Promega) on a Turner TD20/20 luminometer. The ratio of firefly to Renilla luciferase activity was calculated. The results are reported as relative changes in the ratio, with a relative-fold increase of 1.0 signifying no change. The results are reported as means ± SE of three or more sets of transfections done in triplicate.
IL-8/CXCL8 ELISA. Serum-starved cultures of NCM460 cells were stimulated with LPA. To determine the amount of IL-8/CXCL8 protein secreted by the cells, conditioned medium was collected and centrifuged at 5,000 g for 5 min to remove cell debris. The collected samples were used for IL-8 ELISA (BD Pharmingen).
Materials.
[
-32P]ATP (370 MBq/ml) was from Amersham Pharmacia Biotech (Piscataway, NJ). Bisindolylmaleimide I (GF-109203X), bisindolylmaleimide V, AG-1478, LY-294002, PD-98059, U-0126, rapamycin, and Ro-31-8220 were purchased from Calbiochem. LPA, phorbol 12,13-dibutyrate (PDBu), and trypsin-EDTA solution (1x) were obtained from Sigma (St. Louis, MO). Phosphoserine 744/748 PKD antibody, anti-phospho-ERK1/2 (Thr202/Tyr204) MAb, and anti-phospho-p38MAPK (Thr180/Tyr182) MAb were obtained from Cell Signaling Technology (Beverly, MA). Purified PKD2 protein was obtained from Stressgen (Santa Diego, CA). TRIzol reagent, Lipofectamine 2000, and the SuperScript III one-step RT-PCR system with Platinum Taq DNA polymerase were obtained from Invitrogen. Anti-phospho-PKD2 (Ser876) was obtained from Upstate (Lake Placid, NY). PKD2 siRNA oligonucleotides and siCONTROL nontargeting siRNA pool were obtained from Dharmancon and Ambion. The PKD2 polyclonal antibody was used for immunoprecipitation, and Western blotting was generated against the synthetic peptide GLPTDRDLGGACPPQD, corresponding to amino acids 850865 of PKD2 (by the Antibody Core of CURE: Digestive Diseases Research Center) or obtained from Upstate. Similar results were obtained with the PKD2 antibodies from both sources. The polyclonal anti-PKD3 N17 antibody was raised by immunizing rabbits with a peptide corresponding to the human PKD3 17 amino-terminal residues SANNSPPSAQKSVLPTA using standard procedures (39). Antibodies (PKD C-20, PKC-
C-20, PKC-
C-15, PKC-
, and PKC-
C-15; anti-ERK2 polyclonal antibody) used in Western blot analysis were obtained from Santa Cruz Biotechnologies (Santa Cruz, California). Caco-2, HT-29, and T84 cells were obtained from American Type Culture Collection. Other items were from standard suppliers or as indicated in the text.
Statistical analysis. Paired t-test was applied. All data are expressed as means ± SE. Significance at P < 0.05 and P < 0.01 was as indicated.
| RESULTS |
|---|
|
|
|---|
|
We next determined whether NCM460 cells endogenously express the PKD3 isoform of the PKD family. As shown in Fig. 1C, we did not detect any immunoreactive signal in lysates of these cells by Western blot analysis using a specific antibody directed against PKD3 (39). As positive controls, the same antibody detected ectopic human PKD3 protein in COS-7 cells transfected with green fluorescent protein-PKD3 and endogenous PKD3 protein in rat IEC-18 cells (Fig. 1C). These results indicate that PKD2 protein is the predominate isoform of the PKD family endogenously expressed by NCM460 cells. Thus these human epithelial cells provide a model system to study the regulation and function of PKD2 without significant contribution of the other PKD isoforms.
LPA stimulates PKD2 activation through a PKC-dependent pathway.
LPA is a physiological ligand that mediates its biological effects predominantly via members of the endothelial differentiation gene subfamily of GPCRs, namely LPA1, LPA2, and LPA3 (3). All three LPA receptor subtypes led to the generation of the second messengers inositol 1,4,5-trisphosphate, which stimulates Ca2+ mobilization from intracellular stores, and diacylglycerol, which activates classic and novel PKCs (3). To determine whether PKD2 is regulated through GPCR-mediated pathways, serum-starved NCM460 cells were treated with LPA (5 µM) for various times, lysed, and immunoprecipitated with PKD2 antibody. The immunocomplexes recovered with protein A agarose were then incubated with [
-32P]ATP, and the incorporation of 32P into PKD2 was analyzed by SDS-PAGE and autoradiography to examine the level of autophosphorylation.
As shown in Fig. 2A, PKD2 isolated from unstimulated NCM460 cells had low catalytic activity. Treatment of NCM460 cells with LPA induced a rapid and striking increase in PKD2 kinase activity that was maintained during cell lysis and immunoprecipitation. PKD2 activation was detectable in 30 s and reached a maximum (
10-fold) within 1 min of LPA stimulation (Fig. 2A, top).
|
In many cases, PKD is activated through PKC-dependent activation loop phosphorylation, but PKC-independent pathways, including tyrosine phosphorylation of residues in the pleckstrin homology (PH) domain and other less defined pathways, have also been described (40). Much less is known about the mechanisms leading to the activation of PKD2 in normal epithelial cells. To determine whether PKCs mediate PKD2 activation induced by LPA in NCM460 cells, cultures of these cells were treated with various concentrations of the selective PKC inhibitors Ro-31-8220 (58) or GF-I (54) before LPA stimulation. Control cells received either an equivalent amount of solvent or GF-V, a biologically inactive analog of GF-I, before addition of LPA. As shown in Fig. 2B, treatment with either Ro-31-8220 or GF-I potently blocked PKD2 activation induced by subsequent addition of LPA. Because a previous report suggested that GF-I and Ro-31-8220 also inhibit PKD2 activity (51), we tested the effect of these inhibitors on the activity of purified PKD2 and PKC-
using the exogenous substrate syntide-2. As shown in Fig. 2C, syntide-2 phosphorylation catalyzed by PKD2 was not inhibited by the addition of either Ro-31-8220 or GF-I to the incubation mixture, whereas syntide-2 phosphorylation by PKC-
was completely blocked. These results indicate that Ro-31-8220 and GF-I interfere with LPA-induced PKD2 activation in intact NCM460 cells by inhibiting PKCs rather than PKD2.
A role of PKCs in PKD2 activation is further substantiated by experiments in which NCM460 cells were exposed to biologically active phorbol esters that directly activate classic and novel PKCs and subsequently, with long-term exposure, promote their downregulation. As shown in Fig. 2D, treatment with 100 nM PDBu induced a rapid and striking PKD2 phosphorylation that remains robust at 30 min. Conversely, downregulation of PKCs by exposure to PDBu for 24 h inhibited PKD2 phosphorylation at Ser876, elicited by subsequent stimulation with LPA (Fig. 2E). Collectively, these results indicate that LPA stimulates PKD2 activation through a PKC-dependent pathway.
LPA stimulates IL-8 secretion and NF-
B activity.
We next investigated whether LPA, which is increasingly implicated in immunoregulation (23, 41), could regulate a known and important biological function of colonic epithelial cells, namely, production of cytokines/chemokines. Initially, using a human cytokine microarray assay, we screened the expression profile of cytokines from serum-starved NCM460 cells. The membranes were hybridized with supernatant from LPA-treated (10 µM) for 24 h or vehicle-treated (control) NCM460 cells. The corresponding proteins were detected by a mixture of antibodies and visualized by an enhanced chemiluminescence system. Interestingly, of the 40 anti-cytokine antibodies on the array, only IL-8/CXCL8 was markedly increased after incubation with LPA for 24 h (Fig. 3A).
|
The transcription factor NF-
B plays an important role in the regulation of cytokine/chemokine expression in a variety of cell types (17). Here, we tested whether treatment of NCM460 cells with LPA stimulates NF-
B activation by measuring NF-
B-DNA binding, NF-
B-driven luciferase reporter activity, and I
B
phosphorylation. As shown in Fig. 4A, stimulation of NCM460 cells with 10 µM LPA for 30 min induced NF-
B binding to oligonucleotide probes encoding the consensus sequence of NF-
B. Similarly, LPA increased NF-
B-driven luciferase reporter activity up to approximately fivefold at 4 h (Fig. 4B). Correspondingly, LPA induced I
B
phosphorylation, the prelude to NF-
B nuclear translocation and subsequent activation (Fig. 4C).
|
B activation and IL-8 secretion.
Given that LPA elicited a striking increase in IL-8/CXCL8 production, NF-
B promoter activity, and PKC-dependent PKD2 activation, we hypothesized that these events lie in a signal-transduction pathway, namely, PKC/PKD2/NF-
B/IL-8 production. To determine directly whether PKD2 mediates NF-
B activation in response to LPA, we decreased the endogenous levels of PKD2 using gene silencing by RNA interference. Subconfluent cultures of NCM460 cells were transiently transfected with PKD2 siRNA or nontargeted negative control duplex. To minimize the possibility that the siRNA oligonucleotide may be affecting the expression of a gene other than PKD2, NCM460 cells were transfected with siRNA targeting distinct regions of PKD2. As shown in Figs. 5A and 6B, the PKD2 protein level in NCM460 cells transfected with PKD2 siRNA was dramatically reduced (
80%) compared with cells transfected with nontargeted negative control duplex. In contrast, PKC-
protein levels, determined as a control, were not affected, thus further demonstrating the selectivity of PKD2 gene silencing (Figs. 5A and 6B). PKD2 knockdown dramatically reduced LPA-induced I
B
phosphorylation (Fig. 5A), but it did not interfere with the phosphorylation of either ERK1/2 or p38 MAPK stimulated by exposure to LPA for 30 or 240 min (Fig. 5B). Furthermore, PKD2 siRNA significantly reduced NF-
B-driven luciferase reporter activity (Fig. 5C). These results indicate that PKD2 plays a major role in mediating LPA-induced NF-
B activation.
|
|
80%) inhibited the production of IL-8/CXCL8 induced by LPA (Fig. 6A).
Very recently, Zhao et al. (62, 63) demonstrated that in normal human bronchial epithelial cells IL-8 production in response to LPA is dependent on EGF receptor transactivation stimulated by PKC-
, Lyn kinase, matrix metalloproteinases, and human bronchial EGF. Therefore, if LPA stimulates IL-8 production in NCM460 cells through a similar pathway, inhibition of EGF receptor tyrosine kinase should prevent LPA-stimulated IL-8 production in these cells. As shown in Fig. 6A, treatment of NCM460 cells with the selective EGF receptor tyrosine kinase inhibitor AG-1478 attenuated LPA-stimulated IL-8 production only slightly. These results are consistent with the hypothesis that LPA induces IL-8 production through a PKC-dependent but EGF receptor-independent pathway in human intestinal NCM460 cells and imply that IL-8/CXCL8 production is regulated through different pathways in different epithelial cell types.
We next determined the contribution of PKD2 to LPA-induced IL-8/CXCL8 production in NCM460 cells. As shown in Fig. 6B, transfection of NCM460 cells with siRNAs targeting PKD2 resulted in selective knockdown of PKD2, in agreement with results in Fig. 5A. The salient feature of the results shown in Fig. 6 is that PKD2 knockdown markedly reduced LPA-stimulated IL-8/CXCL8 production by 60% (Fig. 6C). Collectively, the results presented here indicate that a substantial component of LPA-stimulated IL-8/CXCL8 production is mediated by endogenous PKD2 through a NF-
B-dependent pathway in normal human intestinal NCM460 cells.
| DISCUSSION |
|---|
|
|
|---|
LPA has been shown to play a role in immunoregulation, affecting various cell types. In human umbilical endothelial cells, LPA stimulates expression of intercellular adhesion molecule 1, which interacts with activated lymphocytes (23). More recently, LPA has been shown to enhance IL-13 expression in T cells (41). Furthermore, LPA has been shown to stimulate IL-8/CXCL8 production in human bronchial epithelial cells (42) and in human colon cancer cell lines (45, 60). Zhao et al. (62, 63) recently demonstrated that LPA-induced EGF receptor transactivation is a major mediator of IL-8 production, using human bronchial epithelial cells as their model system. In contrast, our study demonstrates that exposure of human intestinal NCM460 cells to the specific EGF receptor tyrosine kinase inhibitor AG-1478 inhibited the production of IL-8/CXCL8 in response to LPA only modestly (
20%). Thus, although in bronchial epithelial cells the majority of the IL-8/CXCL8 production induced by LPA is mediated by EGF receptor transactivation, this pathway has only a modest contribution to the response in intestinal NCM460 cells, the experimental system used in this study.
There is increasing evidence that the PKD family of protein kinases plays fundamental cellular functions in multiple cell types. However, the preponderance of this data has been generated from studies of PKD, the founding member of this protein kinase family. Although the isoforms of the PKD family share extensive homology in their catalytic domains, recent studies demonstrated that these enzymes localize to different organelles in the cell. Furthermore, many aspects of PKD regulation and physiological functions are based on overexpression of wild-type and mutant PKDs in transient transfection systems, which have inherent limitations. Previous studies implicated PKD in a pathway that promotes NF-
B activation in response to oxidative stress (4750). However, most of these studies utilized transfection of PKD mutants or tagged PKD in cells, which express both PKD and PKD2 (29, 4750). None of the previous studies demonstrated a role of endogenous PKDs in mediating GPCR-mediated pathways leading to NF-
B activation (as opposed to oxidative stress), and none identified a role of any of the PKDs in chemokine production.
In this study, we demonstrated that PKD2 is the only PKD family protein detected in nontransformed, human colonic epithelial NCM460 cells. LPA stimulated PKD2 activation in these cells, as judged by measurements of catalytic activity in immunoprecipitates and by phosphorylation of activation loop residues, Ser706/710 and Ser876, the autophosphorylation site in the COOH terminus of PKD2. These results indicate that LPA induces striking endogenous PKD2 activation and multisite phosphorylation in human epithelial cells.
Several lines of evidence indicate that LPA-induced PKD2 activation proceeds via a PKC-dependent pathway. Either pharmacological PKC inhibitors or downregulation of classic and novel isoforms of PKC by long-term exposure to phorbol esters dramatically reduced LPA-stimulated PKD2 phosphorylation at Ser706/710 and Ser876. A prior report suggested that the PKC inhibitors GF-1 and Ro-31-8220 have direct inhibitory effects on immunoprecipitated PKD2 in vitro (51). To clarify the mechanism by which the PKC inhibitors interfere with LPA-induced PKD2 activation in intact cells, we tested the activity of purified PKD2 in the absence or presence of Ro-31-8220 or GF-I. Our results indicate that neither Ro-31-8220 nor GF-I had a direct effect on PKD2 catalytic activity. We verified that Ro-31-8220 or GF-I used in our experiments completely inhibited PKC-
-catalyzed substrate phosphorylation at concentrations that did not exert any inhibitory effect on PKD2 activity. These results are consistent with the notion that LPA stimulates PKD2 activation through a PKC-dependent pathway.
Human intestinal epithelial cells in vivo are thought to represent a major local source of proinflammatory cytokines and, in particular, for the IL-8/CXCL8 chemokine. Indeed, epithelial-derived IL-8/CXCL8 has been shown to support neutrophil infiltration in human mucosal inflammatory diseases of the colon, including ulcerative colitis (21, 28). In the present study, we demonstrate that LPA potently stimulates IL-8/CXCL8 production in nontransformed human colonic epithelial cells NCM460. The levels of IL-8/CXCL8 production in response to LPA were comparable to those induced by pathogenic bacteria (37, 44). Either inhibition of PKC or PKD2 gene silencing utilizing siRNAs targeting distinct PKD2 sequences markedly reduced LPA-stimulated IL-8/CXCL8 production and NF-
B promoter activity. Our results indicate that PKD2 is a novel signal-transduction element in the pathway that mediates IL-8/CXCL8 production in response to LPA via NF-
B.
In addition to NF-
B, the IL-8 promoter contains binding sites for the transcription factors activator protein-1 (AP-1), C-EBP/NF-IL-6, and Tcf/Lef (17, 24). NF-
B is considered to be essential, whereas the others are dispensable for transcriptional activation in some cells but contribute to activation in others (24). Therefore, in some cell types, optimal IL-8/CXCL8 transcription and subsequent expression require contribution of other transcription factors, such as AP-1, C-EBP/NF-IL-6, and/or Tcf/Lef. Although our results with NCM460 cells demonstrate a prominent role of PKD2 in LPA-stimulated IL-8/CXCL8 production, the AP-1/ERK pathway could be required for promoting a maximal IL-8/CXCL8 response to LPA stimulation.
In different intestinal epithelial cell lines, LPA stimulates intestinal epithelial cell migration (53), proliferation (57), and IL-8/CXCL8 production (45, 60). The serum concentrations of this bioactive lipid range from 2 to 20 µM (3). Major sources of LPA in the vicinity of injured epithelial surfaces and inflammatory processes are activated platelets and stimulated fibroblasts (3). We envisage that, after intestinal epithelial injury, bleeding and blood clots ensue with subsequent activation of platelets, resulting in high concentrations of LPA in the local microenvironment. LPA receptor activation (at concentrations such as those used in this study) could then lead to PKD2-mediated NF-
B activation that results in IL-8/CXCL8 production. This in turn may lead to neutrophil recruitment to counter potential bacterial invasion and stimulation of CXCR1/CXCR2-expressing cells, such as myofibroblasts (36), in the lamina propria. In addition to its neutrophil chemoattractant ability, IL-8/CXCL8 has recently been shown to mediate spreading and wound closure by fibroblasts (12). These are important events in the repair of intestinal injury that compromise the integrity of the basement membrane.
It is conceivable that the PKC/PKD2/NF-
B/IL-8 pathway delineated in this study could also operate in intestinal epithelial cells challenged by other stimuli. Toll-like receptors (TLRs), which recognize microbial products known as pathogen-associated molecular patterns, are expressed in colonic epithelial cells (2). Recently, PKCs have been implicated as a downstream targets of TLR signaling (4, 7, 8). Thus PKD2 may serve as a point of convergence that integrates signals from both TLRs and GPCRs.
In summary, our results indicate that a substantial component of the production of the potent proinflammatory chemokine IL-8/CXCL8 is mediated by PKD2 through a NF-
B-dependent pathway in NCM460 cells. This is the first time that endogenous PKD2, and indeed any member of the PKD family, is shown to play an important role in mediating the production of a chemokine in epithelial cells or in any cell type.
| GRANTS |
|---|
|
|
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
modulates growth and differentiation in Caco-2 cells. Gastroenterology 114: 503509, 1998.[CrossRef][Web of Science][Medline]2. Abreu MT, Fukata M, Arditi M. TLR signaling in the gut in health and disease. J Immunol 174: 44534460, 2005.
3. Anliker B, Chun J. Lysophospholipid G protein-coupled receptors. J Biol Chem 279: 2055520558, 2004.
4. Asehnoune K, Strassheim D, Mitra S, Yeol Kim J, Abraham E. Involvement of PKC
/
in TLR4 and TLR2 dependent activation of NF-
B. Cell Signal 17: 385394, 2005.[CrossRef][Web of Science][Medline]
5. Bagowski CP, Stein-Gerlach M, Choidas A, Ullrich A. Cell-type specific phosphorylation of threonines T654 and T669 by PKD defines the signal capacity of the EGF receptor. EMBO J 18: 55675576, 1999.[CrossRef][Web of Science][Medline]
6. Baron CL, Malhotra V. Role of diacylglycerol in PKD recruitment to the TGN and protein transport to the plasma membrane. Science 295: 325328, 2002.
7. Cario E, Gerken G, Podolsky DK. Toll-like receptor 2 enhances ZO-1-associated intestinal epithelial barrier integrity via protein kinase C. Gastroenterology 127: 224238, 2004.[CrossRef][Web of Science][Medline]
8. Chang YJ, Wu MS, Lin JT, Sheu BS, Muta T, Inoue H, Chen CC. Induction of cyclooxygenase-2 overexpression in human gastric epithelial cells by Helicobacter pylori involves TLR2/TLR9 and c-Src-dependent nuclear factor-
B activation. Mol Pharmacol 66: 14651477, 2004.
9. Chiu T, Rozengurt E. PKD in intestinal epithelial cells: rapid activation by phorbol esters, LPA, and angiotensin through PKC. Am J Physiol Cell Physiol 280: C929C942, 2001.
10. Dequiedt F, Van Lint J, Lecomte E, Van Duppen V, Seufferlein T, Vandenheede JR, Wattiez R, Kettmann R. Phosphorylation of histone deacetylase 7 by protein kinase D mediates T cell receptor-induced Nur77 expression and apoptosis. J Exp Med 201: 793804, 2005.
11. Di Mari JF, Mifflin RC, Powell DW. The role of protein kinase C in gastrointestinal function and disease. Gastroenterology 128: 21312146, 2005.[CrossRef][Web of Science][Medline]
12. Dobreva I, Waeber G, James RW, Widmann C. Interleukin-8 secretion by fibroblasts induced by low density lipoproteins is p38 MAPK-dependent and leads to cell spreading and wound closure. J Biol Chem 281: 199205, 2006.
13. Dwinell MB, Lugering N, Eckmann L, Kagnoff MF. Regulated production of interferon-inducible T-cell chemoattractants by human intestinal epithelial cells. Gastroenterology 120: 4959, 2001.[CrossRef][Web of Science][Medline]
14. Frey MR, Saxon ML, Zhao X, Rollins A, Evans SS, Black JD. Protein kinase C isozyme-mediated cell cycle arrest involves induction of p21(waf1/cip1) and p27(kip1) and hypophosphorylation of the retinoblastoma protein in intestinal epithelial cells. J Biol Chem 272: 94249435, 1997.
15. Hausser A, Storz P, Martens S, Link G, Toker A, Pfizenmaier K. Protein kinase D regulates vesicular transport by phosphorylating and activating phosphatidylinositol-4 kinase III
at the Golgi complex. Nat Cell Biol 7: 880886, 2005.[CrossRef][Web of Science][Medline]
16. Hayashi A, Seki N, Hattori A, Kozuma S, Saito T. PKCnu, a new member of the protein kinase C family, composes a fourth subfamily with PKCmu. Biochim Biophys Acta 1450: 99106, 1999.[Medline]
17. Hoffmann E, Dittrich-Breiholz O, Holtmann H, Kracht M. Multiple control of interleukin-8 gene expression. J Leukoc Biol 72: 847855, 2002.
18. Hurd C, Rozengurt E. Protein kinase D is sufficient to suppress EGF-induced c-Jun Ser 63 phosphorylation. Biochem Biophys Res Commun 282: 404408, 2001.[CrossRef][Web of Science][Medline]
19. Hurd C, Waldron RT, Rozengurt E. Protein kinase D complexes with C-Jun N-terminal kinase via activation loop phosphorylation and phosphorylates the C-Jun N-terminus. Oncogene 21: 21542160, 2002.[CrossRef][Web of Science][Medline]
20. Huynh QK, McKinsey TA. Protein kinase D directly phosphorylates histone deacetylase 5 via a random sequential kinetic mechanism. Arch Biochem Biophys 450: 141148, 2006.[CrossRef][Web of Science][Medline]
21. Izzo RS, Witkon K, Chen AI, Hadjiyane C, Weinstein MI, Pellecchia C. Interleukin-8 and neutrophil markers in colonic mucosa from patients with ulcerative colitis. Am J Gastroenterol 87: 14471452, 1992.[Web of Science][Medline]
22. Koon HW, Zhao D, Zhan Y, Simeonidis S, Moyer MP, Pothoulakis C. Substance P-stimulated interleukin-8 expression in human colonic epithelial cells involves protein kinase C
activation. J Pharmacol Exp Ther 314: 13931400, 2005.
23. Lee H, Lin CI, Liao JJ, Lee YW, Yang HY, Lee CY, Hsu HY, Wu HL. Lysophospholipids increase ICAM-1 expression in HUVEC through a Gi- and NF-
B-dependent mechanism. Am J Physiol Cell Physiol 287: C1657C1666, 2004.
24. Levy L, Neuveut C, Renard CA, Charneau P, Branchereau S, Gauthier F, Van Nhieu JT, Cherqui D, Petit-Bertron AF, Mathieu D, Buendia MA. Transcriptional activation of interleukin-8 by beta-catenin-Tcf4. J Biol Chem 277: 4238642393, 2002.
25. Liljedahl M, Maeda Y, Colanzi A, Ayala I, Van Lint J, Malhotra V. Protein kinase D regulates the fission of cell surface destined transport carriers from the trans-Golgi network. Cell 104: 409420, 2001.[CrossRef][Web of Science][Medline]
26. Lorentz O, Cadoret A, Duluc I, Capeau J, Gespach C, Cherqui G, Freund JN. Downregulation of the colon tumour-suppressor homeobox gene Cdx-2 by oncogenic ras. Oncogene 18: 8792, 1999.[CrossRef][Web of Science][Medline]
27. Matthews SA, Liu P, Spitaler M, Olson EN, McKinsey TA, Cantrell DA, Scharenberg AM. Essential role for protein kinase D family kinases in the regulation of class II histone deacetylases in B lymphocytes. Mol Cell Biol 26: 15691577, 2006.
28. Mazzucchelli L, Hauser C, Zgraggen K, Wagner H, Hess M, Laissue JA, Mueller C. Expression of interleukin-8 gene in inflammatory bowel disease is related to the histological grade of active inflammation. Am J Pathol 144: 9971007, 1994.[Abstract]
29. Mihailovic T, Marx M, Auer A, Van Lint J, Schmid M, Weber C, Seufferlein T. Protein kinase D2 mediates activation of nuclear factor kappaB by Bcr-Abl in Bcr-Abl+ human myeloid leukemia cells. Cancer Res 64: 89398944, 2004.
30. Moyer MP, Manzano LA, Merriman RL, Stauffer JS, Tanzer LR. NCM460, a normal human colon mucosal epithelial cell line. In Vitro Cell Dev Biol Anim 32: 315317, 1996.
31. Mumy KL, McCormick BA. Events at the host-microbial interface of the gastrointestinal tract. II. Role of the intestinal epithelium in pathogen-induced inflammation. Am J Physiol Gastrointest Liver Physiol 288: G854G859, 2005.
32. Murray NR, Davidson LA, Chapkin RS, Clay Gustafson W, Schattenberg DG, Fields AP. Overexpression of protein kinase C betaII induces colonic hyperproliferation and increased sensitivity to colon carcinogenesis. J Cell Biol 145: 699711, 1999.
33. Oster H, Abraham D, Leitges M. Expression of the protein kinase D (PKD) family during mouse embryogenesis. Gene Expr Patterns 6: 400408, 2006.[CrossRef][Medline]
34. Page K, Li J, Zhou L, Iasvovskaia S, Corbit KC, Soh JW, Weinstein IB, Brasier AR, Lin A, Hershenson MB. Regulation of airway epithelial cell NF-
B-dependent gene expression by protein kinase C
. J Immunol 170: 56815689, 2003.
35. Perletti GP, Marras E, Concari P, Piccinini F, Tashjian AH Jr. PKC
acts as a growth and tumor suppressor in rat colonic epithelial cells. Oncogene 18: 12511256, 1999.[CrossRef][Web of Science][Medline]
36. Powell DW, Adegboyega PA, Di Mari JF, Mifflin RC. Epithelial cells and their neighbors. I. Role of intestinal myofibroblasts in development, repair, and cancer. Am J Physiol Gastrointest Liver Physiol 289: G2G7, 2005.
37. Raffatellu M, Chessa D, Wilson RP, Dusold R, Rubino S, Baumler AJ. The Vi capsular antigen of Salmonella enterica serotype Typhi reduces Toll-like receptor-dependent interleukin-8 expression in the intestinal mucosa. Infect Immun 73: 33673374, 2005.
38. Rey O, Yuan J, Rozengurt E. Intracellular redistribution of protein kinase D2 in response to G-protein-coupled receptor agonists. Biochem Biophys Res Commun 302: 817824, 2003.[CrossRef][Web of Science][Medline]
39. Rey O, Yuan J, Young SH, Rozengurt E. Protein kinase C nu/protein kinase D3 nuclear localization, catalytic activation, and intracellular redistribution in response to G protein-coupled receptor agonists. J Biol Chem 278: 2377323785, 2003.
40. Rozengurt E, Rey O, Waldron RT. Protein kinase D signaling. J Biol Chem 280: 1320513208, 2005.
41. Rubenfeld J, Guo J, Sookrung N, Chen R, Chaicumpa W, Casolaro V, Zhao Y, Natarajan V, Georas S. Lysophosphatidic acid enhances interleukin-13 gene expression and promoter activity in T cells. Am J Physiol Lung Cell Mol Physiol 290: L66L74, 2006.
42. Saatian B, Zhao Y, He D, Georas SN, Watkins T, Spannhake EW, Natarajan V. Transcriptional regulation of lysophosphatidic acid-induced interleukin-8 expression and secretion by p38 MAPK and JNK in human bronchial epithelial cells. Biochem J 393: 657668, 2006.[CrossRef][Web of Science][Medline]
43. Satoh A, Gukovskaya AS, Reeve JR Jr, Shimosegawa T, Pandol SJ. Ethanol sensitizes NF-
B activation in pancreatic acinar cells through effects on protein kinase C-
. Am J Physiol Gastrointest Liver Physiol 291: G432G438, 2006.
44. Savkovic SD, Ramaswamy A, Koutsouris A, Hecht G. EPEC-activated ERK1/2 participate in inflammatory response but not tight junction barrier disruption. Am J Physiol Gastrointest Liver Physiol 281: G890G898, 2001.
45. Shida D, Kitayama J, Yamaguchi H, Okaji Y, Tsuno NH, Watanabe T, Takuwa Y, Nagawa H. Lysophosphatidic acid (LPA) enhances the metastatic potential of human colon carcinoma DLD1 cells through LPA1. Cancer Res 63: 17061711, 2003.
46. Sinnett-Smith J, Zhukova E, Hsieh N, Jiang X, Rozengurt E. Protein kinase D potentiates DNA synthesis induced by Gq-coupled receptors by increasing the duration of ERK signaling in swiss 3T3 cells. J Biol Chem 279: 1688316893, 2004.
47. Storz P, Doppler H, Toker A. Activation loop phosphorylation controls protein kinase D-dependent activation of nuclear factor
B. Mol Pharmacol 66: 870879, 2004.
48. Storz P, Doppler H, Toker A. Protein kinase C
selectively regulates protein kinase D-dependent activation of NF-
B in oxidative stress signaling. Mol Cell Biol 24: 26142626, 2004.
49. Storz P, Doppler H, Toker A. Protein kinase D mediates mitochondrion-to-nucleus signaling and detoxification from mitochondrial reactive oxygen species. Mol Cell Biol 25: 85208530, 2005.
50. Storz P, Toker A. Protein kinase D mediates a stress-induced NF-
B activation and survival pathway. EMBO J 22: 109120, 2003.[CrossRef][Web of Science][Medline]
51. Sturany S, Van Lint J, Gilchrist A, Vandenheede JR, Adler G, Seufferlein T. Mechanism of activation of protein kinase D2(PKD2) by the CCK(B)/gastrin receptor. J Biol Chem 277: 2943129436, 2002.
52. Sturany S, Van Lint J, Muller F, Wilda M, Hameister H, Hocker M, Brey A, Gern U, Vandenheede J, Gress T, Adler G, Seufferlein T. Molecular cloning and characterization of the human protein kinase D2. A novel member of the protein kinase D family of serine threonine kinases. J Biol Chem 276: 33103318, 2001.
53. Sturm A, Sudermann T, Schulte KM, Goebell H, Dignass FU. Modulation of intestinal epithelial wound healing in vitro and in vivo by lysophosphatidic acid. Gastroenterology 117: 368377, 1999.[CrossRef][Web of Science][Medline]
54. Toullec D, Pianetti P, Coste H, Bellevergue P, Grandperret T, Ajakane M, Baudet V, Boissin P, Boursier E, Loriolle F, Duhamel L, Charon D, Kirilovsky J. The Bisindolylmaleimide Gf-109203x is a potent and selective inhibitor of protein kinase-C. J Biol Chem 266: 1577115781, 1991.
55. Wang Q, Wang X, Evers BM. Induction of cIAP-2 in human colon cancer cells through PKC delta/NF-kappa B. J Biol Chem 278: 5109151099, 2003.
56. Wang X, Wang Q, Hu W, Evers BM. Regulation of phorbol ester-mediated TRAF1 induction in human colon cancer cells through a PKC/RAF/ERK/NF-
B-dependent pathway. Oncogene 23: 18851895, 2004.[CrossRef][Web of Science][Medline]
57. Yang M, Zhong WW, Srivastava N, Slavin A, Yang J, Hoey T, An S. G protein-coupled lysophosphatidic acid receptors stimulate proliferation of colon cancer cells through the
-catenin pathway. Proc Natl Acad Sci USA 102: 60276032, 2005.
58. Yeo EJ, Exton JH. Stimulation of phospholipase D by epidermal growth factor requires protein kinase C activation in Swiss 3T3 cells. J Biol Chem 270: 39803988, 1995.
59. Yuan J, Rey O, Rozengurt E. Activation of protein kinase D3 by signaling through Rac and the
subunits of the heterotrimeric G proteins G(12) and G(13). Cell Signal 18: 10511062, 2006.[CrossRef][Web of Science][Medline]
60. Yun CC, Sun H, Wang D, Rusovici R, Castleberry A, Hall RA, Shim H. LPA2 receptor mediates mitogenic signals in human colon cancer cells. Am J Physiol Cell Physiol 289: C2C11, 2005.
61. Zhao D, Zhan Y, Zeng H, Koon HW, Moyer MP, Pothoulakis C. Neurotensin stimulates interleukin-8 expression through modulation of I
B
phosphorylation and p65 transcriptional activity: involvement of protein kinase C
. Mol Pharmacol 67: 20252031, 2005.
62. Zhao Y, He D, Saatian B, Watkins T, Spannhake EW, Pyne NJ, Natarajan V. Regulation of lysophosphatidic acid-induced epidermal growth factor receptor transactivation and interleukin-8 secretion in human bronchial epithelial cells by protein kinase C delta, Lyn kinase and matrix metalloproteinases. J Biol Chem 281: 1950119511, 2006.
63. Zhao Y, He D, Saatian B, Watkins T, Spannhake EW, Pyne NJ, Natarajan V. Regulation of lysophosphatidic acid-induced epidermal growth factor receptor transactivation and interleukin-8 secretion in human bronchial epithelial cells by protein kinase C
, Lyn kinase, and matrix metalloproteinases. J Biol Chem 281: 1950119511, 2006.
64. Zhukova E, Sinnett-Smith J, Rozengurt E. Protein kinase D potentiates DNA synthesis and cell proliferation induced by bombesin, vasopressin, or phorbol esters in Swiss 3T3 cells. J Biol Chem 276: 4029840305, 2001.
This article has been cited by other articles:
![]() |
J. Yoo, C. Chung, L. Slice, J. Sinnett-Smith, and E. Rozengurt Protein kinase D mediates synergistic expression of COX-2 induced by TNF-{alpha} and bradykinin in human colonic myofibroblasts Am J Physiol Cell Physiol, December 1, 2009; 297(6): C1576 - C1587. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lee, S. Choi, G. Hallden, S. J. Yo, D. Schichnes, and G. W. Aponte P2Y5 is a G{alpha}i, G{alpha}12/13 G protein-coupled receptor activated by lysophosphatidic acid that reduces intestinal cell adhesion Am J Physiol Gastrointest Liver Physiol, October 1, 2009; 297(4): G641 - G654. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yuan, A. Lugea, L. Zheng, I. Gukovsky, M. Edderkaoui, E. Rozengurt, and S. J. Pandol Protein kinase D1 mediates NF-{kappa}B activation induced by cholecystokinin and cholinergic signaling in pancreatic acinar cells Am J Physiol Gastrointest Liver Physiol, December 1, 2008; 295(6): G1190 - G1201. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |