Am J Physiol Cell Physiol Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 292: C756-C766, 2007. First published September 20, 2006; doi:10.1152/ajpcell.00391.2006 Free Article
0363-6143/07 $8.00
This Article
Free upon publication Free Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/2/C756    most recent
00391.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Related articles in Am J Physiol Cell Physiol
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rab, A.
Right arrow Articles by Bebok, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rab, A.
Right arrow Articles by Bebok, Z.

PROTEIN AND VESICLE TRAFFICKING, CYTOSKELETON

Endoplasmic reticulum stress and the unfolded protein response regulate genomic cystic fibrosis transmembrane conductance regulator expression

András Rab,1,2 Rafal Bartoszewski,1 Asta Jurkuvenaite,1 John Wakefield,3 James F. Collawn,1,2 and Zsuzsa Bebok1,2

1Department of Cell Biology and 2The Gregory Fleming James Cystic Fibrosis Research Center, University of Alabama at Birmingham, Birmingham; and 3Tranzyme Corporation, Birmingham, Alabama

Submitted 14 July 2006 ; accepted in final form 16 September 2006


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The unfolded protein response (UPR) is a cellular recovery mechanism activated by endoplasmic reticulum (ER) stress. The UPR is coordinated with the ER-associated degradation (ERAD) to regulate the protein load at the ER. In the present study, we tested how membrane protein biogenesis is regulated through the UPR in epithelia, using the cystic fibrosis transmembrane conductance regulator (CFTR) as a model. Pharmacological methods such as proteasome inhibition and treatment with brefeldin A and tunicamycin were used to induce ER stress and activate the UPR as monitored by increased levels of spliced XBP1 and BiP mRNA. The results indicate that activation of the UPR is followed by a significant decrease in genomic CFTR mRNA levels without significant changes in the mRNA levels of another membrane protein, the transferrin receptor. We also tested whether overexpression of a wild-type CFTR transgene in epithelia expressing endogenous wild-type CFTR activated the UPR. Although CFTR maturation is inefficient in this setting, the UPR was not activated. However, pharmacological induction of ER stress in these cells also led to decreased endogenous CFTR mRNA levels without affecting recombinant CFTR message levels. These results demonstrate that under ER stress conditions, endogenous CFTR biogenesis is regulated by the UPR through alterations in mRNA levels and posttranslationally by ERAD, whereas recombinant CFTR expression is regulated only by ERAD.

endoplasmic reticulum-associated degradation; messenger ribonucleic acid


THE UNFOLDED PROTEIN RESPONSE (UPR) is a cellular stress response that is required for cellular recovery following endoplasmic reticulum (ER) stress. UPR can be generated by numerous biochemical and environmental agents or by overexpression of folding-deficient mutant proteins (39). To decrease the ER load, proteins are targeted for proteasomal destruction through the endoplasmic reticulum-associated degradation (ERAD) process (12, 31). In mammalian cells, the UPR is mediated by three ER-resident sensors: activating transcription factor 6 (ATF6) (14, 37), type I transmembrane protein kinase and endoribonuclease (IRE1), and RNA-activated protein kinase-like ER kinase (PERK) (23). The UPR increases the folding capacity of the cell through transcriptional regulation of an array of genes required for protein folding, ER growth, ER-to-Golgi trafficking, and ERAD (38, 39, 44). It also has become evident that ERAD and UPR signaling pathways play important physiological roles during growth and differentiation by helping cells become accommodated to varying protein loads (39, 50). As a second arm of the ER stress recovery mechanism, the synthesis of a number of proteins is downregulated by PERK and IRE1beta (13, 17). In addition to translational suppression, a recent study also identified 15 transcriptionally downregulated genes in yeast following induction of UPR. Most of these were integral membrane or extracellular proteins (18). These studies indicate that neither the extent nor the specificities of the regulatory processes associated with the UPR are understood.

Regulatory links between UPR and ERAD indicate that the two pathways work in concert (11, 44). In addition to an important role in normal cellular physiology, ERAD of misfolded proteins is the basis of a growing number of pathological conditions referred to as conformational diseases (38, 39). Furthermore, because ER stress activates both ERAD and UPR pathways, the biogenesis of numerous proteins with important cellular functions can be altered. Although significant progress has been made toward understanding the cellular pathways underlying the UPR (50) and ERAD (31, 48), the influence of these pathways on transcription, translation, and maturation of membrane glycoproteins following ER stress has not been elucidated in mammalian cells.

The cystic fibrosis transmembrane conductance regulator (CFTR) is a multidomain membrane glycoprotein with diverse cellular functions (20, 28, 33). Mutations in the CFTR gene cause cystic fibrosis (CF) (35, 36). CF, caused most commonly by deletion of phenylalanine at the 508 position ({Delta}F508), is a conformational disorder attributable to {Delta}F508 CFTR misfolding and degradation by ERAD (34). In addition, whereas the folding and maturation of many newly synthesized wild-type (WT) glycoproteins is typically quite efficient regardless of expression system or cell type, CFTR has been shown to mature inefficiently in most model systems, particularly when it is overexpressed as recombinant protein (4, 25, 46). Although the significance and consequences of inefficient WT CFTR maturation are not understood, it is becoming evident that selection of {Delta}F508 and WT CFTR for ERAD occur at different checkpoints (49) and that the pathways of degradation may differ significantly (10). Based on these findings, it is clear that understanding WT CFTR biogenesis will be necessary to reveal the defects associated with processing mutants such as {Delta}F508.

We have previously shown that under physiological conditions, the maturation of WT CFTR is efficient in epithelial cells endogenously expressing the protein (45). We also reported that cellular stress, caused by reactive oxygen nitrogen species (RONS), inhibits WT CFTR maturation and decreases steady-state CFTR levels and function (5). Recent studies have shown that cell-specific, cytokine-induced posttranscriptional regulation of CFTR expression occurs through the AU-rich elements of the 3'-untranslated region (UTR) of CFTR mRNA, and these elements have been shown to regulate mRNA stability (2). These studies suggest that the cellular milieu is extremely important in determining WT CFTR biogenesis. However, the role of ER stress and the UPR on WT CFTR expression regulation has not been studied in detail.

Although it is widely accepted that WT CFTR is inefficiently processed in recombinant models, studies regarding CFTR biogenesis still have been performed predominantly in recombinant overexpression systems for practical reasons. For example, in most cell lines, and in primary cells in particular, the synthesis rate of the endogenous WT CFTR is too slow to adequately monitor CFTR maturation in a metabolic pulse-chase experiment. It also has been noted that primary cells and endogenous CFTR-expressing cell lines often lose detectable CFTR expression during cell culture, but the reasons for this have not been determined.

The major objective of the present studies was to understand how the UPR, which is activated through pharmacologically induced ER stress, influences endogenous and recombinant WT CFTR biogenesis. Because the UPR regulates transcription and translation and increases the activity of ERAD, both CFTR mRNA levels and protein maturation efficiency were measured. We also tested the effects of recombinant WT CFTR overexpression on the activation of UPR and ERAD of CFTR in cells with efficient endogenous CFTR maturation. We found important differences in recombinant and endogenous WT CFTR expression regulation, and we suggest that perturbation of physiological ER functions that activate the UPR may significantly alter the expression of endogenous CFTR and other transport proteins. Moreover, because pathological conditions such as chronic inflammation and hypoxia may induce ER stress, it is critical to understand how WT CFTR expression is regulated under these conditions.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell Lines and Culture Conditions Calu-3, HT29, and T84 cells were obtained from the ATCC (www.atcc.org). HeLaWT (expressing recombinant WT CFTR) and Calu-3WT (overexpressing recombinant WT CFTR) were transduced with a TranzVector (Tranzyme, Birmingham, AL) and selected as previously described (3). Cells were cultured in DMEM (Life Technologies) with 10% FBS at 37°C in a humidified incubator in 5% CO2.

Antibodies Anti-CFTR COOH-terminal monoclonal antibody (24-1), which was originally produced and characterized by Genzyme (Cambridge, MA), was purified from hybridoma supernatant (ATCC no. HB-11947) and used as previously described (3, 45).

Induction of ER and Cytosolic Stress Cells were treated with 100 µM N-acetyl-L-leucyl-L-leucyl-L-norleucinal (ALLN; Sigma) or 20 µM epoxomycin (Biomol) for time intervals specified in each experiment (15). Brefeldin A (eBioscience) was added to the tissue culture medium at 3 µg/ml (final concentration) for 4 h (16). Tunicamycin (Sigma) was added to samples for 12–14 h at 5 µg/ml (final concentration) (16). To induce cytosolic stress, we treated cells with 100 µM arsenite for 6 h (29, 47).

Immunoprecipitation of CFTR CFTR was immunoprecipitated using anti-COOH-terminal 24-1 monoclonal antibody followed by in vitro phosphorylation with [{gamma}-32P]ATP (NEN) and cAMP-dependent protein kinase (Promega). Labeled CFTR was analyzed using SDS-PAGE and autoradiography as described previously (5). Densitometry was performed using IPLab software (Scanalytics). All lysis buffers were supplemented with a protease inhibitor cocktail (Complete Mini; Roche).

Metabolic Pulse Chase After a 30-min methionine starvation in methionine/cysteine-free MEM at 37°C, 300 µCi/ml of EasyTag protein labeling mixture ([35S]methionine/cysteine; NEN) was added to pulse label proteins for 30 min. Following the pulse, the medium was changed to nonradioactive methionine-rich solution for the time intervals specified. Cells were lysed in RIPA buffer, and CFTR was immunoprecipitated using 1 µg of 24-1 monoclonal antibody and 20 µl of protein A+G-agarose. Immunoprecipitated samples were analyzed using SDS-PAGE (6% gels) and detected using autoradiography (PhosphorImager; Molecular Dynamics). CFTR maturation efficiency was measured using IPLab software as described previously (45).

Real-Time RT-PCR Total cellular RNA was isolated using the RNeasy mini kit (catalog no. 74106; Qiagen) according to the manufacturer's protocol. RNA concentration was calculated based on the absorbance of samples at 260 nm. RNA samples were stored at –20°C. RT-PCR was performed using TaqMan One-Step RT-PCR master mix reagents (catalog no. 4309169; Applied Biosystems) containing carboxy-X-rhodamine (ROX) as a passive reference to normalize non-PCR-related signal in each reaction. Probes were conjugated to carboxyfluorescein (5'-end) and a nonfluorescent quencher (3'-end). TaqMan assays utilize the 5' exonuclease activity of the DNA polymerase to free the fluorescent dye from the quencher during the PCR reaction. The proportionally rising dye concentration results in a crescent absolute fluorescence. Total CFTR was evaluated using Assay-On-Demand primer mix (assay ID: Hs00357011_m1). Endogenous CFTR was amplified using assays CFTR5UTR-TS7, CFTR5UTR-TS7F, and CFTR5UTR-TS7R (GACATCACAGCAGGTCAGAGAAAA and GCTCCTAATGCCAAAGACCTACTA). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH; assay ID: Hs99999905_m1) and 18S RNA (assay ID: Hs99999901_s1) were studied in parallel as internal controls. HSPA5/BiP (assay ID: Hs00607129_gH) and XBP1 (assay ID: Hs00231936_m1) were amplified to test for UPR activity. Transferrin receptor (TR; assay ID: Hs99999911_m1) was amplified as an additional control. TaqMan RT-PCR reactions were performed in 25-µl final volumes containing 5 µl (10x dilution of stock) of RNA sample, AmpErase UNG (2x, 12.5 µl), MultiScribe reverse transcriptase and RNase inhibitor (40x, 0.625 µl), primers and probe (20x, 1.25 µl), and RNase-free water (5.625 µl). Quantitative real-time PCR was performed using the ABI PRISM 7500 sequence detection system. Five 1-log serial dilution reactions were conducted in duplicate. Data were exported from ABI PRISM 7500 software into Microsoft Excel and analyzed using the relative standard curve method. Cycle threshold values for each serial dilution were plotted, and the values were calculated from the y-intercept and slope of the standard curve using the Excel Trendline option. These values were then used to calculate the input amount of mRNA samples. The input amount of target mRNA was normalized to GAPDH mRNA as an endogenous control. Results are plotted as CFTR mRNA levels relative to 18S RNA (means ± SD).

Measurement of ATP/ADP Ratio The metabolic state of cells following activation of ER stress was assessed by measuring cellular ATP/ADP ratios using an HPLC method as described previously (26).

Cytosolic RNase Activity Measurements Cytosolic RNase activity was measured using a protocol described by Baudouin et al. (2) with minor modifications.

Cytosolic protein extraction. ER stress was induced with 100 µM ALLN or 5 µg/ml tunicamycin for 6 h. Untreated cells were used as controls. Cells were washed, lysed at 4°C in hypotonic medium (10 mM KCl, 10 mM HEPES, pH 7.4, and 1 mM MgCl2) containing protease (Roche) and phosphatase (Sigma) inhibitors and homogenized. Unbroken cells were removed by centrifugation at 2,500 g for 15 min. The supernatant was centrifuged for 1 h at 100,000 gto separate membrane (pellet) and cytosolic (supernatant) fractions. After the protein concentrations were determined, the supernatants were immediately used in RNA incubation experiments. The protein concentrations in the cytosolic fractions of treated and control cells were similar and normalized for each experiment. All experiments were performed in RNase-free environment.

Incubation. Total RNAs (20 µg/sample) isolated from Calu-3 cells were incubated with the cytosolic fractions (20 µg/sample) under gentle stirring in an RNase digestion buffer containing 0.6 M NaCl, 20 mM Tris, pH 7.4, and 10 mM EDTA for 20 min at 25°C. All incubations were stopped by the addition of TRIzol (Invitrogen), and RNA was again extracted. CFTR mRNA content was measured using real-time RT-PCR.

Statistical Analysis Results are expressed as means ± SD. Statistical significance among means was determined using the Student's t-test (2 samples).


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Induction of ER Stress and Activation of the UPR Reduce CFTR Maturation Efficiency in Calu-3 Cells The effects of ER stress and the UPR on endogenous WT CFTR maturation were tested in Calu-3 cells. Previous studies showed that inhibition of the proteasome causes ER stress and activates the UPR (15, 19, 38). Based on these results, Calu-3 cells were treated with 100 µM ALLN for 6 h. Activation of the UPR was tested by measuring spliced XBP1 and HSPA5/GRP78/BiP (BiP) mRNA levels using real-time RT-PCR. XBP1 is a transcription factor that is activated upon frameshift splicing by IRE1 RNase (1, 30). The spliced XBP-1 mRNA encodes a basic leucine zipper transcription factor that enters the nucleus and acts during ER stress to activate UPR target genes via direct binding to the UPR consensus element (UPRE) (1, 30). BiP is a central regulator of ER stress that controls the activity of IRE1, PERK, and ATF6 through binding and release as a major ER chaperone (22). Therefore, we used these reporters to monitor UPR activity. After 6 h of ER stress, significant increases in spliced XBP1 and BiP mRNA levels were detected, indicating UPR activation (Fig. 1A).


Figure 1
View larger version (28K):
[in this window]
[in a new window]

 
Fig. 1. Cystic fibrosis transmembrane conductance regulator (CFTR) maturation efficiency is decreased following activation of the unfolded protein response (UPR). A: Calu-3 cells were cultured in the presence or absence of 100 µM ALLN for 6 h. Total RNA was isolated from cells and subjected to real-time RT-PCR analysis to measure spliced XBP1 (sXBP1) and BiP mRNA levels as reporters of UPR activity. A significant increase in both sXBP1 and BiP mRNA levels was detected (n = 8; *P < 0.01). B: Calu-3 cells were cultured in the presence or absence of 100 µM ALLN for 6 h, followed by metabolic pulse-chase studies. Cells were pulse labeled with 300 µCi/ml 35S-labeled amino acids and chased in nonradioactive medium for the time periods specified. CFTR was immunoprecipitated with anti-CFTR 24-1 antibody and separated by SDS-PAGE on 6% gels. Representative gels of 3 separate experiments are shown. C: gels were analyzed using a PhosphorImager, and CFTR maturation efficiency was measured by comparing the density of labeled band B (100%) after a 30-min pulse with the density of band C after 4 h of chase using IPLab software. Disappearance of band B (calculated based on densitometry at each chase time point; solid lines) and formation of band C (dotted lines) was measured as a function of time and plotted as a percentage of band B density at the 0 time point. A representative plot of 3 separate experiments is shown.

 
It has been suggested that the functions UPR and ERAD are coordinated and that activation of the UPR leads to enhanced ERAD (44). We therefore tested whether activation of the UPR results in enhanced ERAD of CFTR with subsequent decreased WT CFTR maturation efficiency. Following activation of the UPR, we performed metabolic pulse-chase experiments to follow CFTR maturation efficiency in Calu-3 cells. Untreated Calu-3 cells were tested as controls (Fig. 1B). These experiments were performed to test the hypothesis that CFTR becomes a substrate for ERAD if the activity of ERAD is enhanced. In agreement with our previous results (45), CFTR maturation is efficient in control Calu-3 cells (>90% maturation). However, following induction of ER stress and activation of the UPR, which enhances the activity of ERAD, endogenous WT CFTR maturation was severely compromised (~40% maturation) as shown in Fig. 1B. These results suggest that increased ERAD activity may cause inefficient WT CFTR maturation measured in most models.

Induction of ER Stress and Activation of the UPR Decrease Endogenous CFTR mRNA Levels and Protein Synthesis The extent and specificity of protein expression regulation following ER stress and UPR activation are not understood in mammalian cells (40). To test whether CFTR mRNA levels are affected, we measured genomic CFTR mRNA levels in three different cell lines, Calu-3, T-84, and HT-29, before and after activation of the UPR. An increase in spliced XBP1 mRNA was used as the criterion for UPR activity (Fig. 2A, left). When the UPR was activated, CFTR mRNA levels decreased significantly to 25–45% of controls in all three cell lines tested (Fig. 2). Similar results were obtained using either GAPDH mRNA or 18S RNA as reference. Because GAPDH mRNA levels are closer to the mRNA levels of CFTR and XBP1 than 18S RNA, results are plotted as the function of GAPDH mRNA (Fig. 2A, right). Transferrin receptor (TR) mRNA levels were measured as an additional control. TR was chosen because it is a membrane protein expressed in most cells at high levels, and its expression is regulated both transcriptionally and posttranscriptionally (8, 81). Transcriptional regulation of TR is necessary to maintain cellular homeostasis, and iron levels regulate TR mRNA stability (8, 81 ). Both TR and CFTR mRNAs contain AU-rich elements at the 3'-UTR that are important in exosome-mediated mRNA decay, and these elements regulate protein expression posttranscriptionally through mRNA stability (2, 9, 43). Therefore, decreases in both CFTR and TR mRNA levels would suggest an enhanced exosome-mediated mRNA decay. The results shown in Fig. 2Bindicate that TR mRNA levels were not changed after induction of ER stress, suggesting that under these conditions, there was not a global enhancement of cytosolic RNase activity.


Figure 2
View larger version (26K):
[in this window]
[in a new window]

 
Fig. 2. Induction of ER stress and activation of the UPR decrease endogenous CFTR mRNA and protein levels. A: sXBP1 and CFTR mRNA levels. Real-time RT-PCR was used to measure sXBP1 (left) and CFTR mRNA levels (right) in Calu-3, T84, and HT29 cells expressing endogenous CFTR following induction of ER stress (100 µM ALLN, 6 h). Spliced XBP1 increased significantly in all 3 cell lines tested, whereas CFTR mRNA levels decreased to 50–80% of controls following UPR activation (n = 8). *P < 0.01. No change in GAPDH mRNA levels was detected, and GAPDH was used as reference to quantify sXBP1 and CFTR mRNA levels. B: transferrin receptor (TR) mRNA levels. Real-time RT-PCR was used to measure TR mRNA levels from the same samples as sXBP1 and CFTR as a control. No significant changes in TR mRNA levels were detected. C: CFTR band B protein levels. Control and ER-stressed Calu-3, T84, and HT29 cells were lysed, and CFTR was immunoprecipitated from 500 µg of total cellular proteins in triplicate. Samples were in vitro phosphorylated (MATERIALS AND METHODS) and separated by SDS-PAGE on 6% gels. Representative gels of 3–5 individual experiments are shown from each cell line (left). CFTR band B levels were compared by densitometry (right) using IPLab software (n = 3) *P < 0.05.

 
We also measured steady-state CFTR protein levels in these cell lines following UPR activation and observed a marked decrease in newly synthesized band B CFTR (Fig. 2C). Only a very small amount of band B CFTR is present in endogenous CFTR-expressing cells at steady state, even under optimal conditions, since the synthesis rate is low (45). Because the half-life of the fully processed band C CFTR is long (>24 h) in these cells (45), no significant changes in total band C CFTR were detected following 6 h of ER stress.

The previous experiments were performed following a 6-h ER stress. We next asked whether decreased CFTR mRNA correlates with the activation of the UPR and production of XBP1 transcription factor in a time-dependent fashion. Spliced XBP1, CFTR, and TR mRNA levels were measured hourly for 8 h following induction of ER stress. The results indicate that spliced XBP1 mRNA levels reach a maximum after 3 h and remain significantly higher up to 8 h (Fig. 3). In contrast, CFTR mRNA begins to decrease after 3 h (XBP1 maximum) and reaches a minimum at ~20% by 8 h (Fig. 3). The specificity of CFTR mRNA downregulation by the UPR was assessed by measuring TR mRNA levels from the same samples. TR mRNA remained constant during the 8-h ER stress. As an additional control, cellular ATP/ADP ratios were measured at each time point and extended to 12 h to test for general cellular toxicity (see MATERIALS AND METHODS). No significant changes in ATP levels were detected (data not shown).


Figure 3
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 3. Time-dependent correlation between UPR activity and decreasing CFTR mRNA levels. Calu-3 cells were treated with 100 µM ALLN for the time periods specified (1–8 h), and total RNA was isolated. Spliced XBP1, CFTR, GAPDH, and TR mRNA levels were measured from each sample. No changes in TR or GAPDH mRNA levels were seen. Spliced XBP1, CFTR, and TR levels are plotted as a function of GAPDH mRNA. Shown is 1 of 2 individual experiments performed in duplicate.

 
ER Stress Caused by Brefeldin A or Tunicamycin Decreases Endogenous CFTR mRNA Levels To test whether the observed changes in CFTR biogenesis were specific to ER stress and UPR activation caused by proteasome inhibition, we conducted experiments using two alternative ER stress agents, brefeldin A (16, 24) and tunicamycin (32). Real-time RT-PCR was performed in Calu-3 cells treated with brefeldin A or tunicamycin to measure endogenous CFTR mRNA levels. The spliced variant of XBP1 was measured to monitor UPR activation. ER stress caused by brefeldin A or tunicamycin resulted in an increase in spliced XBP1 levels and a decrease in endogenous WT CFTR transcript levels very similar to those observed with proteasome inhibition (Fig. 4). There were no detectable changes in TR mRNA levels (data not shown). To test whether the decrease in CFTR mRNA levels was caused by ER but not cytosolic stress, we also treated Calu-3 cells with 100 µM arsenite, a method that previously has been shown to cause oxidative cytosolic stress without ER stress and UPR activation (29, 47). No changes in CFTR, GAPDH, or spliced XBP1 mRNA levels were measured following arsenite treatment (data not shown). These results further support the idea that the changes seen in CFTR mRNA levels following ER stress induction using three different methods were specifically caused by ER stress responses.


Figure 4
View larger version (18K):
[in this window]
[in a new window]

 
Fig. 4. ER stress caused by brefeldin A or tunicamycin activates the UPR and decreases endogenous CFTR transcript levels. Cells were treated with 10 µg/ml brefeldin A or 5 µg/ml tunicamycin (TM) for 6 or 12 h, respectively, and total RNA was isolated. Spliced XBP1 and CFTR mRNA levels were measured using real-time RT-PCR and plotted relative to GAPDH mRNA levels (n = 8; *P < 0.001).

 
Overexpression of Recombinant WT CFTR in Calu-3 Cells Results in Inefficient Maturation Without Increasing UPR Activity To test the effect of recombinant CFTR overexpression on CFTR ERAD and activation of the UPR, we developed a stable cell line, Calu-3WT, that expresses recombinant CFTR on a background of endogenous CFTR expression. It has been suggested that overexpression of recombinant proteins causes ER stress and activates both ERAD and the UPR (38). To characterize the recombinant CFTR-overexpressing Calu-3 cell line (Calu-3WT), we measured steady-state CFTR levels by immunoprecipitation from 250 µg of total cell lysates and directly compared them with that of parental Calu-3 cells expressing only endogenous CFTR. Surprisingly, overexpression of recombinant WT CFTR under the control of the CMV promoter did not increase steady-state CFTR levels in Calu-3WT cells (Fig. 5A). In contrast to protein levels, total CFTR mRNA levels were higher in the transduced Calu-3WT cells than in the parental cell line (Fig. 5B). This suggested either decreased CFTR synthetic rates or inefficient CFTR maturation in Calu-3WT cells. To discriminate between these possibilities, we performed metabolic pulse-chase studies. The results indicate a significant decrease in CFTR maturation efficiency in Calu-3WT cells (~60% maturation) compared with the parental cells (~100% maturation) (Fig. 5C). CFTR synthesis rates were slightly elevated in Calu-3WT cells as shown by the increased density of band B immediately after the pulse (Fig. 5C). This result supports the hypothesis that recombinant CFTR overexpression results in inefficient CFTR maturation. As a consequence, steady-state CFTR protein levels in Calu-3 and Calu-3WT cells remain similar.


Figure 5
View larger version (21K):
[in this window]
[in a new window]

 
Fig. 5. A: CFTR protein levels are the same in Calu-3 and Calu-3 wild-type (Calu-3WT) cells. Total cellular lysates (250 µg) were immunoprecipitated (1 µg/sample 24-1 anti-CFTR antibody, 20 µl of protein A-agarose), in vitro phosphorylated using [{gamma}-32P]ATP and cAMP-dependent protein kinase, and analyzed using SDS-PAGE and autoradiography. A gel representative of 3 experiments is shown (left). Densitometry results are plotted to show relative amounts of CFTR expressed in the cell lines (right), n = 3. N.S., no significant difference. B: increased CFTR mRNA levels in Calu-3WT cells. CFTR mRNA levels were measured using real-time RT PCR. GAPDH was amplified as internal control, and results are plotted relative to GAPDH mRNA levels (n = 6; *P < 0.05). C: CFTR maturation efficiency is decreased in Calu-3 WT cells compared with Calu-3. Calu-3 cells were pulse labeled with 300 µCi/ml 35S-labeled amino acids. After the pulse, the [35S]methionine/cysteine-containing medium was replaced with complete medium. Cells were lysed at the time points specified, and CFTR was immunoprecipitated with anti-CFTR 24-1 antibody. Samples were separated using SDS PAGE on 6% gels and analyzed using a PhosphorImager. CFTR maturation efficiency was measured by comparing the density of labeled band B (100%) after a 30-min pulse to the density of band C after 4 h of chase, using IPLab software. Results are plotted as percentages of newly synthesized band B converted to band C by the end of a 4-h chase (average ± SD, n = 4; *P< 0.05).

 
To test whether overexpression of recombinant WT CFTR activates the UPR in Calu-3WT cells, we measured spliced XBP1 and BiP mRNA levels and compared them with those of parental Calu-3 cells. A mixed population of Calu-3WT and two clones, one with low (Calu-3WT1) and another with high (Calu-3WT2) recombinant CFTR expression levels, were examined. sXBP1 and BiP mRNA levels were normalized to either GAPDH mRNA or 18S RNA. The results indicate that overexpression of recombinant WT CFTR does not activate the UPR as monitored by an increase in spliced XBP1 or BiP levels (Fig. 6A). Next, we tested whether induction of recombinant WT CFTR synthesis activates the UPR. To increase recombinant CFTR synthesis, we treated Calu-3 and Calu-3WT cells with 1 mM Na-butyrate for 12 h. Na-butyrate treatment increased recombinant CFTR mRNA and protein levels without a corresponding positive effect on endogenous CFTR levels (Fig. 6B). The decrease in total CFTR mRNA and protein levels in Calu-3 parental cells may be attributed to a toxic effect by Na-butyrate. Considering that steady-state CFTR levels in Calu-3 and Calu-3WT cells are similar in the absence of induction (Fig. 5), the increase in CFTR levels following induction with Na-butyrate is likely to be a temporary effect. To test whether increased recombinant CFTR synthesis causes ER stress and activates the UPR, we measured spliced XBP1 mRNA levels. Again, no significant changes in XBP1 levels were detected, indicating that an acute increase in WT CFTR synthesis rates does not activate the UPR (Fig. 6C).


Figure 6
View larger version (24K):
[in this window]
[in a new window]

 
Fig. 6. Overexpression of recombinant CFTR in Calu-3 cells does not activate the UPR. A: sXBP1 levels were similar in Calu-3 and Calu-3 WT cells as measured using real-time RT PCR (average ± SD, n = 6). B: Na-butyrate treatment (1 mM for 12 h) increased CFTR mRNA levels significantly in Calu-3 WT cells, but rather decreased CFTR mRNA levels in Calu-3 cells expressing endogenous CFTR only (top). Similar to mRNA, Na-butyrate treatment increased recombinant CFTR levels and had no effect on endogenous WT CFTR expression levels as measured by immunoprecipitation and in vitro phosphorylation. Relative total CFTR mRNA levels (CFTR/GAPDH) and a representative gel of immunoprecipitated CFTR are shown for each cell line and for each condition (control or butyrate) in duplicate (bottom left). The results of densitometry are plotted at right (average ± SD, n = 4). *P < 0.02. C: sXBP1 mRNA levels were measured in control and Na-butyrate treated Calu-3 and Calu-3 WT cells and showed no significant increase following induction of CFTR synthesis, n = 6.

 
ER Stress and the UPR Have No Effect on Recombinant CFTR mRNA Levels Because ER stress and activation of the UPR resulted in decreased endogenous CFTR mRNA levels, we next tested whether ER stress regulates recombinant CFTR transcript levels. In these studies, a HeLaWT cell line (3, 45) expressing recombinant WT CFTR only and Calu-3WT expressing both recombinant and endogenous CFTR were examined. Following induction of ER stress by proteasome inhibition, the levels of sXBP1 and BiP mRNAs were measured to monitor UPR activation. CFTR mRNA levels were measured using two different primer sets, a set designed to amplify endogenous and recombinant CFTR, and a set constructed to amplify only endogenous CFTR (see MATERIALS AND METHODS). In contrast to endogenous WT CFTR-expressing cells (Fig. 2), no changes in CFTR mRNA levels were detected in HeLaWT cells expressing recombinant CFTR only (Fig. 7A). To further differentiate the effects of ER stress and the UPR on recombinant and endogenous CFTR mRNA levels, we tested Calu-3WT cells. In these cells expressing considerably more (~5x) recombinant than endogenous CFTR mRNA (Fig. 5B), there was no significant change in total CFTR mRNA (endogenous + recombinant) levels following ER stress (Fig. 7B, top). However, endogenous CFTR mRNA levels decreased significantly (Fig. 7B, bottom). Under the same conditions, TR mRNA levels remained unchanged (data not shown). These results further demonstrate that the decreased CFTR mRNA following ER stress is specific to endogenous CFTR, even when recombinant and endogenous CFTR are expressed in the same cell.


Figure 7
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 7. ER stress and UPR have no effect on recombinant CFTR mRNA levels. The effects of ER stress and activation of the UPR on recombinant CFTR expression levels were tested in HeLaWT (A; expressing recombinant WT CFTR only) and in Calu-3WT (B; expressing endogenous and recombinant CFTR). UPR was induced with ALLN (100 µM, 6 h). Total and recombinant CFTR mRNA levels were measured using real-time RT-PCR. No changes in recombinant CFTR mRNA were detected following activation of the UPR. Endogenous CFTR mRNA levels decreased to ~50% in Calu-3 WT cells (n = 6, *P < 0.001).

 
Decreased Endogenous CFTR mRNA Levels are Not the Result of Enhanced Cytosolic mRNA Decay To determine whether decreased endogenous CFTR mRNA levels were the result of transcriptional repression or enhanced mRNA degradation in the cytosol, we performed experiments to test for increased cytosolic RNase activity following induction of ER stress. Cytosolic fractions from ER stressed and control Calu-3 cells were incubated with RNA extracted from Calu-3 cells containing CFTR mRNA. Nuclease activity was stopped by the addition of TRIzol reagent, followed by RNA extraction and real-time RT-PCR to amplify CFTR mRNA. RNA incubated with buffer only was tested as control. The results indicate no differences in RNase activity between control and ER-stressed Calu-3 cell cytosolic fractions (Fig. 8). The presence of active RNase in the cytosolic fractions is demonstrated by the ~20% decrease in CFTR mRNA levels in both control and ER-stressed Calu-3 cell cytosolic fractions compared with the control incubated with buffer (Fig. 8). The CFTR mRNA decay was similar to previously reported results (2). These results indicate that decreased genomic CFTR mRNA levels following ER stress and activation of the UPR are not the result of enhanced cytosolic mRNA decay.


Figure 8
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 8. Cytosolic RNase activity is not increased following induction of ER stress. Cytosolic fractions were isolated from control and ER-stressed Calu-3 cells and incubated with equal amounts of total RNA isolates from Calu-3 cells containing CFTR mRNA (20 µg of cytosolic proteins, 20 µg of RNA, 25°C, 30 min) in RNA digestion buffer, followed by extraction of RNA and real-time RT-PCR of CFTR mRNA levels. RNA samples incubated with buffer alone (no nucleases) were used as control. No differences in nuclease activities on CFTR mRNA of control and ER-stressed cytosolic samples were measured. The ~20% decrease in CFTR mRNA levels following incubation with cytosolic proteins compared with nonincubated mRNA samples indicates the presence of active nucleases in the cytosolic fraction. These experiments were performed on 4 individual samples under each condition and repeated twice. *P < 0.05.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The studies presented concentrate on the differences in genomic and recombinant WT CFTR biogenesis regulation following induction of ER stress. ER stress activates cellular recovery mechanisms such as the UPR and ERAD. The UPR increases the folding capacity of the ER by increasing the synthesis of chaperones and ER membrane components (38) and decreases the protein load both transcriptionally (18) and posttranscriptionally by decreasing protein synthesis (13, 17). The UPR also increases the capacity of ERAD, the main posttranslational mechanism that regulates protein biogenesis (11). These pathways are equally relevant for both normal cellular homeostasis as well as disease pathogenesis (for review, see Refs. 38, 39). Because our studies concentrate on WT CFTR expression regulation, the results presented are not directly relevant to the pathogenesis of cystic fibrosis caused by mutations in the cftr gene. In contrast, our results highlight the potentially important consequences of ER stress responses regarding membrane protein expression regulation. In agreement with our previous studies (45), we have shown that endogenous WT CFTR is not normally a substrate for ERAD but that under ER stress conditions, endogenous WT CFTR biogenesis becomes regulated by ERAD. We also have shown that following induction of ER stress and activation of the UPR, but not under cytosolic stress conditions, endogenous WT CFTR mRNA levels decrease significantly. The decrease in endogenous WT CFTR mRNA levels is likely the result of transcriptional repression through the UPR, since incubation of RNA samples containing CFTR mRNA with cytosolic fractions (containing nuclease complexes such as the exosome) did not reveal an increase in nuclease activity in the ER stressed cytosolic samples. In contrast to endogenous CFTR, ER stress had no effect on recombinant CFTR mRNA levels, suggesting that upstream elements or intronic sequences present only in endogenous CFTR are responsible for decreased CFTR mRNA levels. Furthermore, we have shown that overexpression of recombinant CFTR does not activate ER stress responses, and this would help to explain the inefficient recombinant WT CFTR maturation seen in most models.

What is the significance of these results? Early studies indicated that only 20–55% of newly synthesized 140-kDa, core glycosylated WT CFTR molecules acquire complex oligosaccharide chains, and this represents the percentage of CFTR molecules that traffic through post-ER compartments (25, 46). Although the inefficiency in WT CFTR maturation was first suggested to be the consequence of overexpression (7), it later was also shown in cell lines expressing low levels of the protein (46). On the basis of these results, it has been proposed that the absence of assembly factors or other changes caused by transformation of cells may account for inefficient CFTR maturation (20). However, the significance of this posttranslational CFTR expression regulation is not understood. Furthermore, although transcriptional (for review see Ref. 27) and posttranscriptional (through mRNA stability; Ref. 2) regulation of CFTR expression have been investigated in endogenous CFTR-expressing cells and during development, the role of ER stress on CFTR expression regulation has not been examined. The studies presented are the first to show endogenous CFTR expression regulation at multiple levels by ER stress responses and will contribute to our understanding of how membrane protein expression is regulated under stress conditions.

Our careful investigation of recombinant and endogenous WT CFTR biogenesis in epithelial cell lines shows significant differences in WT CFTR maturation efficiency between different model cell lines (45). When sufficient levels of the protein are synthesized that allow for metabolic pulse-chase analysis, the results indicate that the maturation of endogenous WT CFTR is efficient (45). To be able to label sufficient endogenous CFTR, cell culture conditions have to be carefully optimized, because either starvation or overgrowth of the culture results in significantly decreased endogenous CFTR synthesis and low labeling efficiency (Bebok Z, unpublished observation). Interestingly, starvation is one of the original methods for inducing ER stress that results in the activation of both ERAD and the UPR (50), suggesting that the biogenesis of endogenous WT CFTR is downregulated under these conditions.

Oxidative cytosolic stress following a 12- to 24-h exposure to butylhydroquinone has been shown to reduce CFTR function by decreasing mRNA stability (6). Cigarette smoke extract also has been shown to decrease chloride secretion in human bronchial epithelial cells, suggesting that this too may be the result of decreased CFTR expression (21). Furthermore, CFTR mRNA stability by cytokines is regulated through the AU-rich element of the 3'-UTR, which plays role in exosome-mediated mRNA decay (2). These studies suggest that oxidative stress and inflammation decrease CFTR levels posttranscriptionally by decreasing the half-life of CFTR mRNA. However, it is not clear whether these methods induce ER stress. In contrast, previous reports (29) and our results demonstrate that treatment with arsenate for the same time period as ALLN or tunicamycin does not cause ER stress and has no effect on CFTR or GAPDH message levels. This suggests that the time frame for posttranscriptional (mRNA stability) regulation is longer than the likely transcriptional regulation presented. Furthermore, the specific downregulation of genomic CFTR mRNA levels argues against decreased mRNA stability, since endogenous human TR mRNA levels with similar AU-rich regions in the 3'-UTR that would mediate exosomal decay (2) remained unchanged following ER stress and UPR activation. Decreases in both TR and CFTR mRNA would indicate an increased exosome-mediated mRNA turnover in our experiments. However, based on the results and the known pathways regulated by the UPR (transcription, translation, and ERAD), it is most likely that the decrease in CFTR mRNA seen in our studies results from transcriptional downregulation.

CFTR is not an abundant protein, even in cells with relatively high endogenous CFTR levels such as the Calu-3 cells used in this study. If transcription inhibition is a normal component of the cellular processes used to decrease ER load under stress conditions, then why is CFTR a target? Although it has been shown in yeast that cellular stress may downregulate the expression of certain membrane proteins transcriptionally (18), the mechanism of this process and the nature of the inhibiting transcription factors are not known and require further investigation.

Our finding that overexpression of recombinant WT CFTR does not cause ER stress or activate the UPR also is significant. Previous studies have indicated that WT CFTR carries structural features that may contribute to inefficient folding (42). This suggests that overexpression of CFTR could increase the likelihood of misfolding, resulting in activation of the UPR. However, in agreement with our results, recent studies investigating ER stress responses following the overexpression of LDL receptor showed that only the ER retention mutant, not WT LDL receptor overexpression, activated the UPR (41). We can speculate that overexpression of the ER retention mutant {Delta}F508 CFTR may cause ER stress responses similar to those of the mutant LDL receptor, considering that {Delta}F508 CFTR is selected for degradation at different checkpoints than the WT protein.

During recent years, significant progress has been made in identifying the pathways of the mammalian ERQC, ERAD, and UPR. However, it remains unclear how these processes regulate the protein load in different cell types. If recombinant protein overexpression following gene transfer activates the UPR, this could lead to cell damage and apoptosis (37), resulting in inefficient transgene expression levels and tissue damage. Furthermore, because cellular stress responses are often activated under inflammatory conditions, the biogenesis of proteins may be compromised.

In summary, the studies presented show a relationship among ER stress, UPR activation, and CFTR expression regulation. Based on these and previous studies by our group (5) and others (6), we suggest that cellular stress responses may significantly influence CFTR expression both transcriptionally and posttranscriptionally during disease conditions such as chronic infections. Our results support the idea that the CF-like symptoms in chronic lung inflammation without mutations in the CFTR gene may be caused by reduced CFTR expression that are a consequence of cellular stress responses (5, 6, 7, 22). This might be especially true for mild CF caused by CFTR mutations that retain significant ion channel activity but are expressed at a low level. Furthermore, our results indicate that overexpression of recombinant WT CFTR does not result in ER stress. This is very important, considering the significant efforts that are being directed toward gene therapy of CF and other genetic diseases. On the basis of our findings, we suggest that ERAD and subsequent transcriptional downregulation are responsible for the regulation of genomic CFTR levels under ER stress conditions. In contrast, ERAD appears to be the main pathway for limiting recombinant CFTR protein levels. These experiments also illustrate new features concerning the role of ER stress and the UPR in the biogenesis of CFTR and other integral membrane proteins. Further studies, however, are required to reveal the precise mechanism by which the UPR regulates CFTR and other protein expression.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Institutes of Health Grants HL-76587 (to Z. B) and DK-60065 (to J. F. C.). We thank the Gregory Fleming James Cystic Fibrosis Research Center for the support of this research.


    ACKNOWLEDGMENTS
 
We thank Marina Mazur for excellent work in selecting, cloning, and maintaining the cell lines used in these studies. We also thank Drs. Eric Sorscher and Elizabeth Sztul for critical reading of the manuscript and for helpful suggestions.


    FOOTNOTES
 

Address for reprint requests and other correspondence: Z. Bebok, Dept. of Cell Biology, Univ. of Alabama at Birmingham, 1918 Univ. Blvd., MCLM 760, Birmingham, AL 35294-0005 (e-mail: bebok{at}uab.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Back SH, Schroder M, Lee K, Zhang K, Kaufman RJ. ER stress signaling by regulated splicing: IRE1/HAC1/XBP1. Methods 35: 395–416, 2005.[CrossRef][Web of Science][Medline]

2. Baudouin-Legros M, Hinzpeter A, Jaulmes A, Brouillard F, Costes B, Fanen P, Edelman A. Cell-specific posttranscriptional regulation of CFTR gene expression via influence of MAPK cascades on 3'UTR part of transcripts. Am J Physiol Cell Physiol 289: C1240–C1250, 2005.[Abstract/Free Full Text]

3. Bebok Z, Collawn J, Wakefield J, Parker W, Varga K, Li Y, Sorscher EJ, Clancy JP. Failure of cAMP agonists to activate rescued {Delta}F508 CFTR in CFBE41o- airway epithelial monolayers. J Physiol 569: 601–615, 2005.[Abstract/Free Full Text]

4. Bebok Z, Mazzochi C, King AS, Hong SJ, Sorscher EJ. The mechanism underlying CFTR transport from the endoplasmic reticulum to the proteasome includes Sec61beta, and a cytosolic, deglycosylated intermediary. J Biol Chem 273: 29873–29878, 1998.[Abstract/Free Full Text]

5. Bebok Z, Varga K, Hicks JK, Venglarik CJ, Kovacs T, Chen L, Hardiman KM, Collawn JF, Sorscher EJ, Matalon S. Reactive oxygen nitrogen species decrease cystic fibrosis transmembrane conductance regulator expression and cAMP-mediated Cl secretion in airway epithelia. J Biol Chem 277: 43041–43049, 2002.[Abstract/Free Full Text]

6. Cantin AM, Bilodeau G, Ouellet C, Liao J, Hanrahan JW. Oxidant stress suppresses CFTR expression. Am J Physiol Cell Physiol 290: C262–C270, 2006.[Abstract/Free Full Text]

7. Cheng SH, Gregory RJ, Marshall J, Paul S, Souza DW, White GA, O'Riordan CR, Smith AE. Defective intracellular transport and processing of CFTR is the molecular basis of most cystic fibrosis. Cell 63: 827–834, 1990.[CrossRef][Web of Science][Medline]

8. Eisenstein RS. Iron regulatory proteins and the molecular control of mammalian iron metabolism. Annu Rev Nutr 20: 627–662, 2000.[CrossRef][Web of Science][Medline]

9. Erlitzki R, Long JC, Theil EC. Multiple, conserved iron-responsive elements in the 3'-untranslated region of transferrin receptor mRNA enhance binding of iron regulatory protein 2. J Biol Chem 277: 42579–42587, 2002.[Abstract/Free Full Text]

10. Farinha CM, Amaral MD. Most F508del-CFTR is targeted to degradation at an early folding checkpoint and independently of calnexin. Mol Cell Biol 25: 5242–5252, 2005.[Abstract/Free Full Text]

11. Friedlander R, Jarosch E, Urban J, Volkwein C, Sommer T. A regulatory link between ER-associated protein degradation and the unfolded-protein response. Nat Cell Biol 2: 379–384, 2000.[CrossRef][Web of Science][Medline]

12. Hampton RY. ER-associated degradation in protein quality control and cellular regulation. Curr Opin Cell Biol 14: 476–482, 2002.[CrossRef][Web of Science][Medline]

13. Harding HP, Zhang Y, Ron D. Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 397: 271–274, 1999.[CrossRef][Medline]

14. Haze K, Yoshida H, Yanagi H, Yura T, Mori K. Mammalian transcription factor ATF6 is synthesized as a transmembrane protein and activated by proteolysis in response to endoplasmic reticulum stress. Mol Biol Cell 10: 3787–3799, 1999.[Abstract/Free Full Text]

15. Hong M, Li M, Mao C, Lee AS. Endoplasmic reticulum stress triggers an acute proteasome-dependent degradation of ATF6. J Cell Biochem 92: 723–732, 2004.[CrossRef][Web of Science][Medline]

16. Hung JH, Su IJ, Lei HY, Wang HC, Lin WC, Chang WT, Huang W, Chang WC, Chang YS, Chen CC, Lai MD. Endoplasmic reticulum stress stimulates the expression of cyclooxygenase-2 through activation of NF-{kappa}B and pp38 mitogen-activated protein kinase. J Biol Chem 279: 46384–46392, 2004.[Abstract/Free Full Text]

17. Iwawaki T, Hosoda A, Okuda T, Kamigori Y, Nomura-Furuwatari C, Kimata Y, Tsuru A, Kohno K. Translational control by the ER transmembrane kinase/ribonuclease IRE1 under ER stress. Nat Cell Biol 3: 158–164, 2001.[CrossRef][Web of Science][Medline]

18. Kimata Y, Ishiwata-Kimata Y, Yamada S, Kohno K. Yeast unfolded protein response pathway regulates expression of genes for anti-oxidative stress and for cell surface proteins. Genes Cells 11: 59–69, 2006.[Abstract/Free Full Text]

19. Kitiphongspattana K, Mathews CE, Leiter EH, Gaskins HR. Proteasome inhibition alters glucose-stimulated (pro)insulin secretion and turnover in pancreatic beta-cells. J Biol Chem 280: 15727–15734, 2005.[Abstract/Free Full Text]

20. Kopito RR. Biosynthesis and degradation of CFTR. Physiol Rev 79: S167–S173, 1999.

21. Kreindler JL, Jackson AD, Kemp PA, Bridges RJ, Danahay H. Inhibition of chloride secretion in human bronchial epithelial cells by cigarette smoke extract. Am J Physiol Lung Cell Mol Physiol 288: L894–L902, 2005.[Abstract/Free Full Text]

22. Lee AS. The ER chaperone and signaling regulator GRP78/BiP as a monitor of endoplasmic reticulum stress. Methods 35: 373–381, 2005.[CrossRef][Web of Science][Medline]

23. Liu CY, Wong HN, Schauerte JA, Kaufman RJ. The protein kinase/endoribonuclease IRE1{alpha} that signals the unfolded protein response has a luminal N-terminal ligand-independent dimerization domain. J Biol Chem 277: 18346–18356, 2002.[Abstract/Free Full Text]

24. Liu XM, Peyton KJ, Ensenat D, Wang H, Schafer AI, Alam J, Durante W. Endoplasmic reticulum stress stimulates heme oxygenase-1 gene expression in vascular smooth muscle. Role in cell survival. J Biol Chem 280: 872–877, 2005.[Abstract/Free Full Text]

25. Lukacs GL, Mohamed A, Kartner N, Chang XB, Riordan JR, Grinstein S. Conformational maturation of CFTR but not its mutant counterpart ({Delta}F508) occurs in the endoplasmic reticulum and requires ATP. EMBO J 13: 6076–6086, 1994.[Web of Science][Medline]

26. Manfredi G, Yang L, Gajewski CD, Mattiazzi M. Measurements of ATP in mammalian cells. Methods 26: 317–326, 2002.[CrossRef][Web of Science][Medline]

27. McCarthy VA, Harris A. The CFTR gene and regulation of its expression. Pediatr Pulmonol 40: 1–8, 2005.[Web of Science][Medline]

28. Mehta A. CFTR: more than just a chloride channel. Pediatr Pulmonol 39: 292–298, 2005.[CrossRef][Web of Science][Medline]

29. Mengesdorf T, Althausen S, Paschen W. Genes associated with pro-apoptotic and protective mechanisms are affected differently on exposure of neuronal cell cultures to arsenite. No indication for endoplasmic reticulum stress despite activation of grp78 and gadd153 expression. Brain Res Mol Brain Res 104: 227–239, 2002.[Medline]

30. Meunier L, Usherwood YK, Chung KT, Hendershot LM. A subset of chaperones and folding enzymes form multiprotein complexes in endoplasmic reticulum to bind nascent proteins. Mol Biol Cell 13: 4456–4469, 2002.[Abstract/Free Full Text]

31. Meusser B, Hirsch C, Jarosch E, Sommer T. ERAD: the long road to destruction. Nat Cell Biol 7: 766–772, 2005.[CrossRef][Web of Science][Medline]

32. Nadanaka S, Yoshida H, Kano F, Murata M, Mori K. Activation of mammalian unfolded protein response is compatible with the quality control system operating in the endoplasmic reticulum. Mol Biol Cell 15: 2537–2548, 2004.[Abstract/Free Full Text]

33. Riordan JR. Assembly of functional CFTR chloride channels. Annu Rev Physiol 67: 701–718, 2005.[CrossRef][Web of Science][Medline]

34. Riordan JR. Cystic fibrosis as a disease of misprocessing of the cystic fibrosis transmembrane conductance regulator glycoprotein. Am J Hum Genet 64: 1499–1504, 1999.[CrossRef][Web of Science][Medline]

35. Riordan JR. Etiology of CF: knowns and unknowns. Pediatr Pulmonol Suppl 18: 96–98, 1999.[Medline]

36. Riordan JR, Chang XB. CFTR, a channel with the structure of a transporter. Biochim Biophys Acta 1101: 221–222, 1992.[Medline]

37. Rutkowski DT, Kaufman RJ. A trip to the ER: coping with stress. Trends Cell Biol 14: 20–28, 2004.[CrossRef][Web of Science][Medline]

38. Schroder M, Kaufman RJ. ER stress and the unfolded protein response. Mutat Res 569: 29–63, 2005.[Web of Science][Medline]

39. Schroder M, Kaufman RJ. The mammalian unfolded protein response. Annu Rev Biochem 74: 739–789, 2005.[CrossRef][Web of Science][Medline]

40. Shen X, Ellis RE, Sakaki K, Kaufman RJ. Genetic interactions due to constitutive and inducible gene regulation mediated by the unfolded protein response in C. elegans. PLoS Genet 1: e37, 2005.[CrossRef][Medline]

41. Sorensen S, Ranheim T, Bakken KS, Leren TP, Kulseth MA. Retention of mutant low density lipoprotein receptor in endoplasmic reticulum (ER) leads to ER stress. J Biol Chem 281: 468–476, 2006.[Abstract/Free Full Text]

42. Tector M, Hartl FU. An unstable transmembrane segment in the cystic fibrosis transmembrane conductance regulator. EMBO J 18: 6290–6298, 1999.[CrossRef][Web of Science][Medline]

43. Theil EC. The IRE (iron regulatory element) family: structures which regulate mRNA translation or stability. Biofactors 4: 87–93, 1993.[Web of Science][Medline]

44. Travers KJ, Patil CK, Wodicka L, Lockhart DJ, Weissman JS, Walter P. Functional and genomic analyses reveal an essential coordination between the unfolded protein response and ER-associated degradation. Cell 101: 249–258, 2000.[CrossRef][Web of Science][Medline]

45. Varga K, Jurkuvenaite A, Wakefield J, Hong JS, Guimbellot JS, Venglarik CJ, Niraj A, Mazur M, Sorscher EJ, Collawn JF, Bebok Z. Efficient intracellular processing of the endogenous cystic fibrosis transmembrane conductance regulator in epithelial cell lines. J Biol Chem 279: 22578–22584, 2004.[Abstract/Free Full Text]

46. Ward CL, Kopito RR. Intracellular turnover of cystic fibrosis transmembrane conductance regulator. J Biol Chem 269: 25710–25718, 1994.[Abstract/Free Full Text]

47. Xue X, Piao JH, Nakajima A, Sakon-Komazawa S, Kojima Y, Mori K, Yagita H, Okumura K, Harding H, Nakano H. Tumor necrosis factor {alpha} (TNF{alpha}) induces the unfolded protein response (UPR) in a reactive oxygen species (ROS)-dependent fashion, and the UPR counteracts ROS accumulation by TNF{alpha}. J Biol Chem 280: 33917–33925, 2005.[Abstract/Free Full Text]

48. Ye Y, Shibata Y, Kikkert M, van Voorden S, Wiertz E, Rapoport TA. Inaugural Article: Recruitment of the p97 ATPase and ubiquitin ligases to the site of retrotranslocation at the endoplasmic reticulum membrane. Proc Natl Acad Sci USA 102: 14132–14138, 2005.[Abstract/Free Full Text]

49. Zhang F, Kartner N, Lukacs GL. Limited proteolysis as a probe for arrested conformational maturation of {Delta}F508 CFTR. Nat Struct Biol 5: 180–183, 1998.[CrossRef][Web of Science][Medline]

50. Zhang K, Kaufman RJ. The unfolded protein response: a stress signaling pathway critical for health and disease. Neurology 66: S102–S109, 2005.


Related articles in Am J Physiol Cell Physiol:

Freedom of expression. Focus on "Endoplasmic reticulum stress and the unfolded protein response regulate cystic fibrosis transmembrane conductance regulator expression"
Neil A. Bradbury
Am J Physiol Cell Physiol 2007 292: C687-C688. [Full Text]  



This article has been cited by other articles:


Home page
Am. J. Respir. Cell Mol. Bio.Home page
R. Bartoszewski, A. Rab, A. Jurkuvenaite, M. Mazur, J. Wakefield, J. F. Collawn, and Z. Bebok
Activation of the Unfolded Protein Response by {Delta}F508 CFTR
Am. J. Respir. Cell Mol. Biol., October 1, 2008; 39(4): 448 - 457.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
K. Hybiske, Z. Fu, C. Schwarzer, J. Tseng, J. Do, N. Huang, and T. E. Machen
Effects of cystic fibrosis transmembrane conductance regulator and {Delta}F508CFTR on inflammatory response, ER stress, and Ca2+ of airway epithelia
Am J Physiol Lung Cell Mol Physiol, November 1, 2007; 293(5): L1250 - L1260.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. L. Davenport, H. E. Moore, A. S. Dunlop, S. Y. Sharp, P. Workman, G. J. Morgan, and F. E. Davies
Heat shock protein inhibition is associated with activation of the unfolded protein response pathway in myeloma plasma cells
Blood, October 1, 2007; 110(7): 2641 - 2649.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
R. F. Goldstein, A. Niraj, T. P. Sanderson, L. S. Wilson, A. Rab, H. Kim, Z. Bebok, and J. F. Collawn
VCP/p97 AAA-ATPase Does Not Interact with the Endogenous Wild-Type Cystic Fibrosis Transmembrane Conductance Regulator
Am. J. Respir. Cell Mol. Biol., June 1, 2007; 36(6): 706 - 714.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
N. A. Bradbury
Freedom of expression. Focus on "Endoplasmic reticulum stress and the unfolded protein response regulate cystic fibrosis transmembrane conductance regulator expression"
Am J Physiol Cell Physiol, February 1, 2007; 292(2): C687 - C688.
[Full Text] [PDF]


This Article
Free upon publication Free Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/2/C756    most recent
00391.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Related articles in Am J Physiol Cell Physiol
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rab, A.
Right arrow Articles by Bebok, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rab, A.
Right arrow Articles by Bebok, Z.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.