Am J Physiol Cell Physiol AJP: Lung Cellular and Molecular Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Cell Physiol 292: C209-C215, 2007. First published August 16, 2006; doi:10.1152/ajpcell.00157.2006
0363-6143/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/1/C209    most recent
00157.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dong, J.
Right arrow Articles by Sobel, B. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dong, J.
Right arrow Articles by Sobel, B. E.

RECEPTORS AND SIGNAL TRANSDUCTION

IL-1 and IL-6 induce hepatocyte plasminogen activator inhibitor-1 expression through independent signaling pathways converging on C/EBP{delta}

Jie Dong,1 Satoshi Fujii,1 Shogo Imagawa,1 Shuichiro Matsumoto,2 Michiaki Matsushita,2 Satoru Todo,2 Hiroyuki Tsutsui,1 and Burton E. Sobel3

Department of 1Cardiovascular Medicine and 2Surgery, Hokkaido University Graduate School of Medicine, Sapporo, Japan; and 3Cardiovascular Research Institute of the University of Vermont, Colchester, Vermont

Submitted 5 April 2006 ; accepted in final form 5 August 2006


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
To elucidate signaling pathways activated by IL-1 and IL-6 that contribute to increased expression of plasminogen activator inhibitor-1 (PAI-1), we studied human hepatoma (HepG2) cells and primary mouse hepatocytes. HepG2 cell PAI-1 mRNA increased in response to IL-1beta, IL-6, and IL-1beta plus IL-6 as shown by real-time PCR. Activity of the transiently transfected PAI-1 promoter (–829 to +36 bp) increased as well. Systematic promoter deletion assays showed that the region from –239 to –210 bp containing a putative CCAAT-enhancer binding protein (C/EBP) binding site was critical. Point mutations in this region abolished the IL-1beta and IL-6 responses. Antibody interference electrophoretic mobility shift assays showed that C/EBP{delta} (but not C/EBP{alpha} or C/EBPbeta) binding and protein were increased by IL-1beta, IL-6, and IL-1beta plus IL-6 in HepG2 cells. IL-1beta and IL-6 increased expression of both PAI-1 mRNA and C/EBP{delta} mRNA in mouse primary hepatocytes as well. Downregulation of C/EBP{delta} induced with small interfering RNA (siRNA) decreased secretion of PAI-1. As judged from results obtained with inhibitors, signal transduction in all three of the mitogen-activated protein kinase pathways was involved in IL-1-inducible PAI-1 expression. By contrast, JAK signaling was responsible for the IL-6-induced inducible expression. Thus IL-1 and IL-6 exert directionally similar effects on PAI-1 expression, but the induction involves distinct signaling pathways with a final common mediator, C/EBP{delta}.

CCAAT-enhancer binding protein; interleukin-1beta; interleukin-6; statins; thrombosis

BECAUSE PLASMINOGEN ACTIVATOR inhibitor (PAI)-1 is the major physiological inhibitor of fibrinolysis and influences thrombosis and atherosclerosis (3, 13, 23, 28), elucidation of signal transduction modifying its expression in response to cytokines (4, 5, 14, 26) has been of interest (4–6, 9, 10, 12, 21, 22). The present study was designed to determine whether transcriptional regulation and signal transduction mechanisms accounting for increased expression of PAI-1 induced by IL-1beta differ from those accounting for induction by IL-6, whether the pathways, if divergent, use a final common mediator, CCAAT-enhancer binding protein (C/EBP) {delta}, implicated in our previous work (6), and whether the two cytokines evoke combined effects on induction of PAI-1 expression.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell culture. HepG2 cells (ATCC, Rockville, MD) were grown to 80% confluence, washed with PBS, and incubated in serum-free medium for 24 h. The medium was replaced subsequently with fresh serum-free medium containing 1 ng/ml IL-1beta, 1 ng/ml IL-6, and inhibitors of induction identified previously, including (in µmol/l) 10 mevastatin (Sigma, St. Louis, MO), 20 LY-294002, 5 SB-203580, 10 SP-600125, 10 U-0126, 10 JAK inhibitor 1, 18 SN-50, and 20 API-2 (Calbiochem, La Jolla, CA). The inhibitors were used at concentrations that are not cytotoxic (9, 16, 21, 22, 27). Mouse primary hepatocytes were isolated with a two-step collagenase perfusion method (6) from male ICR mice (Hokkaido University Laboratory Animal Center) with procedures conforming to institutional animal study guidelines. Primary hepatocytes were cultured for 48 h in Williams' medium E containing 10% FBS, 0.1 µmol/l insulin, 1.0 µmol/l dexamethasone, and 20 ng/ml epidermal growth factor. HepG2 cells and mouse hepatocytes were subsequently incubated in serum-free medium for 24 h and stimulated with IL-1beta and/or IL-6 for 4 h.

Plasmid constructs. The human PAI-1 promoter region from –829 to +36 bp was amplified with the use of human genomic DNA as template, with upstream (GGGGTACCCGTTGGTCTCCTGTTTCCTTACCAAGC) and downstream (CCGGCTCGAGGACAGCGCTCTTGGCCCTGCAGCCA) primers incorporating the restriction sites for Kpn1 and Xho1. After digestion by Kpn1 and Xho1, PCR product was ligated into luciferase reporter plasmid (pGL3-basic; Promega, Madison, WI). The produced plasmid was designated as PAI (–829). Sequence analysis indicated that PAI-1 (–829) contains a 4G/4G polymorphism at –675 bp of the PAI-1 promoter. The same method was used to construct deletion mutant plasmids with the same downstream primer. The upstream primers were as follows: PAI-1 (–663) GGGGTACCTGTATCATCGGAGGCGGCCGGGCACA, PAI-1 (–539) GGGGTACCCTGTTGGGCTGGGCCAGGAGGAGG, PAI-1 (–366) GG- GGTACCTCCAAGCTGAACACTAGGGGTCCT, PAI-1 (–308) GGGGTACCAACCTGGCAGGACATCCGGGAGAGAC, PAI-1 (–239) GGGGTACCAAGGCTATTGGGGTTTGCTCAATTG, PAI-1 (–210) GCGGTACCCCTGAATGCTCTTACACACGTACA, and PAI-1 (–121) GGGGTACCGGGGACCCGCTGGCTGTTCAGA- CGGA.

Mutated plasmids were constructed with the use of an overlap-extension PCR strategy. The mutated primers used were as follows (the mutated site is underlined): C/EBP mutant GGCTATTGGGGTGCTTTCGCTTGTTCCTGAATGCTC and 5G mutant CTGGACACGTGGGGGAGTCAGCCGTGTA.

Correct assembly was verified with the use of restriction analysis. Mutated regions generated by PCR were sequenced to identify clones without polymerase reaction errors.

Transient transfection and luciferase assay. HepG2 cells were seeded at 8 x 105/well on six-well plates. After 24 h, 1.5 µg of Firefly luciferase pGL3-basic construct with different length of PAI-1 promoter was cotransfected with 1 µg of Renilla luciferase pRL-TK vector (for transfection efficiency control; Promega) with the use of the DNA-calcium phosphate coprecipitation method. Medium was replaced by serum-free medium 6 h after transfection. The cells were exposed to IL-1beta, IL-6, and mevastatin 24 h after transfection and harvested 48 h after transfection. Cell lysate luciferase activity was determined with the use of a Dual-Luciferase Reporter Assay System (Promega).

Preparation of nuclear extract and performance of electrophoretic mobility shift assays. The probe encompassing the C/EBP motif from the PAI-1 promoter was prepared with the use of the following paired complementary oligonucleotides: PAI-1 C/EBP (AGCTTATTGGGGTTTGCTCAATTGTTCCT) and PAI-1 C/EBP (AGCTAGGAACAATTGAGCAAACCCCAATA).

Probes were end-labeled with [{alpha}-32P]dCTP and purified. DNA binding reactions were performed, and the reactants were incubated for 15 min at room temperature. For electrophoretic mobility shift assays (EMSA), supershift analysis antibodies (Santa Cruz Biotechnology) against C/EBP{alpha} (sc-61X), C/EBPbeta (sc-150X), and C/EBP{delta} (sc-636X) were incubated with nuclear extracts for 10 min before addition of the probe. DNA-protein complexes were resolved on 6% polyacrylamide gels, and autoradiography was performed. Images were analyzed by densitometry (ImageJ software; National Institutes of Health, Bethesda, MD).

Western blot analysis of C/EBP{delta}. Immunological detection of C/EBP{delta} and PAI-1 was performed with rabbit polyclonal anti-C/EBP{delta} antibody (sc-636, 1:500 dilutions; Santa Cruz) and anti-PAI-1 antibody (no. 528216, 5,000-fold dilutions; Calbiochem). Images were analyzed with a densitometer. Anti-histone H1 antibody (Santa Cruz) was used to confirm equal loading of sample.

Isolation of RNA and quantitative reverse transcription PCR. Total RNA was extracted and reverse transcribed. PAI-1 and C/EBP{delta} mRNA were quantified with the use of real-time PCR as described previously (6). The following PCR primers were used: for human PAI-1, upstream (CCACTTCTTCAGGCTGTTCC) and downstream (AGTGCTGCCGTCTGATTTGT) primers; for human C/EBP{delta}, upstream (GACTCAGCAACGACCCATACC) and downstream (TGCTCAGTCTTTTCCTCTTAT) primers; for human 18S rRNA (an internal control), upstream (AGTCGGAGTTTCGAAGACGA) and downstream (CGGGTGAGGTTTCCCATATT) primers; for mouse PAI-1, upstream (GACACCCTCAGCATGTTCATC) and downstream (AGGGTTGCACTAAACATGTCAG) primers; and for mouse C/EBP{delta}, upstream (CTCCCGCACACAACATACTG) and downstream (CTTCGGCAACCACCTAAAAG) primers; and for mouse beta-actin (an internal control), upstream (TGCGTGACATCAAAGAGAAG) and downstream (GATGCCACAGGATTCCATA) primers. After a PCR melting curve had been constructed to ensure that nonspecific products had been eliminated, the amount of mRNA was determined by comparison with the standard curve generated from serial dilutions of a T-vector containing cDNA of the gene.

Gene silencing with small interfering RNA. C/EBP{delta} mRNA silencing was performed with the use of two sequence-specific double-stranded small interfering RNA (siRNAs), C/EBP{delta} siRNA-a (GAUGCAGCAGAAGUUGGUGTT) and C/EBP{delta} siRNA-b (GACUCAGCAACGACCCAUATT) (Ambion, Austin, TX). Double-stranded negative control siRNA and beta-actin siRNA (Ambion) were used as negative and positive controls. Transfection of siRNA duplex was performed with TransIT-siQUEST transfection reagent according to the manufacturer's instructions (Mirus, Madison, WI). In brief, HepG2 cells were transfected with 30 nM siRNA in complete growth medium. Medium was replaced by serum-free medium 24 h after transfection. After serum starvation for 16 h, the cells were stimulated by IL-1beta for 4 h for C/EBP{delta} and 24 h for PAI-1.

Statistical analysis. All experiments were conducted in duplicate with independent separate cultures (n = no. of independent experiments). Data are expressed as means ± SD. Statistical comparison of control and treated groups was performed with Student's t-tests. The accepted level of significance was P < 0.05.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Effects of IL-1beta and IL-6 on PAI-1 promoter activity. To define the effect of IL-1beta on PAI-1 promoter activity and determine whether it exhibited overlapping or nonoverlapping effects with respect to IL-6, the PAI-1 (–829) promoter construct was transfected into HepG2 cells, and luciferase activity was measured. IL-1beta increased PAI-1 promoter activity by 3.8 ± 0.2-fold, and IL-6 increased PAI-1 promoter activity by 2.4 ± 0.2-fold. IL-1beta plus IL-6 increased PAI-1 promoter activity by 7.1 ± 0.5-fold (Fig. 1A).


Figure 1
View larger version (34K):
[in this window]
[in a new window]

  		Fig. 1. A: identification of responsive elements for IL-1beta and/or IL-6 on the plasminogen activator inhibitor-1 (PAI-1) promoter. HepG2 cells were cotransfected with PAI-1 (–829) or a series of deletion mutant or pGL3- basic plasmid. pRL-TK plasmid was used as an internal control. The absolute luciferase activity was measured by dividing the firefly luciferase activity with the internal control Renilla luciferase activity. The relative luciferase activity was then measured by normalizing absolute luciferase activity with respect to control activity in each plasmid group. Values are means ± SD (n = 6). P < 0.05 vs. PAI-1 (–829) without agent (*) and vs. PAI-1 (–829) luciferase activity induced by IL-1beta and IL-1beta + IL-6 (#). B: effects of mutations in the 5G and C/EBP motif on the PAI-1 promoter activity induced by IL-1beta and/or IL-6. Wild type indicates the PAI-1 (–829) construct. 5G mutant indicates a PAI-1 (–829) with a mutation at –675 bp. C/EBP mutant indicates a PAI-1 (–829) with the C/EBP motif (–226 to –213 bp) mutated. The relative luciferase activity was measured by normalizing absolute luciferase activity with respect to control activity in each plasmid group. Values are means ± SD (n = 6). *P < 0.05 vs. PAI-1 (–829) luciferase activity induced by IL-1beta and IL-1beta + IL-6. C: effects of mevastatin (Mev) on the PAI-1 promoter activity induced by IL-1beta and/or IL-6. HepG2 cells were incubated with IL-1beta, IL-6, and/or mevastatin. Values are means ± SD of the degree of increase compared with controls without agents (n = 4). P < 0.05 vs. PAI-1 (–829) without agent (*) and vs. PAI-1 (–829) luciferase activity induced by IL-1beta and/or IL-6 (#).

 
Mapping of IL-1beta- and IL-6-responsive elements in the PAI-1 promoter. To localize the elements mediating the effects of IL-1beta and IL-1beta plus IL-6, cells were transfected with eight luciferase reporter vectors containing different deletion length of the PAI-1 promoter regions. PAI-1 promoter activity induced by IL-1beta and IL-1beta plus IL-6 was not effectively decreased with deletions preceding –239 bp. Deletion of the region from –239 to –210 bp decreased IL-1beta-inducible relative luciferase activity by 72 ± 6% and abolished the combined effects of IL-1beta and IL-6 (Fig. 1A). Thus the region from –239 to –210 bp was critical in mediating the IL-1beta and IL-6 effects.

Identification of IL-1beta- and IL-6-responsive elements in the PAI-1 promoter. To determine whether the C/EBP motif (–226 to –213 bp) that we have shown mediates the IL-6 effect (6) is responsible also for the stimulation exhibited by IL-1beta and combined effects elicited by IL-1beta plus IL-6, the PAI-1 (–829) plasmid with the C/EBP motif mutated was constructed and transfected into HepG2 cells. IL-1beta-inducible PAI-1 promoter activity was decreased by 69%. Furthermore, no effect of IL-1beta in combination with IL-6 on PAI-1 promoter activity was evident (Fig. 1B).

With the use of a PAI-1 (–829) plasmid with a mutation in 5G (–675 bp) we constructed, the IL-1beta- and IL-6-inducible activity persisted. Although mevastatin did not alter basal PAI-1 promoter activity, it significantly decreased PAI-1 promoter activity induced by IL-1beta (43 ± 4%) alone or in combination with IL-6 (48 ± 8%; Fig. 1C).

Effects of IL-1beta and IL-6 on C/EBP{delta} binding activity. To determine whether the response of the PAI-1 promoter to IL-1beta is mediated by C/EBP and, if so, to determine which member of C/EBP family is involved, IL-1beta-induced C/EBP binding activity was assessed with EMSAs with antibodies against C/EBP{alpha}, C/EBPbeta, and C/EBP{delta}. When antibody against C/EBP{alpha} was used, supershift bands were slightly decreased by exposure of the cells for 4 h to IL-1beta (Fig. 2A). When antibody against C/EBPbeta was used, supershift bands were unchanged (Fig. 2B). In contrast to binding of C/EBP{alpha} or C/EBPbeta, C/EBP{delta} binding activity was increased by exposure of the cells for 4 h to IL-1beta (n = 4, P < 0.05; Fig. 2, C and D) and to IL-1beta plus IL-6. IL-1beta-inducible C/EBP{delta} binding activity started to increase within 1 h of exposure and peaked with exposure of 4 h (6.7 ± 0.4-fold). Positive interaction between IL-1beta and IL-6 was evident at every time point and was maximal with exposure of 4 h (10.5 ± 0.6-fold; Fig. 3, A and B).


Figure 2
View larger version (73K):
[in this window]
[in a new window]

  		Fig. 2. Effects of IL-1beta, IL-6, and mevastatin on C/EBP binding to the PAI-1 promoter. HepG2 cells were exposed to mevastatin for 1 h and then to IL-1beta and/or IL-6 for 4 h. The nuclear extracts were collected, and electrophoretic mobility shift assays (EMSAs) were performed. Complex 1 (C1) consisted of CCAAT-enhancer binding protein (C/EBP) {alpha} and C/EBPbeta, complex 2 (C2) of C/EBPbeta and C/EBP{delta}, and complex 3 (C3) of C/EBPbeta (6). A: supershift experiment with antibody against C/EBP{alpha}. B: supershift experiment with antibody against C/EBPbeta. C: supershift experiment with antibody against C/EBP{delta}. D: C/EBP{delta} supershift bands shown in C were analyzed by densitometry. Values are means ± SD of the degree of increase compared with controls without agents. The upper halves of the whole images are shown. P < 0.05 vs. control (§) and vs. C/EBP{delta} binding activity induced by IL-1beta and/or IL-6 (#).

 

Figure 3
View larger version (67K):
[in this window]
[in a new window]

  		Fig. 3. Time course of exposure of the cells to IL-1beta and/or IL-6 on C/EBP{delta} binding to the PAI-1 promoter. A C/EBP{delta} antibody supershift experiment was performed with the use of 10 µg nuclear extracts of HepG2 cells exposed to IL-1beta and/or IL-6 for the indicated time periods and to a 6-fmol PAI-1 promoter probe (–233 to –207 bp) containing a C/EBP motif. A: complexes C1, C2, and C3 indicate the band of DNA-protein complex formation. "C/EBP{delta}" indicates the C/EBP{delta} supershift band. B: C/EBP{delta} supershift bands shown in A were analyzed by densitometry. Values are means ± SD of the degree of increase compared with controls without agents at time 0 (n = 3).

 
Mevastatin exerted no effects on binding activities of C/EBP{alpha} (Fig. 2A) or C/EBPbeta (Fig. 2B) induced by IL-1beta and/or IL-6. However, it significantly decreased C/EBP{delta} binding activity induced by IL-1beta and IL-1beta plus IL-6 (n = 4, P < 0.05; Fig. 2, C and D). These observations suggest that IL-1beta- and IL-1beta- plus IL-6-inducible transcription was initiated by increased binding of C/EBP{delta} protein to the PAI-1 promoter.

Effects of IL-1beta and IL-6 on C/EBP{delta} protein in nuclear extracts. To determine whether mevastatin altered the concentrations of C/EBP{delta} protein induced by IL-1beta and IL-1beta plus IL-6, Western blot analysis was performed on nuclear extracts. IL-1beta increased the concentration of C/EBP{delta} protein by 6.7 ± 0.7-fold, and IL-1beta plus IL-6 increased the concentration of C/EBP{delta} protein by 8.9 ± 1.6-fold (Fig. 4, A and B). Mevastatin decreased IL-1beta-inducible C/EBP{delta} by 37 ± 6% and IL-1beta plus IL-6-inducible C/EBP{delta} by 39 ± 5% (n = 3, P < 0.05) although it did not affect accumulation of C/EBP{delta} protein in the absence of the cytokines.


Figure 4
View larger version (28K):
[in this window]
[in a new window]

  		Fig. 4. Effects of IL-1beta, IL-6, and mevastatin on concentrations of C/EBP{delta} protein and PAI-1 mRNA in HepG2 cells and mouse primary hepatocytes. A: HepG2 cells were exposed to mevastatin for 1 h and then to IL-1beta and/or IL-6 for 4 h. The nuclear extracts were collected, and Western blots were performed. Histone H1 was used as a loading control. B: C/EBP{delta} bands shown in A were analyzed by densitometry. C: HepG2 cells were exposed to mevastatin for 1 h and then treated with IL-1beta and/or IL-6 for 4 h. Total RNA was isolated, and real-time PCR was performed. D: after being transplanted for 72 h, mouse primary hepatocytes were exposed to IL-1beta and/or IL-6 for 4 h. Values are means ± SD of the degree of increase compared with controls without agents. P < 0.05 vs. PAI-1 mRNA control (*) and vs. PAI-1 mRNA induced by IL-1beta and/or IL-6 (#), vs. C/EBP{delta} protein or C/EBP{delta} mRNA in control (§), and vs. C/EBP{delta} protein or C/EBP{delta} mRNA induced by IL-1beta and/or IL-6 ({dagger}).

 
Effects of IL-1beta and IL-6 on expression of PAI-1 mRNA and C/EBP{delta} mRNA in HepG2 cells and mouse primary hepatocytes. Results obtained with quantitative real-time reverse transcription PCR showed that IL-1beta and IL-6 increased expressions of both PAI-1 mRNA and C/EBP{delta} mRNA (n = 3, P < 0.05) in HepG2 cells (Fig. 4C) and in mouse primary hepatocytes (Fig. 4D). PAI-1 mRNA peaked with 4 h of exposure, and C/EBP{delta} mRNA peaked with 2 h of exposure (data not shown). Mevastatin significantly decreased PAI-1 mRNA and C/EBP{delta} mRNA induction by IL-1beta and/or IL-6 in HepG2 cells (n = 3, P < 0.05) consistent with C/EBP{delta} being an essential mediator of induction by both cytokines.

Effects of siRNA-mediated downregulation of C/EBP{delta} on IL-1beta-inducible PAI-1 expression. To further determine whether C/EBP{delta} is responsible for upregulation of PAI-1 induced by IL-1beta, C/EBP{delta} siRNA transfection experiments were performed. C/EBP{delta} and PAI-1 protein were analyzed with Western blots. C/EBP{delta} expression was decreased by exposure of HepG2 cells to C/EBP{delta} siRNA. PAI-1 protein secretion induced by IL-1beta was significantly decreased as well (n = 3, P < 0.05; Fig. 5, A and B). beta-Actin expression was decreased by 72.4% with exposure of HepG2 cells to beta-actin siRNA (n = 3, P < 0.05; Fig. 5C). beta-Actin siRNA or negative control siRNA exerted no effects on PAI-1 and C/EBP{delta} expression.


Figure 5
View larger version (34K):
[in this window]
[in a new window]

  		Fig. 5. Effects of downregulation of C/EBP{delta} using small interfering RNA (siRNA) on the secretion of PAI-1. A: HepG2 cells were transfected with 30 nM siRNA in complete growth medium. After transfection (24 h), medium was replaced by serum-free medium. After serum starvation for 16 h, the cells were stimulated by IL-1beta for 4 h, and nuclear extracts were collected for analysis of C/EBP{delta}. For analysis of PAI-1, the cells were stimulated for 24 h, and media were collected. Double-stranded negative control siRNA was transfected as an internal control. Western blot was performed as described in MATERIALS AND METHODS. A representative blot is shown. B: PAI-1 and C/EBP{delta} bands shown in A were analyzed by densitometry. Values are means ± SD of the degree of increase compared with negative controls without agents. P < 0.05 vs. C/EBP{delta} control (*), vs. PAI-1 control (#), vs. IL-1beta inducible C/EBP{delta} in negative control group ({ddagger}), and vs. IL-1beta-inducible PAI-1 in negative control ({dagger}). C: HepG2 cells were transfected with negative control siRNA and beta-actin siRNA. After 4 h, total mRNA was extracted. beta-Actin, PAI-1, and C/EBP{delta} mRNA were measured with the use of real-time PCR. *P < 0.05 vs. beta-actin transfected by negative control siRNA.

 
Effects of inhibitors of signal transduction on IL-1beta and IL-6 induction of C/EBP{delta} and PAI-1. To delineate the specific signal transduction pathways leading to increased C/EBP{delta} and PAI-1 production induced by IL-beta and IL-6, selective inhibitors were used, including: an inhibitor of phosphoinositide (PI) 3-kinase, LY-294002, an inhibitor of p38/mitogen-activated protein kinase (MAPK), SB-203580, an inhibitor of c-Jun N-terminal kinase (JNK)/MAPK, SP-600125, an inhibitor of extracellular signal-regulated kinase (ERK)/MAPK, U-0126, a potent inhibitor of JAKs, JAK inhibitor 1, an inhibitor of nuclear factor-{kappa}B (NF-{kappa}B), SN-50, and an Akt/protein kinase B (PKB) signaling inhibitor, API-2. Under basal (unstimulated) conditions, LY-294002 decreased baseline C/EBP{delta} mRNA expression, and protein and API-2 increased PAI-1 mRNA expression and PAI-1 protein (Figs. 6A and 7A). The changes in absolute amounts of C/EBP{delta} mRNA and PAI-1 mRNA induced by IL-1beta or IL-6 (Fig. 6, B and D) were accompanied by directionally similar changes in C/EBP{delta} protein and PAI-1 protein (Fig. 7, B and C). As was evident after normalization for basal mRNA levels (Fig. 6A), induction of relative increases in C/EBP{delta} mRNA and PAI-1 mRNA by IL-1beta was significantly increased by LY-294002 and decreased by SB-203580, SP-600125, and U-0126 (Fig. 6C). Induction of relative increases in C/EBP{delta} mRNA and PAI-1 mRNA by IL-6 was significantly decreased by JAK inhibitor 1 (Fig. 6E). SN-50 and API-2 exerted no effects on PAI-1 and C/EBP{delta} expression induced by IL-1 or IL-6. These results suggest that the PI 3-kinase signaling pathway exerted negative effects on PAI-1 expression upon stimulation with IL-1beta and that three MAPK signaling pathways were involved in IL-1beta induction of C/EBP{delta} and PAI-1. The JAK signaling pathway is known to be critical for IL-6-induced effects.


Figure 6
View larger version (16K):
[in this window]
[in a new window]

  		Fig. 6. Effects of the inhibitors of signaling pathways on PAI-1 and C/EBP{delta} mRNA induced by IL-1beta or IL-6. HepG2 cells were treated with LY-294002 (LY, 20 µmol/l), SB-203580 (SB, 5 µmol/l), SP-600125 (SP, 10 µmol/l), U-0126 (U, 10 µmol/l), JAK inhibitor 1 (JAK1, 10 µmol/l), SN-50 (SN, 18 µmol/l), or API-2 (20 µmol/l) for 1 h. They were then exposed to IL-1beta or IL-6 for 4 h. Total RNA was isolated, and real-time PCR was performed. 18S rRNA was used as an internal control. A, B, and D: absolute amounts of mRNA. Values are means ± SD of the degree of increase over controls (without stimulating agents). C and E: relative mRNA levels were determined by normalizing PAI-1 or C/EBP{delta} mRNA levels after induction by IL-1beta (B) or IL-6 (D) with respect to control mRNA levels in cells treated with each inhibitor without stimulating cytokines (A). P < 0.05 vs. PAI-1 mRNA induced by IL-1beta (*), vs. C/EBP{delta} mRNA induced by IL-1 beta (n = 4, P < 0.05; #), vs. PAI-1 (§), and vs. C/EBP{delta} mRNA induced by IL-6 (n = 4, P < 0.05; {dagger}).

 

Figure 7
View larger version (75K):
[in this window]
[in a new window]

  		Fig. 7. Effects of the inhibitors of signaling pathways on PAI-1 and C/EBP{delta} protein induced by IL-1beta or IL-6. HepG2 cells were treated with the indicated inhibitors for 1 h. They were then exposed to IL-1beta or IL-6. After 4 h, nuclear protein was extracted for assay of C/EBP{delta} protein by Western blot. After 24 h, medium was collected for assay of PAI-1 protein. A: effects of inhibitors on basal PAI-1 and C/EBP{delta} protein levels. B: effect of inhibitors on PAI-1 and C/EBP{delta} protein levels induced by IL-1beta. C: effect of inhibitors on PAI-1 and C/EBP{delta} protein levels induced by IL-6. The results are representative of those obtained in 3 independent experiments.

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
In this study, a specific region of the PAI-1 promoter required for IL-1beta induction of PAI-1 expression was delineated. The deletion of the elements from –239 to –210 bp containing a C/EBP motif was found to decrease IL-1beta-inducible promoter activity. Mutation of the C/EBP motif decreased IL-1beta-inducible PAI-1 promoter activity and abolished induction by of IL-1 plus IL-6 combined on promoter activity. Thus the C/EBP motif appears to be critical in mediation of the IL-1beta response.

An insertion/deletion (4G/5G) polymorphism at –675 bp may alter PAI-1 gene expression induced by cytokines (4, 7, 17, 18). In the present study, no difference was found between 4G/4G and 5G/5G type in terms of basal and IL-1beta-inducible PAI-1 promoter activity. The binding activity of C/EBP{delta}, but not C/EBP{alpha} or C/EBPbeta, was increased by IL-1beta. This was accompanied by an increase in the amount of C/EBP{delta} mRNA and C/EBP{delta} protein. Downregulation of C/EBP{delta} in response to siRNA reduced expression of PAI-1 induced by IL-1beta. Thus C/EBP{delta} appears to be responsible for IL-1beta-inducible PAI-1 expression.

Results in previous studies showed that IL-1beta and IL-6 increase C/EBP{delta} expression in hepatocytes (15, 19). Results in our study extend these observations by demonstrating that IL-1beta and IL-6 exert combined effects on expression of C/EBP{delta} mRNA and C/EBP{delta} protein. We found analogous results in primary mouse hepatocytes, increasing the likelihood that the results obtained with HepG2 cells can be extrapolated to human liver in vivo.

Several members of the C/EBP family, including C/EBP{alpha}, C/EBPbeta, and C/EBP{delta} participate in mediating acute-phase responses (15, 19). The binding activity of C/EBP{alpha} to PAI-1 promoter was decreased and that of C/EBPbeta was not altered by exposure of HepG2 cells to the inflammatory cytokines we studied. By contrast, concentrations of C/EBP{delta} mRNA and protein were low at baseline and were markedly increased by IL-1beta. Therefore, it is likely that, following stimulation by IL-1beta, C/EBP{alpha} bound to the PAI-1 promoter is replaced by C/EBP{delta} that consequently activates transcription of PAI-1.

In contrast to C/EBPbeta, activated both early and late, C/EBP{delta} is likely to act late in altered gene expression associated with acute-phase reactions (19).

To determine which signaling pathways are involved in the IL-1- or IL-6-induced increased PAI-1 expression mediated by C/EBP{delta}, several relatively selective inhibitors of the signaling pathways were used. These inhibitors were used at concentrations that do not lead to apparent cytotoxicity (9, 16, 21, 22, 27). In HepG2 cells, IL-6 activates JAK, ERK, p38, and the PI 3-kinase/Akt pathway but does not activate the JNK signaling pathway (21, 22). When we examined upstream transduction pathways, we found that the JAK pathway was critical for IL-6-inducible C/EBP{delta} and subsequent PAI-1 production. Whether IL-6 induces C/EBP{delta} through STAT3 is not clear. STAT3 contributes to greater induction of C/EBP{delta} gene transcription by IL-6, and cooperative interaction of STAT3 with Sp1 is essential for the induction of C/EBP{delta} (2). However, overall induction of C/EBP{delta} is only minimally defective in STAT3-deficient mice (1).

IL-1beta activates C/EBP{delta} through the ERK pathway in human enterocytes and p38/MAPK pathway in epithelial cells (11, 24). In HepG2 cells, IL-1beta activates PI 3-kinase and p38, ERK, and JNK signal pathways (20, 22). In the present study, all three MAPK pathways were shown to be involved in the induction of C/EBP{delta} and PAI-1 mRNA by IL-1beta, and PI 3-kinase signaling negatively influenced IL-1beta induction. Akt/PKB is a downstream component of the PI 3-kinase signaling pathway. API-2 selectively inhibits the cellular phosphorylation/activation of all three homologous Akt isoforms (27). In the present study, API-2 increased PAI-1 expression induced by IL-1 and IL-6. However, increased basal PAI-1 expression by Akt inhibition may have contributed to the apparent IL-1- and IL-6-inducible PAI-1 increase by Akt inhibition. Hence it is unclear to what extent Akt regulates IL-1- and IL-6-mediated PAI-1 expression. Apart from the C/EBP family, NF-{kappa}B is another important transcription factor mediating IL-1 effects during acute-phase reactions in liver (8). However, our results suggest that NF-{kappa}B is not involved in upregulation of PAI-1 mediated by IL-1.

Mevastatin decreased expression of PAI-1 and inhibited increases of C/EBP{delta} mRNA, C/EBP{delta} protein, and C/EBP{delta} binding to the PAI-1 promoter induced by IL-1 and IL-6. Thus mevastatin exerted inhibitory effects downstream of C/EBP{delta}. Most of the pleiotropic properties of statins are attributable to inhibition of intracellular isoprenoids, important elements of the small G protein of the membranous signaling pathway (25). Because the kinase inhibitors used can potentially cross inhibit other kinases, further investigation of upstream signaling pathways of IL-1beta and IL-6 will be necessary to identify distinct signaling pathways and additional targets that can be influenced by statins.

In conclusion, our results indicate that IL-1 and IL-6 exert combined, directionally similar effects on expression of PAI-1. However, these effects are mediated by distinct signaling pathways that converge on a final, common mediator, C/EBP{delta}.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This study was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sport, Science and Technology of Japan.


   ACKNOWLEDGMENTS
 
The technical assistance of Miwako Fujii and secretarial assistance of Lori Dales are greatly appreciated.


   FOOTNOTES
 

Address for reprint requests and other correspondence: B. E. Sobel, Cardiovascular Research Institute, Univ. of Vermont, Colchester Research Facility, 208 South Park Dr., Colchester, VT 05446 (e-mail: Burton.Sobel{at}uvm.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Alonzi T, Maritano D, Gorgoni B, Rizzuto G, Libert C, Poli V. Essential role of STAT3 in the control of the acute-phase response as revealed by inducible gene inactivation in the liver. Mol Cell Biol 21: 1621–1632, 2001.[Abstract/Free Full Text]

2. Cantwell CA, Sterneck E, Johnson PF. Interleukin-6-specific activation of the C/EBP{delta} gene in hepatocytes is mediated by Stat3 and Sp1. Mol Cell Biol 18: 2108–2117, 1998.[Abstract/Free Full Text]

3. Carmeliet P, Stassen JM, Schoonjans L, Ream B, van den Oord JJ, De Mol M, Mulligan RC, Collen D. Plasminogen activator inhibitor-1 gene-deficient mice. II. Effects on hemostasis, thrombosis, and thrombolysis. J Clin Invest 92: 2756–2760, 1993.[ISI][Medline]

4. Dawson SJ, Wiman B, Hamsten A, Green F, Humphries S, Henney AM. The two allele sequences of a common polymorphism in the promoter of the plasminogen activator inhibitor-1 (PAI-1) gene respond differently to interleukin-1 in HepG2 cells. J Biol Chem 268: 10739–10745, 1993.[Abstract/Free Full Text]

5. Dong J, Fujii S, Goto D, Furumoto T, Kaneko T, Zaman TA, Nakai Y, Mishima T, Imagawa S, Kitabatake A. Increased expression of plasminogen activator inhibitor-1 by mediators of the acute phase response: a potential progenitor of vasculopathy in hypertensives. Hypertens Res 26: 723–729, 2003.[CrossRef][ISI][Medline]

6. Dong J, Fujii S, Li HM, Nakabayashi H, Sakai M, Nishi S, Goto D, Furumoto T, Imagawa S, Zaman TA, Kitabatake A. Interleukin-6 and mevastatin regulate plasminogen activator inhibitor-1 through CCAAT/enhancer-binding protein{delta}. Arterioscler Thromb Vasc Biol 25: 1078–1084, 2005.[Abstract/Free Full Text]

7. Eriksson P, Kallin B, van't Hooft FM, Båvenholm P, Hamsten A. Allele-specific increase in basal transcription of the plasminogen-activator inhibitor 1 gene is associated with myocardial infarction. Proc Natl Acad Sci USA 92: 1851–1855, 1995.[Abstract/Free Full Text]

8. Han Y, Meng T, Murray NR, Fields AP, Brasier AR. Interleukin-1-induced nuclear factor-{kappa}B-I{kappa}B{alpha} autoregulatory feedback loop in hepatocytes. A role for protein kinase c{alpha} in post-transcriptional regulation of I{kappa}B{alpha} resynthesis. J Biol Chem 274: 939–947, 1999.[Abstract/Free Full Text]

9. Heinrich PC, Behrmann I, Haan S, Hermanns HM, Muller-Newen G, Schaper F. Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem J 374: 1–20, 2003.[CrossRef][ISI][Medline]

10. Hou B, Eren M, Painter C, Covington J, Dixon J, Schoenhard J, Vaughan D. Tumor necrosis factor-{alpha} activates the human plasminogen activator inhibitor-1 gene through a distal nuclear factor-{kappa}B site. J Biol Chem 279: 18127–18136, 2004.[Abstract/Free Full Text]

11. Hungness ES, Pritts TA, Luo GJ, Hershko DD, Robb BW, Hasselgren PO. IL-1beta activates C/EBP-beta and {delta} in human enterocytes through a mitogen-activated protein kinase signaling pathway. Int J Biochem Cell Biol 34: 382–395, 2002.[CrossRef][ISI][Medline]

12. Kasza A, Kiss DL, Gopalan S, Xu W, Rydel RE, Koj A, Kordula T. Mechanism of plasminogen activator inhibitor-1 regulation by oncostatin M and interleukin-1 in human astrocytes. J Neurochem 283: 696–703, 2002.

13. Kohler HP, Grant PJ. Plasminogen-activator inhibitor type 1 and coronary artery disease. N Engl J Med 342: 1792–1801, 2000.[Free Full Text]

14. Koike C, Hayakawa Y, Niiya K, Sakuragawa N, Sasaki H. The production of heparin cofactor II is not regulated by inflammatory cytokines in human hepatoma cells: comparison with plasminogen activator inhibitor type-1. Thromb Haemost 75: 298–302, 1996.[ISI][Medline]

15. Lekstrom-Himes J, Xanthopoulos KG. Biological role of the CCAAT/enhancer-binding protein family of transcription factors. J Biol Chem 273: 28545–28548, 1998.[Abstract/Free Full Text]

16. Lin YZ, Yao SY, Veach RA, Torgerson TR, Hawiger J. Inhibition of nuclear translocation of transcription factor NF-{kappa}B by a synthetic peptide containing a cell membrane-permeable motif and nuclear localization sequence. J Biol Chem 270: 14255–14258, 1995.[Abstract/Free Full Text]

17. Maemura K, de la Monte SM, Chin MT, Layne MD, Hsieh CM, Yet SF, Perrella MA, Lee ME. A novel cycle-like factor, regulates the circadian oscillation of plasminogen activator inhibitor-1 gene expression. J Biol Chem 275: 36847–36851, 2000.[Abstract/Free Full Text]

18. McCormack LJ, Semple JI, Stickland MH, Barrett JH, Grant PJ. The effect of number of days in culture and plasminogen activator inhibitor-1 (PAI-1) 4G/5G genotype on PAI-1 antigen release by cultured human umbilical vein endothelial cells. Thromb Res 92: 199–206, 1998.[CrossRef][ISI][Medline]

19. Poli V. The role of C/EBP isoforms in the control of inflammatory and native immunity functions. J Biol Chem 273: 29279–29282, 1998.[Free Full Text]

20. Reddy SA, Huang JH, Liao WS. Phosphatidylinositol 3-kinase in interleukin 1 signaling. Physical interaction with the interleukin 1 receptor and requirement in NF-{kappa}B and AP-1 activation. J Biol Chem 272: 29167–29173, 1997.[Abstract/Free Full Text]

21. Schuringa JJ, Jonk LJ, Dokter WH, Vellenga E, Kruijer W. Interleukin-6-induced STAT3 transactivation and Ser727 phosphorylation involves Vav, Rac-1 and the kinase SEK-1/MKK-4 as signal transduction components. Biochem J 347: 89–96, 2000.

22. Shen X, Tian Z, Holtzman MJ, Gao B. Cross-talk between interleukin 1beta (IL-1beta) and IL-6 signalling pathways: IL-1beta selectively inhibits IL-6-activated signal transducer and activator of transcription factor 1 (STAT1) by a proteasome-dependent mechanism. Biochem J 352: 913–919, 2000.

23. Sobel BE. Increased plasminogen activator inhibitor-1 and vasculopathy. A reconcilable paradox. Circulation 99: 2496–2498, 1999.

24. Svotelis A, Doyon G, Bernatchez G, Desilets A, Rivard N, Asselin C. IL-1 beta-dependent regulation of C/EBP {delta} transcriptional activity. Biochem Biophys Res Commun 328: 461–470, 2005.[CrossRef][ISI][Medline]

25. Undas A, Brummel-Ziedins KE, Mann KG. Statins and blood coagulation. Arterioscler Thromb Vasc Biol 25: 1–8, 2005.[Free Full Text]

26. Verselis SJ, Olson KA, Fett JW. Regulation of angiogenin expression in human HepG2 hepatoma cells by mediators of the acute-phase response. Biochem Biophys Res Commun 259: 178–184, 1999.[CrossRef][ISI][Medline]

27. Yang L, Dan HC, Sun M, Liu Q, Sun XM, Feldman RI, Hamilton AD, Polokoff M, Nicosia SV, Herlyn M, Sebti SM, Cheng JQ. Akt/protein kinase B signaling inhibitor-2, a selective small molecule inhibitor of Akt signaling with antitumor activity in cancer cells overexpressing Akt. Cancer Res 64: 4394–4399, 2004.[Abstract/Free Full Text]

28. Zhu Y, Carmeliet P, Fay WP. Plasminogen activator inhibitor-1 is a major determinant of arterial thrombolysis resistance. Circulation 99: 3050–3055, 1999.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/1/C209    most recent
00157.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dong, J.
Right arrow Articles by Sobel, B. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dong, J.
Right arrow Articles by Sobel, B. E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.