| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RECEPTORS AND SIGNAL TRANSDUCTION
IIb
3 signaling
1Michael E. DeBakey Veterans Affairs Medical Center, Baylor College of Medicine and Rice University, Houston, Texas; and 2The Wihuri Research Institute, Helsinki, Finland
Submitted 1 November 2005 ; accepted in final form 30 June 2006
 |
ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
-subunit's cytoplasmic domain connected to the cytoskeleton. This often culminates in the activation of tyrosine kinases directing cell responses. The delicate balance between hemostasis and thrombosis requires exquisitely fine-tuned integrin function, and balance is maintained in vivo despite that the major platelet integrin 
IIb3 is continuously subjected to frictional or shearing forces generated by laminar blood flow. To test the hypothesis that platelet function is regulated by the direct effects of mechanical forces on IIb3, we examined IIb3/cytoskeletal interactions in human platelets exposed to shear stress in a cone-plate viscometer. We observed that -actinin, myosin heavy chain, and Syk coimmunoprecipitate with IIb3 in resting platelets and that 120 dyn/cm2 shear stress leads to their disassociation from IIb3. Shear-induced disassociation of -actinin and myosin heavy chain from the 3 tail is unaffected by blocking von Willebrand factor (VWF) binding to glycoprotein (Gp) Ib-IX-V but abolished by blocking VWF binding to IIb3. Syk's disassociation from 3 is inhibited when VWF binding to either GpIb-IX-V or IIb3 is blocked. Shear stress-induced phosphorylation of SLP-76 and its association with tyrosine-phosphorylated adhesion and degranulation-promoting adapter protein are inhibited by blocking ligand binding to IIb3 but not by blocking ligand binding to GpIb-IX-V. Chinese hamster ovary cells expressing IIb3 with 3 truncated of its cytoskeletal binding domains demonstrate diminished shear-dependent adhesion and cohesion. These results support the hypothesis that shear stress directly modulates IIb3 function and suggest that shear-induced IIb3-mediated signaling contributes to the regulation of platelet aggregation by directing the release of constraining cytoskeletal elements from the 3-tail. platelets; mechanoreceptor; integrin; shear stress; signal transduction
The concept that cells conform to Newton's third law ("for every action, there is an equal and opposite reaction") by altering their mechanical properties so as to balance the mechanical forces to which they are subjected is useful when examining molecular mechanisms of mechanotransduction (17). This "tensegrity" model of Ingber blends a Newtonian principle with established cell biological principles to provide a context in which to examine mechanisms by which mechanical forces are transduced into cellular responses. It states that "adherent cells generate their own internal tension or prestress in the actin cytoskeleton, which is balanced by internal microtubule struts and external ECM adhesions," where ECM is extracellular matrix (18). This model places integrins centrally in the process of mechanotransduction because their extracellular domains form matrix attachments directly linked through their cytoplasmic domains to the cell cytoskeleton, forming the "primary load-bearing elements in the cell." In this model, an integrin component of a focal contact or focal adhesion transduces an applied mechanical force "through distortion-dependent changes in cytoskeletal structure either locally at the site of receptor binding or distally at other locations within the cell" (18).
When considering molecular mechanisms of integrin-mediated mechanotransduction, one must begin by focusing on the cytoplasmic domain of the integrin's -component. In general, heterodimeric integrins (containing type I transmembrane - and -subunits) are directly connected to the cytoskeleton through the -subunit's cytoplasmic domain. This connection is essential for integrin signaling regulating cell adhesion, migration, exocytosis, and gene expression, including genes regulating mitosis, differentiation, and apoptosis (16). Although the tensegrity model predicts that such interactions are likely to be proven to be both essential and ubiquitous among cells utilizing mechanotransduction for their biological functions, there are only rare examples where mechanotransduction has been shown experimentally to require the -integrin/cytoskeleton interaction (17, 18). For example, Giannone et al. (12) used specific cytoskeletal protein-deficient cell lines to show that talin, but not filamin A, is required for force-induced tightening of integrin/cytoskeletal connections and for the recruitment of vinculin and paxillin to focal contacts. These results support the hypothesis that extracellular forces are transduced to the cytoskeleton through the -integrin/talin interaction and suggest that force transduction from an integrin to talin causes an adaptive cytoskeletal response resulting in focal adhesion formation.
There is indirect evidence that mechanical shearing forces regulate the function of human platelet integrin IIb3. Many platelet surface receptors bound to their ligands send signals to activate IIb3, but only the glycoprotein (Gp) Ib-IX-V adhesion receptor complex functions exclusively under shearing forces to attach platelets to exposed subendothelium and trigger IIb3-dependent thrombus formation (13, 16, 40, 44). IIb3 requires activation (a process termed "inside-out signaling"), and one route of activation involves shear-dependent binding of von Willebrand factor (VWF, either insolubilized in the vessel wall or plasma VWF bound to exposed subendothelial collagen) to the extracellular domain of GpIb. After ligand binding, GpIb's cytoplasmic domain signals the activation of IIb3 (8, 9, 21). IIb3 is also activated by collagen binding to GpVI and integrin 21, and by the local generation of soluble agonists, such as adenosine diphosphate and thrombin (40). After activation, IIb3 mediates platelet cohesion by binding VWF and, as shearing forces diminish during the evolution of an occlusive thrombus, by binding fibrinogen, fibronectin, soluble CD40, and perhaps other ligands (40, 45). Ligand binding then leads to a phase of IIb3 signaling (a process termed "outside-in signaling"). IIb3 outside-in signaling occurs via mechanisms that in most cases define, or at the very least recapitulate, general mechanisms of integrin signaling (16, 44, 46). Platelet outside-in signaling by IIb3 is important because it enhances platelet spreading, cytosolic ionized calcium and protein tyrosine kinase responses, secretion, aggregation, and clot retraction.
Published data suggest that outside-in signaling by platelet IIb3 is modulated by shear stress. Several groups have presented data that IIb3 blockers inhibit shear-dependent calcium responses, shear-dependent activation of protein kinase C and tyrosine kinases, and shear-dependent platelet procoagulant expression (3, 15, 24, 35, 37). In these experiments, however, it is difficult to distinguish the direct effects of shear on the IIb3-mediated response from the indirect effect of shear on signaling through the VWF/GpIb-IX-V/IIb3 axis. There are, however, reports of shear-induced platelet calcium (3, 14, 25) and protein phosphorylation (24, 35, 37) responses that develop independent of shear-induced VWF binding to GpIb. Additionally, we have recently shown that the shear-induced disassociation of -actinin from IIb3 is unaffected by blocking VWF binding to GpIb, but completely inhibited by blocking shear-induced VWF binding to IIb3 (9). This last result raises the possibility that platelet IIb3 functions like a typical integrin mechanosensor and that shear stress-induced traction on platelets bound together or to the extracellular matrix by VWF bridging IIb3 results in cytoskeletal responses similar to those that affect focal contacts and focal adhesions (11).
To test the hypothesis that integrin IIb3 is a shear sensor and to begin to explore how its mechanosensory apparatus works, we used flow chambers to examine how shear stress influences 3/cytoskeletal interactions and tyrosine kinase signaling in intact human platelets and how the expression of IIb3 influences Chinese hamster ovary (CHO) cell interactions with a VWF matrix under shear conditions.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
or inhibition of VWF and fibrinogen binding to IIb3 on platelets, the monoclonal antibody AK2 (10 µg/ml; RDI) which blocks the VWF recognition domain of GpIb, 5D2 (30 µg/ml, a gift from Dr. Michael C. Berndt, Monash University, Clayton, Victoria, Australia) which blocks the GpIb recognition domain of VWF, or RGDS peptide (500 µM) which blocks VWF or fibrinogen binding to IIb3, were added to washed platelet suspensions for 30 min at 24°C before exposure to shear. These receptor blockers completely inhibit shear-induced platelet aggregation. Washed human platelets were subjected to fluid shear stress (120 dyn/cm2) in a cone-plate viscometer at 24°C for 2 min. Immediately after shear, samples were lysed in the same volume of ice-cold immunoprecipitation buffer containing 100 mM NaCl, 100 mM Tris·HCl, pH 7.5, 2% Triton X-100, 0.2% deoxycholic acid, 4 mM Na3VO4, 4 mM NaF, 4 mM EGTA, 4 mM phenylmethylsulfonyl fluoride, and 10 µg/ml each of aprotinin, pepstatin, and leupeptin.
Immunoprecipitation and Western blot analysis.
Sheared platelet or control samples were lysed as above. Samples were then sonicated briefly (
5 s) and incubated on ice for 30 min. Platelet lysates were cleared of insoluble debris by centrifugation at 13,000 revolutions/min for 5 min at 4°C and then diluted with the same volume of ice-cold PBS to bring the final Triton concentration to 0.5%. IIb3 was immunoprecipitated with a rabbit anti-IIb polyclonal antibody generously provided by Dr. P. Thiagarajan (Michael E. DeBakey Veterans Affairs Medical Center and Baylor College of Medicine, Houston, TX). SLP-76 was immunoprecipitated with sheep anti-human SLP-76 polyclonal antibody (Upstate). Immunoprecipitation was carried out by incubating platelet lysates with antibodies and Sepharose-conjugated Protein A/G overnight at 4°C. After three washes with ice-cold PBS buffer, precipitated proteins (5 µg/lane) were separated by SDS-PAGE under reducing conditions. Proteins were then visualized using either silver staining or Western blot analysis. The Western blotting procedure was carried out using primary antibodies (2 µg/ml) overnight at 4°C, followed by 1 h of incubation at room temperature with the appropriate peroxidase-conjugated secondary antibodies (1:5,000 dilution). The antibodies used were as follows: -actinin-BM-75.2 (Sigma), adhesion and degranulation-promoting adapter protein (ADAP), SLAP-130, and Fyn-binding protein (Fyb)-mouse monoclonal (BD Transduction Laboratories), Syk-4D10 (Santa Cruz Laboratories), phosphotyrosine-4G10 (Upstate), protein kinase N (PKN)-rabbit polyclonal (Upstate), class IA phosphatidylinositol 3-kinase (PI3-kinase)-rabbit polyclonal (Upstate) and focal adhesion kinase (FAK)-rabbit polyclonal (Santa Cruz). Reactive bands were visualized by chemiluminescence and autoradiography.
Protein sequence determination.
Lysates of resting platelets were immunoprecipitated with the rabbit anti-IIb antibody. Precipitated proteins were separated on 6% SDS-PAGE, transferred to polyvinylidene difluoride membranes, and stained in 0.05% Coomassie blue solution for 30 min. Membranes were destained with 5% acetic acid and 10% methanol until the bands were easily distinguished from background. The membrane was then rinsed with water for 15 min, and the band of interest was excised, placed in individual microfuge tubes, and subjected to proteolytic digestion with trypsin and endoprotease Asp-N. The proteolytically generated fragments were derivatized with diphenylthiohydantoin, separated by HPLC, and analyzed using a PROCISE-cLC automated sequencer.
CHO cells expressing recombinant IIb3 and Syk.
Full length of human IIb and 3 cDNA (in LK444 plasmid, a gift from Dr. Paul F. Bray, Baylor College of Medicine) was cloned into PREP4 vector (from 5' XbaI to 3' HindIII) and expressed in CHO cells. Truncation of the 3 COOH-terminus from amino acid 716 was constructedusing primers 3a5 (GACGAGATTCTCGAGTCAGTGAAA) and 3a3 (GATGGTGATCGGCCGCTTACCTGATGAG). The amplified 212-bp PCR DNA (from 5' AflII to 3' NotI) was sequenced and ligated to a piece of 3 cDNA (from 5' XbaI to AflII). The truncated 3 cDNA (from 5' XbaI to 3' NotI) was then cloned into PREP4 vector and transfected in CHO cells by Lipofectamine reagent (Invitrogen). The expression of cells transfected with full-length IIb, 3, and/or 3T716 was selected for with 500 µg/ml hygromycin and measured by flow cytometry with anti-IIb antibody (5B12-FITC; DAKO) and Western blotting with a goat anti-3 antibody (Santa Cruz).
Full-length Syk cDNA in the EMCV.SR eukaryotic expression vector was originally obtained from Dr. Karen Zoller (ARIAD Pharmaceuticals, Cambridge, MA; see Ref. 52). It was subcloned into pcDNA3.1/zeo and expressed in CHO-IIb3 cells after Lipofectamine transfection. Cell lines with stable expression of IIb3 and Syk were cloned by limiting dilution from CHO-IIb3 cells identified as expressing Syk by Western blotting with the monoclonal antibody 4D10 (Santa Cruz).
Adhesion to immobilized ligands.
The surface of 12-well plates was coated with VWF (20 µg/ml; Calbiochem) in coating buffer (in mM: 150 NaCl, 50 NaH2PO4, and 50 Na2HPO4) overnight at 4°C. The wells were then washed with PBS and incubated with PBS containing 5 mg/ml BSA for another 2 h at 37°C. After two washings with PBS, the immobilized VWF surface was ready for cell adhesion. Different CHO cell lines with similar expressing levels of IIb3, IIb3T716, or empty vector were detached from the culture dish by EDTA (2 mM), washed with PBS, and collected in JNL buffer containing 1 mM CaCl2. Some CHO-IIb3 cells were incubated with tirofiban (1 µM) at room temperature for 20 min before adhesion. The same amount of cells (5 x 104/ml) was added to each coated well and incubated at 37°C for 30 min. Cells in each well were washed three times with PBS, fixed, and stained with the Hema 3 Manual Staining System (Fisher Scientific).
CHO cell interaction with immobilized VWF under flow conditions.
Purified human VWF was immobilized on glass cover slips (35 mm in diameter) as above. The parallel-plate flow chamber was connected as instructed by GlycoTech (Rockville, MD) using a gasket thickness of 0.01 inch and a flow path width of 0.25 cm. The volumetric flow rate was selected as low as 0.2 ml/min, which is equal to 125 s–1 shear rate or 2.4 dyn/cm2 shear stress (assuming a medium viscosity of 2 cP), and as high as 2 ml/min, which was equal to 1,200 s–1 shear rate or 24 dyn/cm2 shear stress. CHO cell lines expressing IIb3, IIb3T716, or empty vector were detached by EDTA, washed two times with PBS, and resuspended in JNL buffer containing 1 mM Ca2+ at a concentration of 5 x 105 cells/ml. Photographs were taken with a Nikon digital camera using MetaMorph software from a fixed field at x200 magnification at 2–3 min after flow was initiated. The volumetric flow rate was then changed from low to high manually, and photographs from the same area were taken after 2 min.
Data analysis.
Quantitation of Syk Western blot signals in immunoprecipitates of 3 was made using a Hewlett-Packard Scan Jet 7400C scanner connected to a personal computer and processed using the Bio-Rad Quantity One image analysis software. The data were analyzed by the Mann-Whitney rank sum test using Sigma Plot software. Quantitation of cell attachment was made by counting five microscope fields (x200 magnification) per VWF-coated coverslip. Paired numerical data were analyzed by Student's t-test using Microsoft Excel.
|
RESULTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
IIb3 signaling, we began by examining how inhibition of shear-induced VWF binding to IIb3 affects 3 binding to its cytoskeletal partners. In these experiments, monoclonal antibodies were used to block VWF binding to GpIb-IX-V, or a synthetic RGDS peptide was used to inhibit VWF binding to IIb3. Intact washed human platelets in buffer containing 1 mM CaCl2 and 5 µg/ml purified human VWF were then exposed to pathological shear (120 dyn/cm2 shear stress = 6,000 s–1 shear rate) in a cone-plate viscometer. Immunoprecipitates of IIb3 before and after shear were probed by silver staining or immunoblotting to survey for proteins known to bind to the 3 cytoplasmic domain. Only two such partners [myosin heavy chain (MHC) and -actinin] were observed to form dynamic associations that occurred independent of shear-induced VWF binding to GpIb-IX-V.
Figure 1 shows a silver-stained gel of sheared platelets immunoprecipitated with a rabbit polyclonal antiserum specific for integrin IIb. Figure 1 shows a single prominent band of 250,000 Da that disassociates from IIb3 after 2 min of shearing. The dissociation is inhibited by 500 µM RGDS, which inhibits shear-induced VWF binding to IIb3, but is unaffected by 30 µg/ml 5D2, which binds to VWF and prevents it from binding to GpIb. Subsequent analyses of this band using Coomassie staining followed by trypsin digestion, HPLC, and mass spectroscopy identified it as MHC. MHC has been previously shown, using alternative methods, to be capable of binding to the 3 tail (19).
|
IIb3 immunoprecipitates for cytoskeletal proteins that bind to the 3 tail. One such protein is the versatile filamentous actin cross-linking protein -actinin, which we (9) and others (38) have shown to bind to IIb3 in resting platelets. This interaction requires -actinin forming noncovalent bonds with residues 727 through 737 in the proximal 3 COOH-terminal cytoplasmic domain (30). Figure 2 shows that -actinin binds to IIb3 in unstimulated platelets and then disassociates from the 3 tail when platelets are sheared. Figure 2A shows the time response of the disassociation at 120 dyn/cm2 and the shear response of disassociation after 2 min of shear. Figure 2B shows that the dissociation is inhibited by 500 µM RGDS but not by 10 µg/ml AK2, which binds to the VWF recognition domain of GpIb and thereby inhibits shear-induced VWF binding to GpIb-IX-V.
|
-actinin from the 3 tail may be important because, as Fig. 3 demonstrates, -actinin is an important scaffold component that colocalizes several catalytic proteins, such as the lipid kinase type I PI3-kinase, the serine and threonine kinase PKN, and the tyrosine kinase FAK. Furthermore, because we have previously shown that -actinin binds to phosphoinositides (39), Fig. 3 suggests that the -actinin scaffolding has the potential to colocalize PI3-kinase with its substrate phosphatidylinositol 4,5-bisphosphate; and to compartmentalize the cytoskeletal modulator PKN with phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate, which direct its phosphorylation by phosphoinositide-dependent protein kinase 1 (7, 32).
|
|
|
IIb3. It appears to be activated by the tyrosine kinase src, which is a very early signal and perhaps the initiator of IIb3-mediated "outside-in" signaling (1, 5, 34). Syk activation is not required for its binding to the 3 tail, but the converse is not true: Syk appears to require binding to IIb3 to become activated and diphosphorylated (49, 50). Less certain, however, is whether Syk binds to resting platelet IIb3 and is then activated (42) or whether it translocates and binds to 3 only after ligand engages IIb3 during cell adherence (34). Figure 4 shows data consistent with the conclusion that Syk binds to washed platelet IIb3 before shear stimulation begins. Figure 4 also shows that 2 min of 120 dyn/cm2 shear stress causes Syk to disassociate from IIb3 and that this disassociation, unlike that of MHC and -actinin, is dependent on VWF binding to both GpIb-IX-V and IIb3. Densitometry analyses of 3 immunoprecipitates reveal that 50% of the quantity of immunodetectable Syk associated with IIb3 in resting platelets dissociates from IIb3 after 2 min of exposure to 120 dyn/cm2 shear stress (n = 3; P < 0.001).
Figure 5 corroborates that Syk associates with a scaffolding protein (-actinin) and a target protein (FAK) in resting platelets, and it also shows that it binds to PI3-kinase, an important signal-transducing kinase that may be modulated by Syk-mediated phosphorylation (9, 27, 39). FAK becomes tyrosine phosphorylated after 2 min of exposure to 120 dyn/cm2 shear stress, and shear-dependent platelet FAK phosphorylation is prevented by blocking shear-induced VWF binding to either GpIb-IX-V or IIb3 or by preincubating platelets with the nonspecific tyrosine kinase inhibitor piceatannol (data not shown). These results suggest that shear-induced platelet FAK activation requires "inside-outside" signaling to IIb3 followed by "outside-inside" signaling from IIb3, either or both of which is tyrosine kinase dependent (27, 39). In contrast, Fig. 6 shows that the shear-induced phosphorylation of SLP-76 and its binding partner ADAP [also known as SLP-76-associated protein of 130 kDa (SLAP-130) or Fyb] is inhibited only when shear stress-induced VWF binding to IIb3 is blocked by RGDS, indicating that SLP-76 activation is activated by shear-induced outside-inside signaling from IIb3 (33).
|
IIb3-mediated responses due to the effect of shear-induced VWF binding to IIb3 independent of VWF binding to GpIb-IX-V. Although these biochemical responses could lead to functional effects by altering established colocalizations or causing protein tyrosine phosphorylation, platelet experiments fail to address the hypothesis that shear-induced VWF-dependent signaling from IIb3 has functional consequences. To examine this hypothesis, we simplified the experimental design by eliminating the confounding effects of studying platelets (such as VWF binding to GpIb-IX-V, the secretion of proaggregatory granule constituents, and the use of nonspecific inhibitors) by examining flow-dependent responses of CHO cells engineered to express human wild-type and mutant IIb3. In using this experimental system, we recognize that CHO cells are different from platelets in many important ways, such as geometry, cytoskeletal apparatus, and signaling repertoire. Nonetheless, the capacity of CHO-IIb3 cells to adhere and spread when placed on solid-phase VWF in a static milieu (data not shown) suggested to us the possibility of using them to test the hypothesis that shear-induced IIb3 signaling regulates cellular adhesion and cohesion. Additionally, we observed that CHO-IIb3 cell adherence and spreading on solid-phase VWF (20 µg/ml) were eliminated by blocking IIb3 with the nonpeptide antagonist tirofiban, indicating that these CHO cell responses were directed primarily by the expression of IIb3, and that CHO-IIb3T716 cells adhered but did not spread when they were plated for 30 min on 20 µg/ml VWF, indicating that abrogated signaling to the cytoskeleton could be measured when CHO cells expressed IIb3 with a truncation of the cytoplasmic domain of 3 at COOH-terminal residue 716 (data not shown; n = 4).
Figure 7 shows that CHO cells expressing human IIb3 (CHO-IIb3) attach to solid-phase VWF when they are flowed over it under controlled shear stress. Attachment is greater at 24 than at 2.4 dyn/cm2. CHO cell adhesion and cohesion are decreased in cells expressing truncated 3 (CHO-IIb3T716), which eliminates 3 domains mediating binding to MHC, -actinin, and Syk, but recombinant human Syk coexpression has little effect on shear-dependent CHO cell attachment and spreading, despite that there is no endogenous Syk expression in CHO cells (Fig. 7). Figure 8 demonstrates that shear-dependent adherence of CHO-IIb3 cells is calcium dependent and that truncation of the cytoplasmic domain of 3 at COOH-terminal residue 716 eliminates shear-dependent CHO-IIb3 adherence by 80%.
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
IIb3. We have shown that pathological shear forces, such as those encountered in stenotic midsized coronary and cerebral arteries, directly affect ligand-dependent IIb3 signaling. This effect involves the release from IIb3's 3 cytoplasmic domain of a contractile protein (MHC) and a protein involved in maintaining cytoskeletal rigidity that also serves as an adapter (-actinin). These proteins work together, and work through dynamic interactions with Syk, FAK, PKN, PI3-kinase, and SLP-76, to regulate cytoskeletal changes involved in attachment, adhesion, and motility in many cell types, including platelets (9, 44).
To investigate the mechanism by which shear induces IIb3 signaling, we must first examine the molecules involved. The first molecule to examine is the ligand. Experiments in this report are constructed so that soluble VWF is the primary ligand. VWF is derived from the platelet buffer and released from shear-activated platelets (31). VWF is a unique soluble ligand, since its A1 domain forms a shear-dependent bond by contacting a specific region of the extracellular domain of GpIb (41). This bond, despite being transitory, is of such exceptionally high strength that it is capable of withstanding shearing forces that prevent leukocyte deposition and fibrin polymerization (40). The bond between VWF and GpIb works this way because it is a "catch bond," defined as a bond whose off-rate decreases with increasing shear force (6).
The bond that forms between VWF and IIb3 under shearing conditions is different from the VWF/GpIb bond in two important ways. The first difference is that a different domain of VWF (the C-1 domain containing an Arg-Gly-Asp sequence) is recognized by IIb3 only after IIb3 becomes activated. The second difference is that IIb3 probably does not establish a catch bond. In fact, it is more likely to form a slip bond, as has been shown for the closely related integrin v3 when it binds to fibronectin (20). A slip bond is one in which its off rate is increased when shearing forces are applied to it.
These two differences not only distinguish GpIb-IX-V and IIb3 vis a vis the nature of ligand recognition and attachment but also establish the biological context for examining how shear affects IIb3 signaling. To begin, one must first confront and solve the apparent conundrum that shear-dependent IIb3 responses can occur without VWF/GpIb-IX-V-mediated inside-out signaling to IIb3. Although experiments in platelets show that IIb3-dependent responses occur despite blocking VWF binding to GpIb-IX-V, these results could be confounded by incomplete blockade and/or platelet preactivation occurring during their preparation. To circumvent these possibilities, we examined shear-dependent VWF recognition in heterologous cells expressing IIb3 but lacking GpIb-IX-V. Data in Figs. 7 and 8 prove that there is direct shear-induced IIb3-mediated ligand binding and demonstrate for the first time that there are alternative mechanisms for achieving IIb3 activation that circumvent inside-out activation.
Although results indicating direct shear-dependent IIb3 responses may seem inconsistent with what is currently known about integrin IIb3, they are entirely consistent with what is known about other integrins and their mechanoresponsiveness (16, 17, 22). As we have shown for the disassociation of MHC (Fig. 1) and -actinin (Fig. 2) from the 3 tail, and for the downstream activation of SLP-76 (Fig. 6), mechanoresponsiveness involves pathways that require a ligand-integrin couple (16, 17, 22, 23). In addition, as shown in our platelet coimmunoprecipitation and engineered CHO cell experiments, integrin mechanoresponsiveness involves integrin/cytoskeletal interactions that, at least in part, are mediated by the -integrin cytoplasmic domain. In fact, our -actinin coimmunoprecipitation results are consistent with data reported in an osteoblast cell line, where shear-dependent focal adhesions require -actinin anchoring filamentous actin to 1-integrins (36). Additionally, our CHO-IIb3 and CHO-IIb3T716 results are consistent with data reported for v3 using K562 cells, where the tyrosine phosphorylation of Y747 or Y759 in the cytoplasmic domain of 3 is shown to regulate shear-dependent integrin binding to vitronectin (2).
It therefore can be concluded that shear stress has a direct effect on 3 cytoplasmic domain-mediated platelet integrin signaling and that such signaling modulates ligand recognition and bonding. This conclusion leads us to suggest the hypothesis that the recently described "push-pull" model of IIb3 activation represents a biomechanical response of the platelet membrane to shear stress, resulting in IIb3 activation independent of all cytosolic signaling pathways (29). The push-pull model describes IIb3 activation as being directed by the transition of the transmembranous domains of heterodimeric IIb3 to homodimeric IIb/IIb and 3/3 helices. In this model, activation is defined as "affinity modulation," and it is noteworthy that such mechanoresponsive affinity modulation has also been attributed to integrin v3 under conditions of exposure to mechanical stretching forces (23).
Although it is clear that shear stress directly affects IIb3's capacity to bind ligand, the theory that it works by affinity modulation through a push-pull mechanism is at this time entirely speculative. In contrast, data presented in this report begin to provide experimental evidence that the molecular mechanism by which shear stress causes IIb3 signaling involves 3 attachment to cytoskeletal elements. In interpreting these data, it is helpful to return to an examination of the second difference between GpIb-IX-V- and IIb3-mediated shear-induced responses described above (the fact that GpIb forms very strong catch bonds with VWF while IIb3 is more likely to from a slip bond with VWF). In examining this difference between GpIb-IX-V and IIb3, an important first question is "are integrin bonds with VWF strong enough to withstand the force of 120 dyn/cm2 shear stress?" The answer is "yes," since many published data consistently demonstrate that VWF-dependent platelet aggregation requires stable cohesion mediated by VWF bridging IIb3 despite very high shearing forces (4, 24, 35, 37, 43). There are also data showing that integrin v3-mediated adherence to vitronectin is capable of withstanding shearing stresses two to three times higher than those used in our experiments (2). Furthermore, we have previously shown that maintenance of aggregation during 3 min of exposure to 120 dyn/cm2 shear stress is disrupted by cytochalasin D, suggesting that continued IIb3-mediated platelet cohesion requires an intact cytoskeleton (4). It therefore appears valid to conclude that direct shear-induced VWF binding to IIb3 establishes extracellular bonds capable of withstanding pathological elevations of shear stress, possibly through the formation of newly established slip bonds between the 3 tail and the reorganizing cytoskeleton.
Because VWF binding to IIb3 is maintained under shearing forces, one can readily deduce that mechanical forces imposed on VWF bound to the extracellular domain of IIb3 are likely to be transduced to the cytoskeleton. This deduction is consistent with Ingber's "tensegrity model" and is based on extensive previous work on other integrins (11, 12, 17, 18, 20, 22, 23). Most importantly, it is supported by results in Figs. 1 and 2 demonstrating that shear-dependent VWF binding to IIb3 leads to the release of MHC and -actinin bound to the 3 tail: these data prove that shear imposed on the extracellular domain of IIb3 bound to VWF has a direct effect on an intracellular domain of the IIb3 complex. These data also buttress observations made in K-562 cells showing that v3 signaling depends on the 3 tail making its connections to the cytoskeleton and other signaling elements through specific phosphotyrosine residues (2, 26, 51).
Shear-induced IIb3-mediated signaling in platelets is likely to be involved in platelet aggregation, but the confounding effects of shear stress on platelets limit the strength of this supposition. To overcome these confounding effects, we examined shear-dependent adhesion of CHO cells expressing wild-type or mutant IIb3. CHO cells contain most of the platelet's cytoskeletal components but lack GpIb-IX-V (which binds VWF), -granules (which store VWF), dense granules and purinergic receptors (which store and bind adenosine diphosphate, respectively), and many signaling proteins (including Syk). Under these experimental conditions, we observed shear-dependent CHO-IIb3-mediated attachment to VWF that was both calcium and 3 cytoplasmic domain dependent. As such, these results prove for the first time that shear modulates IIb3 function in a manner similar to how IIb3 is modulated in response to ligand binding under static or low shear stress conditions (26, 28, 48, 51). It is interesting to note that the coexpression of Syk does not effect shear-dependent IIb3 signaling (Fig. 7). Such a result is consistent with data in Fig. 4 showing that Syk's disassociation from IIb3 depends on VWF binding to either GpIb-IX-V or IIb3, suggesting that Syk is either uninvolved in both "inside-out" (21) and "outside-in" IIb3 signaling or that it is principally involved in inside-out signaling from GpIb-IX-V to IIb3 only under conditions of pathologically elevated shear stress (9, 39). This latter interpretation is buttressed by data presented in Fig. 4 demonstrating that Syk coimmunoprecipitates with IIb3 in washed platelets under resting conditions. Results in Fig. 4 clarify ambiguous data about the relationship between Syk and IIb3 in unstimulated platelets (34, 42) and corroborate recent data emphasizing the dynamic relationship that exists between Syk, IIb3, and the cytoskeleton (5).
In summary, data presented here demonstrate that shear stress has a direct effect on platelet integrin IIb3. Shear stress first causes integrin activation, as reflected by ligand binding, leading to platelet aggregation or CHO cell adhesion. Ligand binding is then followed by integrin-directed outside-in signaling. We have also presented data that shear-induced signaling involves the cytoplasmic domain of 3 and its dynamic connections to contractile and structural cytoskeletal proteins and that one shear-induced IIb3-dependent response is the activation of SLP-76. We have also introduced a hypothesis for how shear directly activates IIb3 and how ligand-bound IIb3 regulates shear-induced VWF-dependent IIb3 signaling. Although the results presented here are not inconsistent with current understanding of integrin biology, they are the first direct demonstration that IIb3 is a mechanoresponsive receptor and that such mechanoresponsiveness contributes to shear-induced platelet activation independent of the GpIb-IX-V complex. We anticipate that such information will be useful for the process of elucidating molecular mechanisms of platelet activation that operate under conditions of physiological and pathological arterial blood flow. This process is important because it is likely to identify new targets of safer drugs to treat diseases caused by coronary, cerebral, and peripheral arterial atherothrombosis.
|
GRANTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
|
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
|
REFERENCES |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
cytoplasmic domain. Proc Natl Acad Sci USA 100: 13298–13302, 2003.2. Boettiger D, Huber F, Lynch L, and Blystone S. Activation of v3-vitronectin binding is a multistage process in which increases in bond strength are dependent on Y747 and Y759 in the cytoplasmic domain of 3. Mol Biol Cell 12: 1227–1237, 2001.
3. Chow TW, Hellums JD, Moake JL, and Kroll MH. Shear stress-induced von Willebrand factor binding to platelet glycoprotein Ib initiates calcium influx associated with aggregation. Blood 80: 113–120, 1992.
4. Christodoulides N, Feng S, Resendiz JC, Berndt MC, and Kroll MH. Glycoprotein Ib/IX/V binding to the membrane skeleton maintains shear-induced platelets aggregation. Thromb Res 102: 133–142, 2001.[CrossRef][Web of Science][Medline]
5. de Virgilio M, Kiosses WB, and Shattil SJ. Proximal, selective and dynamic interactions between integrin IIb3 and protein tyrosine kinases in living cells. J Cell Biol 165: 305–311, 2004.
6. Doggett TA, Girdhar G, Lawshé A, Schmidtke DW, Luarenzi IJ, Diamond SL, and Diacovo TG. Selectin-like kinetics and biomechanics promote rapid platelet adhesion in flow: the GPIb-vWF tether bond. Biophys J 83: 194–205, 2002.[Medline]
7. Dong LQ, Landa LR, Wick MJ, Zhu L, Mukai H, Ono Y, and Liu F. Phosphorylation of protein kinase N by phosphoinositide-dependent protein kinase-1 mediates insulin signals to the actin cytoskeleton. Proc Natl Acad Sci 97: 5089–5094, 2000.
8. Feng S, Christodoulides N, Resendiz JC, Berndt MC, and Kroll MH. Regulation of 14–3-3 protein binding to GpIb/IX/V by the cytoplasmic domains of GpIb and GpIb. Blood 95: 550–557, 2000.
9. Feng S, Reséndiz JC, Christodoulides N, Lu X, Arboleda D, Berndt MC, and Kroll MH. Pathological shear stress stimulates the tyrosine phosphorylation of -actinin associated with the glycoprotein Ib-IX complex. Biochemistry 41: 1100–1108, 2002.[CrossRef][Medline]
10. Feng S, Reséndiz JC, Lu X, and Kroll MH. Filamin A binding to the cytoplasmic tail of glycoprotein Ib regulates von Willebrand factor-induced platelet activation. Blood 102: 2122–2129, 2003.
11. Geiger B and Bershadsky A. Exploring the neighborhood: adhesion-coupled cell mechanosensors. Cell 110: 139–142, 2002.[CrossRef][Web of Science][Medline]
12. Giannone G, Jiang G, Sutton DH, Critchley DR, and Sheetz MP. Talin1 is critical for force-dependent reinforcement of initial integrin-cytoskeletal bonds but not tyrosine kinase activation. J Cell Biol 163: 409–419, 2003.
13. Gibbons JM. Platelet adhesion signaling and the regulation of thrombus formation. J Cell Sci 117: 3415–3425, 2004.
14. Goncalves I, Nesbitt WS, Yuan Y, and Jackson SP. Importance of temporal flow gradients and integrin IIb3 mechanotransduction for shear-activation of platelets. J Biol Chem 280: 15430–15437, 2005.
15. Goto S, Tamura N, Li M, Handa M, Ikeda Y, Handa S, and Ruggeri ZM. Different effects of various anti-GPIIb-IIIa agents on shear-induced platelet activation. J Thromb Haemost 1: 2022–2030, 2003.[CrossRef][Web of Science][Medline]
16. Hynes RO. Integrins: bidirectional allosteric signaling machines. Cell 110: 673–687, 2002.[CrossRef][Web of Science][Medline]
17. Ingber DE. Mechanosensation through integrins: cells act locally but think globally. Proc Natl Acad Sci USA 100: 1472–1474, 2003.
18. Ingber DE. Tensegrity II. How structural networks influence cellular information processing networks. J Cell Sci 116: 1397–1408, 2003.
19. Jenkins AL, Nannizzi-Alaimo L, Silver D, Sellers JR, Ginsberg MH, Law DA, and Phillips DR. Tyrosine phosphorylation of the 3 cytoplasmic domain mediates integrin-cytoskeletal interactions. J Biol Chem 273: 13878–13885. 1998.
20. Jiang G, Giannone G, Critchley DR, Fukumoto E, and Sheetz MP. Two piconewton slip bind between fibronectin and the cytoskeleton depends on talin. Nature 424: 334–337, 2003.[CrossRef][Medline]
21. Kasirer-Friede A, Cozzi MR, Mazzucato M, De Marco L, Ruggeri ZM, and Shattil SJ. Signaling through GP Ib-IX-V activates alpha IIb beta 3 independently of other receptors. Blood 103: 3403–3411, 2004.
22. Katsumi A, Orr OW, Tzima E, and Schwartz MA. Integrins in mechanotransduction. J Biol Chem 279: 12001–12004, 2004.
23. Katsumi A, Naoe T, Matsushita T, Kaibuchi K, and Schwartz MA. Integrin activation and matrix binding mediate cellular response to mechanical stretch. J Biol Chem 280: 16546–16549, 2005.
24. Kroll MH, Hellums JD, Guo Z, Durante W, Razdan K, Hrbolich JK, and Schafer AI. Protein kinase C is activated in platelets subjected to pathological shear stress. J Biol Chem 268: 3520–3524, 1993.
25. Kuwahara M, Sugimoto M, Tsuji S, Miyata S, and Yoshioka A. Cytosolic calcium changes in a process of platelet adhesion and cohesion on a von Willebrand factor-coated surface under flow conditions. Blood 94: 1149–1155, 1999.
26. Law DA, DeGuzman FR, Heiser P, Ministri-Madrid K, and Phillips DR. Integrin cytoplasmic tyrosine motif is required for outside-in IIb3 signalling and platelet function. Nature 410: 808–811, 1999.
27. Law DA, Nannizzi-Alaimo L, Ministri K, Hughes PE, Forsyth J, Turner M, Shattil SJ, Ginsberg MH, Tybulewicz VLJ, and Phillips DR. Genetic and pharmacological analyses of Syk function in IIb3 signaling in platelets. Blood 93: 2645–2652, 1999.
28. Leong L, Hughes PE, Schwartz MA, Ginsberg MH, and Shattil SJ. Integrin signaling: roles for the cytoplasmic tails of IIb3 in the tyrosine phosphorylation of pp125FAK. J Cell Sci 108: 3817–3825, 1995.[Abstract]
29. Li W, Metcalf DG, Gorelik R, Li R, Mitra N, Nanda V, Law PB, Lear JD, DeGrado WF, and Bennett JS. A push-pull mechanism for regulating integrin function. Proc Natl Acad Sci USA 102: 1424–1429, 2005.
30. Lyman S, Gilmore A, Burridge K, Gidwitz S, and White GC III. Integrin-mediated activation of focal adhesion kinase is independent of focal adhesion formation or integrin activation. J Biol Chem 272: 22538–22547, 1997.
31. Moake JL, Turner NA, Stathopoulos NA, Nolasco LH, and Hellums JD. Shear-induced platelet aggregation can be mediated by VWF released from platelets, as well as exogenous large or unusually large VWF multimers, requires adenosine diphosphate, and is resistant to aspirin. Blood 71: 1366–1374, 1988.
32. Mukai H. The structure and function of PKN, a protein kinase having a catalytic domain homologous to that of PKC. J Biochem 133: 17–27, 2003.
33. Obergfell A, Eto K, Judd BA, del Pozo MA, Schwartz MA, Koretzky GA, and Shattil SJ. The molecular adapter SLP-76 relays signals from platelet integrin IIb3 to the actin cytoskeleton. J Biol Chem 276: 5916–5923, 2001.
34. Obergfell A, Eto K, Mocsai A, Buensuceso C, Moores SL, Brugge JS, Lowell CA, and Shattil SJ. Coordinate interactions of Csk, Src, and Syk kinases with IIb3 initiate integrin signaling to the cytoskeleton. J Cell Biol 157: 265–275, 2002.
35. Oda A, Yokoyama K, Murata M, Tokuhira M, Nakamura K, Handa M, Watanabe K, and Ikeda Y. Protein tyrosine phosphorylation in human platelets during shear stress-induced platelet aggregation is regulated by GpIb/IX as well as GpIIb-IIIa and requires intact cytoskeleton and endogenous ADP. Thromb Haemost 74: 736–742, 1995.[Web of Science][Medline]
36. Pavalko FM, Chen NX, Turner CH, Burr DB, Atkinson S, Yeou-Fang H, Qui J, and Duncan RL. Fluid shear-induced mechanical signaling in MC3T3–E1 osteoblasts requires cytoskeleton-integrin interactions. Am J Physiol Cell Physiol 275: C1591–C1601, 1998.
37. Razdan K, Hellums JD, and Kroll MH. Shear stress-induced von Willebrand factor binding to platelets causes the activation of tyrosine kinase(s). Biochem J 302: 681–686, 1994.
38. Reddy KB, Bialkowska K, and Fox JEB. Dynamic modulation of cytoskeletal proteins linking integrins to signaling complexes in spreading cells. J Biol Chem 276: 28300–28308, 2001.
39. Reséndiz JC, Feng S, Ji G, Francis KA, Berndt MC, and Kroll MH. Purinergic P2Y receptor blockade inhibits shear-induced platelet phosphatidylinositol 3-kinase activation. Mol Pharmacol 63: 639–645, 2003.
40. Ruggeri ZM. Platelets in atherothrombosis. Nat Med 8: 1227–1234, 2002.[CrossRef][Web of Science][Medline]
41. Sadler JE. Contact-how platelets touch von Willebrand factor. Science 297: 1128–1129, 2002.
42. Sarkar S, Rooney MM, and Lord ST. Activation of integrin 3-associated Syk in platelets. Biochem J 338: 677–680, 1999.
43. Savage B, Almus-Jacobs F, and Ruggeri ZM. Specific synergy of multiple substrate-receptor interactions in platelet thrombus formation under flow. Cell 94: 657–666, 1998.[CrossRef][Web of Science][Medline]
44. Shattil SJ and Newman PJ. Integrins: dynamic scaffolds for adhesion and signaling in platelets. Blood 104: 1606–1615, 2004.
45. Srinivasa Prasad KS, Andre P, He M, Bao M, Manganello J, and Phillips DR. Soluble CD40 ligand induces 3 integrin tyrosine phosphorylation and triggers platelet activation by outside-in signaling. Proc Natl Acad Sci USA 100: 12367–12371, 2003.
46. Tamada M, Sheetz MP, and Sawada M. Activation of a signaling cascade by cell stretch. Dev Cell 7: 709–718, 2004.[CrossRef][Web of Science][Medline]
47. van Zanten GH, de Graaf S, Slootweg PJ, Heijnen HF, Connolly TM, de Groot PG, and Sixma JJ. Increased platelet deposition on atherosclerotic coronary arteries. J Clin Invest 93: 615–632, 1994.[Web of Science][Medline]
48. Wang R, Shattil SJ, Ambruso DR, and Newman PJ. Truncation of the cytoplasmic domain of 3 in a variant form of Glanzmann thrombasthenia abrogates signaling through the integrin IIb3 complex. J Clin Invest 100: 2393–2403, 1997.[Web of Science][Medline]
49. Woodside DG, Obergfell A, Leng L, Wilsbacher JL, Miranti CK, Brugge JS, Shattil SJ, and Ginsberg MH. Activation of Syk protein tyrosine kinases through interaction with integrin cytoplasmic domains. Cur Biol 11: 1799–1804, 2001.[CrossRef][Web of Science][Medline]
50. Woodside DG, Obergfell A, Leng L, Talapatra A, Calderwood DA, Shattil SJ, and Ginsberg MH. The N-terminal SH2 domains of Syk and ZAP-70 mediate phosphotyrosine-independent binding to integrin cytoplasmic domains. J Biol Chem 277: 39401–39408, 2002.
51. Xi X, Bodnar RJ, Li Z, Lam SCT, and Du X. Critical roles for the COOH-terminal NITY and RGT sequences of integrin 3 cytoplasmic domain in inside-out and outside-in signaling. J Cell Biol 162: 329–339, 2003.
52. Zoller KE, MacNeil IA, and Brugge JS. Protein tyrosine kinases Syk and Zap-70 display distinct requirements for Src family kinases in immune response receptor signal transduction. J Immunol 158: 1650–1659, 1997.[Abstract]
This article has been cited by other articles:
|
|
 |
|
  H. E. Speich, S. Grgurevich, T. J. Kueter, A. D. Earhart, S. M. Slack, and L. K. Jennings Platelets undergo phosphorylation of Syk at Y525/526 and Y352 in response to pathophysiological shear stress Am J Physiol Cell Physiol, October 1, 2008; 295(4): C1045 - C1054. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |
