|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RECEPTORS AND SIGNAL TRANSDUCTION
1Department of Pharmaceutical Sciences, Washington State University, Pullman, Washington; and 2Zhongshan Ophthalmic Center, Sun Yat-sen University, Key Laboratory of Ophthalmology, Ministry of Education, Guangzhou, People's Republic of China
Submitted 18 October 2005 ; accepted in final form 26 May 2006
| ABSTRACT |
|---|
|
|
|---|
, and TNF-
. LPS, IL-1
, and TNF-
, which mediate ocular inflammation, stimulate activation of p38, ERK, and Akt kinases in the corneal cell line. Similar responses are elicited by 18:1 LPA. Pertussis toxin (PTX) blocks LPA-induced activation of p38 and ERK but only slightly inhibits LPA-induced activation of Akt. All of the agonists tested, including LPA, stimulate proliferation of 2.040 pRSV-T cells. In these cells, both Akt and ERK pathways are important for LPA-induced proliferation. Thus PTX only partially suppresses the mitogenic response to LPA. Transcripts for the LPA receptors LPA1/EDG-2, LPA2/EDG-4, and LPA3/EDG-7 are expressed by the corneal cell line. Ki16425, an antagonist for LPA receptors, was used to explore the autocrine role of LPA. LPA-induced activations of p38, ERK, and Akt kinases, as well as proliferation, are inhibited by Ki16425. Ki16425 partially inhibits signal transduction and proliferation induced by the inflammatory agents tested. We conclude that LPA, produced in corneal epithelial cells in response to inflammatory agonists, contributes to mediating the mitogenic responses to these agonists in an autocrine fashion. phospholipid mediators; protein phosphorylation; G protein-coupled receptors; inflammation
Previous work in our laboratory (60) has indicated that LPA can be produced in response to treatment of cells with other growth factors and can play a role as an autocrine mediator in cancer cell growth. Similarly, work from another laboratory (17) has suggested that LPA may, in part, mediate proliferation induced by sphingosine-phosphate in mesenchymal stem cells. The recent development of LPA receptor antagonists presents opportunities to test the autocrine role of LPA in a more direct manner than was possible previously. In the current study, we have utilized this approach for the first time to examine the role of LPA in inflammatory responses. A corneal epithelial cell line was used as the model system for these studies.
Inflammation is a significant concern in ocular tissues. Lipid-derived mediators, such as platelet-activating factor (26) and eicosanoids (47), have been implicated in the initiation, propagation, and maintenance of inflammatory and immune responses in the eye. However, the physiological roles of LPA and its receptors in inflammation of the ocular surface have not been fully explored.
Several previous studies have indicated that LPA can play a signaling role in the cornea. Lilliom et al. (25) have shown that LPA participates in corneal wound healing that occurs after corneal injury. Specifically, LPA, alkenyl-glycerophosphate, phosphatidic acid, and lysophosphatidylserine were identified in the aqueous humor and the lacrimal gland fluid. Studies have shown that human corneal cell lines express LPA1 and LPA2 receptors and that sodium dodecyl sulfate (SDS) injury can increase the levels of mRNA for LPA2 (57). The small GTP-binding protein Rho is involved in LPA-induced migration of corneal epithelial cells (31). LPA stimulates tyrosine phosphorylation of focal adhesion proteins in chick corneal epithelial cells (52). Additional studies have shown LPA receptor expression and/or response in corneal endothelial cells (55), keratocytes (18, 40, 56), and lens epithelial cells (34). These data have established a potential role for LPA in the eye. However, the signaling pathways involved in LPA production and response in the cornea remain to be addressed.
It has been established that most LPA actions are mediated through the specific GPCRs of the EDG family (LPA1/EDG-2, LPA2/EDG-4, LPA3/EDG-7) (16, 22, 36, 39) and by LPA4/GPR23 (33). However, it has been difficult to determine which LPA receptor serves as a mediator of a given response. Pertussis toxin (PTX) inhibits many responses to LPA but is not specific for a particular receptor subtype. LPA receptor-selective antagonists, which have recently become commercially available, are important tools for identifying the subtype of LPA receptor that is responsible for mediating a particular downstream effect (14). Ki16425 is an LPA receptor antagonist that shows a preference for LPA1 and LPA3 over LPA2 (35).
In this study, we have addressed the hypothesis that LPA serves as an inflammatory mediator in human corneal epithelial cells. An established cell line was used as a model system. LPA production, signaling responses to LPA and inflammatory agonists, and the effects of LPA receptor antagonists were examined. The results suggest that LPA can act as an autocrine mediator of mitogenic responses to proinflammatory agonists.
| MATERIALS AND METHODS |
|---|
|
|
|---|
, TNF-
, Ki16425, U0126, and LY-294002 were obtained from Sigma (St. Louis, MO). PTX was from Calbiochem (La Jolla, CA). Cell culture. A human corneal epithelial cell line, 2.040 pRSV-T, was obtained from American Type Culture Collection (ATCC, Manassas, VA). Cells were maintained in keratinocyte serum-free medium (GIBCO Invitrogen, Carlsbad, CA) containing 5 ng/ml human recombinant EGF, 0.05 mg/ml bovine pituitary extract, 0.005 mg/ml insulin, and 500 ng/ml hydrocortisone and were plated on dishes coated with 0.01 mg/ml fibronectin and 0.01 mg/ml collagen I. Cells were grown at 37°C in 5% CO2-95% air, and were growth factor-starved by incubation in medium lacking EGF, pituitary extract, insulin, and hydrocortisone for 1824 h before experiments.
Isotopic method for LPA analysis. Production of LPA was assessed in cells and medium as described previously (61). Briefly, cells grown in six-well plates, with triplicate wells for each treatment, were growth factor-starved and simultaneously labeled by incubation for 18 h in medium containing 5 µCi/ml [3H]palmitic acid. Cells were washed and then incubated with agonists in Dulbecco's modified Eagle's medium containing 10 mM HEPES (pH 7.5) at 37°C in a cell culture incubator. Lipids were extracted and separated using TLC on silica gel plates impregnated with 0.5 M oxalic acid. Unlabeled 18:1 LPA was added as standard. 3H-labeled lipids were visualized using autoradiography after being sprayed with EN3HANCE (PerkinElmer). LPA bands, as well as the remainder of each lane, were scraped and quantified using liquid scintillation spectrometry. Results are expressed as percentages of the total radioactivity recovered.
Proliferation assays.
Cells were seeded at a density of 1x105 cells/well in triplicate in 24-well plates and then incubated in the plate overnight. After growth factor removal for 18 h, cells were treated with different concentrations of LPA, LPS, IL-1
, or TNF-
for various times in fresh medium lacking growth factors. In some experiments, cells were incubated with Ki16425, U0126, or LY-294002 before agonist addition. DMSO was used as the vehicle for all of these agents; the final concentration of DMSO in the incubation was <0.1%. BSA (4 mg/ml final concentration) was used as the vehicle for LPA. Cells were collected using 0.05% trypsin-0.53 mM EDTA (Sigma); Trypan blue was added. Live cells were counted using a hemacytometer.
Immunoblotting. Whole cell extracts, prepared in the presence of protease and phosphatase inhibitors, were subjected to SDS-PAGE and immunoblotting as described previously (10). Protein loading was equalized to 100 µg/lane, as determined using a Coomassie protein assay (Pierce Biotechnology, Rockford, IL). After incubation with antibodies, blots were developed using enhanced chemiluminescence reagents (Amersham Biosciences, Piscataway, NJ). Blots were scanned and then quantified using ImageQuaNT software (Amersham Biosciences).
RT-PCR.
Total RNA was extracted from harvested cells using TRIzol solution (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. Reverse transcription was performed using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA) in a reaction volume of 20 µl under the conditions recommended by the manufacturer. Total RNA (1 µg) was used as a template for cDNA synthesis. The resulting cDNA was used as a template for PCR. PCR was performed in a 50-µl reaction volume with a buffer consisting of 10x iTaq buffer, 50 mM MgCl2, 10 mM dNTP mix, iTaq DNA polymerase, and 0.25 µM each primer. The primers used were:
-actin (forward), TGACGGGGTCACCCACACTGTGCCCATCT;
-actin (reverse), CTAGAAGCATTTGCGGTGG ACGATGGAGGG; LPA1/EDG-2 (forward), TGTCATGGCTGCCATCTC; LPA1/EDG-2 (reverse), CATCTCAGTTTCCGTTCTAA; LPA2/EDG-4 (forward), CCCAACCAACAGGACTGACT; LPA2/EDG-4 (reverse), GAGCCCTTATCTCTCC CCAC, LPA3/EDG-7 (forward), GGACACCC ATGAAGCTAATG; and LPA3/DG-7 (reverse), TCTGGGTTCTCCTGAGAGAA. PCR was performed with initial denaturation at 95°C for 3 min, followed by 30 cycles consisting of denaturation at 95°C for 30 s, annealing for 30 s at 55°C, and extension at 72°C for 30 s. RT-PCR products were separated on a 2% agarose gel with electrophoresis and visualized under UV illumination.
Statistical analysis. Analysis of the significance of differences between two groups was performed by t-test or ANOVA, using Instat software (GraphPad, San Diego, CA). Values are presented as means ± SE.
| RESULTS |
|---|
|
|
|---|
|
, and TNF-
(51) are common proinflammatory cytokines that are present in the cornea and that induce inflammation in corneal epithelial cells. The effects of 18:1 LPA were also tested, because LPA induces LPA release in many cell lines (59). LPA in the medium was significantly increased by treatment of corneal epithelial cells for 40 min with 10 µM 18:1 LPA, 10 µg/ml LPS, 10 ng/ml IL-1
, and 10 ng/ml TNF-
(Fig. 1B). LPA levels did not change within cells at this time point (data not shown). Because LPS was consistently more efficacious than IL-1
or TNF-
(data not shown), this agonist was used for more detailed studies of LPA production in cells and medium. Effect of LPS on LPA production. The results presented above demonstrated that LPS can increase production of LPA in corneal epithelial cells. The location (cells vs. medium) and time course of LPS-induced LPA production were therefore examined in more detail. Corneal epithelial cells were treated with 10 µg/ml LPS for varying times. LPA generation was assessed in cells and medium, using the isotopic assay (Fig. 2). LPS caused a gradual increase in LPA in corneal epithelial cell medium (Fig. 2A), with a significant (P < 0.05) increase seen at 40 min. The LPS-induced increase persisted for at least 180 min. As shown in Fig. 2B, LPS induced an increase of LPA levels within corneal epithelial cells that was apparent only at 20 min. A dose-response study established that LPA production was maximal with 10 µg/ml LPS (data not shown).
|
, and TNF-
on 2.040 pRSV-T cell proliferation.
The results show that corneal epithelial cells generate LPA in response to inflammatory stimuli and LPA. Whether corneal epithelial cells respond in other ways to LPA is of interest. LPA has been shown to elicit diverse biological actions, including proliferation in a variety of cell types (6, 29, 63). We tested whether LPA enhanced proliferation of the 2.040 pRSV-T cell line, as has been reported for primary corneal epithelial cells (57). Cells were deprived of their usual growth factors and pretreated with or without PTX overnight. They were then incubated in the absence or presence of LPA. PTX can ADP-ribosylate the G proteins Gi/o and G12/13, thereby interfering with many (but not all) GPCR-mediated responses to LPA.
LPA stimulated proliferation of 2.040 pRSV-T human corneal epithelial cells, measured at 48 h, in a dose-dependent manner (Fig. 3A). Cell number was significantly increased by 10, 20, and 30 µM LPA compared with control. When 10 µM LPA was used to treat cells for 24, 48, and 72 h, an increase in cell numbers was observed throughout the time course (Fig. 3B). PTX partially inhibited LPA-induced proliferation but also had an inhibitory effect on cells incubated without LPA. In a separate experiment (Fig. 3C), proliferation was significantly increased after treatment with LPA, LPS, IL-1
, or TNF-
for 48 h. PTX was most effective in blocking the response to LPA, although the inhibition was only partial. PTX also significantly inhibited basal and inflammatory agonist-induced proliferation; however, the magnitude of the effect was small. The data indicate that LPA and inflammatory agonists are mitogenic for 2.040 pRSV-T cells. The response to LPA is mediated, in part, by PTX-sensitive G proteins. However, the relative ineffectiveness of PTX in blocking proliferation prompted us to further examine LPA-induced signaling pathways.
|
|
|
(19, 41), and TNF-
(28, 41) in many cell lines. LPS, IL-1
, TNF-
, and 18:1 LPA all caused a more than 10-fold increase in phosphorylation of each kinase in 2.040 pRSV-T cells (Fig. 6). In summary, LPS, IL-1
, TNF-
, and 18:1 LPA activate three of the same signal transduction pathways in 2.040 pRSV-T cells.
|
, and TNF-
in corneal epithelial cells (Fig. 7). Cells were incubated with 10 µM 18:1 LPA, 10 µg/ml LPS, 10 ng/ml IL-1
, or 10 ng/ml TNF-
for 5 min in the absence and presence of PTX (18-h preincubation). LPA-induced Erk and p38 activations were blocked with preincubation of the cells with PTX (Fig. 7, B and C). However, PTX did not interfere substantially with activation of Akt in response to LPA (Fig. 7D). These data indicate that LPA may activate Akt through a different receptor or G protein from those used to activate Erk and p38. Activations of Erk in response to the other inflammatory agonists was inhibited by <50% by PTX. Notably, the effects of the inflammatory agonists on Akt activation were relatively resistant to PTX. In view of the fact that basal phosphorylation levels of all three kinases were inhibited to varying extents by PTX, the potential role of G proteins (i.e., via autocrine production of LPA) in the responses to the other agents was difficult to assess. However, the data shown in Fig. 7B suggest that LPA may play a major role in agonist-induced Erk activation. Because none of the other agonists tested binds directly to a GPCR, the strong inhibitory effect of PTX on Erk activation suggests either an autocrine or permissive role for LPA (or another ligand binding to PTX-sensitive GPCRs) in certain signaling responses to inflammatory agonists. This concept was further explored in subsequent experiments.
|
|
0.033 µM, and that for Akt activation was
0.4 µM. A dose of 10 µM Ki16425 yielded maximal inhibition of both responses, was equal to the concentration of 18:1 LPA used as agonist, had little effect on basal kinase activity, and is the dose typically used in other studies to inhibit LPA response (23, 62); this concentration of antagonist was therefore used in subsequent studies. We examined the effects of Ki16425 on signaling pathways activated by LPA and other inflammatory agonists. Cells were pretreated with 10 µM Ki16425 for 5 min and then incubated with 10 µM 18:1 LPA, 10 µg/ml LPS, 10 ng/ml IL-1
, or 10 ng/ml TNF-
for 5 min. LPA-induced activations of Erk, Akt, and p38 were inhibited in cells incubated with Ki16425 (Fig. 10). Activations of Erk, Akt, and p38 in response to the other agonists were partly inhibited by Ki16425. However, consistent inhibition of basal kinase activities by Ki16425 complicated interpretation of the partial effects. Because Ki16425 was not cytotoxic in long-term incubations (see below), the significance of these acute effects is not clear.
|
|
, or TNF-
in the absence and presence of Ki16425, LY-294002, or U0126. As shown in Fig. 11B, LPA-induced proliferation was blocked by Ki16425. LY-294002 and U0126 each caused significant inhibition of LPA response, but the inhibition was not complete with either agent alone. The response to LPS was partially but significantly inhibited by Ki16425, LY-294002, and U0126. The response to IL-1
was significantly inhibited by Ki16425 and U0126 and completely blocked by LY-294002. Finally, the response to TNF-
was blocked by Ki16425, LY-294002, and U0126. For LPA and TNF-
, values seen with Ki16425 were not significantly different from untreated control.
|
was most effectively inhibited by Ki16425 (Fig. 11). The more modest, albeit significant, effects of Ki16425 on LPS- and IL-1
-induced proliferation (Fig. 11) are consistent with the data presented in Figs. 3, 7, and 9, all of which suggest a contributory role for LPA in responses to LPS and IL-1
. | DISCUSSION |
|---|
|
|
|---|
Corneal epithelial cells play an important role in ocular surface diseases. LPA secreted from corneal epithelial cells constitutes part of the outer layer of tear film (27). As a polar phospholipid and a mediator, LPA may potentially play dual roles in tears, proving an interface between the aqueous and nonpolar lipid layers (27) as well as acting as a proinflammatory agent. Many disorders involve inflammatory changes in the ocular surface. Of these, dry eye (keratoconjunctivitis sicca) is one of the most common (15, 44). Dry eye is a disorder of the tear film caused by tear deficiency or excessive tear evaporation. The outer layer of tear film is a lipid layer responsible for controlling evaporation from ocular surface. This layer is composed of both polar (e.g., LPA) and nonpolar components (27). Histological features of dry eye include abnormal proliferation and differentiation of the ocular surface epithelium (37, 38). It is believed that inflammatory cytokines in the tears contribute to the pathology (32). Increased expression of several inflammatory mediators has been observed in conjunctival epithelium and tear fluid in dry eye (1, 49, 53). Accordingly, treatments of severe forms of dry eye with steroids and topical cyclosporine A have been successful in human trials.
In this study, we focused on the effects of inflammatory agonists (LPS, IL-1
, and TNF-
) on 2.040 pRSV-T human corneal epithelial cell lines and the role of LPA in responses to these agents. The proinflammatory cytokines IL-1
and TNF-
are important mediators of inflammation and immunity (8). LPS, a major component of the outer membrane of Pseudomonas aeruginosa, exerts many of its biological effects by binding to specific cell surface receptors (24, 45). Binding of LPS to CD14 receptors in human cornea initiates a rapid innate immune response through production of proinflammatory cytokines and chemokines such as IL-6 and -8 (46, 50). Our results show that stimulation of cells with proinflammatory factors (LPS, IL-1
, and TNF-
) and LPA results in increased levels of LPA in the medium. LPA appears first in the cells and then in the medium. This general phenomenon was noted in previous studies from our laboratory (60) using a prostate cancer cell line. The time course suggests that LPA is made within cells and then released, but further studies are needed to establish this point. In other words, it remains to be determined whether the increase in LPA in the medium is due to export of agonist-generated LPA or whether LPA is largely produced in the extracellular space (59).
An interrelationship between inflammation and proliferation has been noted in many pathological settings, including cancer (42) and atherogenesis (7). LPA itself has been observed to be involved in both inflammation and proliferation (11). Although LPA has been previously shown to stimulate proliferation of corneal epithelial cells (57), previous data regarding the direct effects of LPS, TNF-
, and IL-1 on proliferation of corneal epithelial cells appear to be lacking. The current study demonstrates that these agents can stimulate proliferation of a corneal epithelial cell line. Specifically, we found that LPA induced proliferation of 2.040 pRSV-T corneal epithelial cells and that LPS, IL-1
, and TNF-
were also mitogenic. We therefore tested for activation of the Erk and Akt pathways, which are commonly involved in mitogenesis, and p38, which is frequently involved in inflammatory responses. LPA induced Erk, Akt, and p38 activation; LPS, IL-1
, and TNF-
exerted effects that were similar to these of LPA. PTX inhibited the LPA-induced activation of Erk and p38 but not Akt. The results indicate that LPA can act through PTX-sensitive G proteins to activate Erk and p38 but uses alternate pathways to activate Akt. Activation of both Akt and Erk is important for mitogenesis in this corneal cell line.
Most LPA actions are mediated through GPCRs, i.e., LPA1, LPA2, LPA3 (16, 22, 36), and LPA4/GPR23 (35). In the present study, we found that 2.040 pRSV-T cells express LPA1, LPA2, and LPA3 receptors. All of these receptors can couple to multiple G proteins (2). Previous studies by others showed that human corneal cell lines express LPA1 and LPA2 (57). PTX inhibited some LPA actions in 2.040 pRSV-T cells, indicating that PTX-sensitive G proteins mediate these responses. However, LPA-induced proliferation was not completely inhibited by PTX. The LPA antagonist Ki16425 was used to test the roles of LPA1 and LPA3. Ki16425 blocked LPA-induced proliferation. In addition, LPA-induced activations of Erk and Akt were substantially inhibited by Ki16425, with p38 activation being less sensitive. Because both Akt and Erk are required for LPA-induced proliferation, the mitogenic effects of LPA appear to be mediated by LPA1 and/or LPA3 receptors in this corneal epithelial cell line. Interestingly, the abilities of Ki16425 and PTX to reduce basal levels of activation of Akt and Erk suggest that LPA receptors are constitutively active in this cell line. Whether this is due to constitutive production of LPA or to constitutive activities of LPA receptors in the absence of agonist remains to be determined.
Proinflammatory cytokines and their receptors are components of a complicated signaling network that exists at the ocular surface. Their interactions can result in a persistent inflammatory response. In our study, LPA elicited responses similar to those of other inflammatory mediators (LPS, IL-1
, and TNF-
) in 2.040 pRSV-T cells. In addition, the proinflammatory agonists increased LPA production by these cells. An LPA antagonist, Ki16425, blocked the responses of the proinflammatory agonists to varying extents. Partial inhibition of responses likely reflects differences in the downstream signaling pathways utilized by the agonists; these differences resulted in greater dependence on LPA mediation for some agonists (e.g., TNF-
) than for others (e.g., LPS, IL-1
). Our data suggest that LPA is an important mediator of the mitogenic effects of proinflammatory cytokines on 2.040 pRSV-T cells. LPA receptors may thus represent "multitasking" therapeutic targets for the control of the proliferation and inflammation in corneal epithelia, as well as in other cell types that are responsive to LPA (e.g., carcinoma cells). LPA receptor-selective antagonists, such as Ki16425, provide a platform for the development of new therapeutic agents.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
concentration and fluorescein clearance in ocular rosacea. Invest Ophthalmol Vis Sci 40: 25062512, 1999.2. Anliker B and Chun J. Lysophospholipid G protein-coupled receptors. J Biol Chem 279: 2055520558, 2004.
3. Billah MM, Lapetina EG, and Cuatrecasas P. Phospholipase A2 activity specific for phosphatidic acid. A possible mechanism for the production of arachidonic acid in platelets. J Biol Chem 256: 53995403, 1981.
4. Bozinovski S, Jones JE, Vlahos R, Hamilton JA, and Anderson GP. Granulocyte/macrophage-colony-stimulating factor (GM-CSF) regulates lung innate immunity to lipopolysaccharide through Akt/Erk activation of NF
B and AP-1 in vivo. J Biol Chem 277: 4280842814, 2002.
5. Chettibi S, Lawrence AJ, Stevenson RD, and Young JD. Effect of lysophosphatidic acid on motility, polarisation and metabolic burst of human neutrophils. FEMS Immunol Med Microbiol 8: 271281, 1994.[CrossRef][Web of Science][Medline]
6. Contos JJ, Ishii I, and Chun J. Lysophosphatidic acid receptors. Mol Pharmacol 58: 11881196, 2000.[Web of Science][Medline]
7. De Winther MPJ, Kanters E, Kraal G, and Hofker MH. Nuclear factor
B signaling in atherogenesis. Arterioscler Thromb Vasc Biol 25: 904914, 1005.
8. Dinarello CA. Biologic basis for interleukin-1 in disease. Blood 87: 20952147, 1996.
9. Eichholtz T, Jalink K, Fahrenfort I, and Moolenaar WH. The bioactive phospholipid lysophosphatidic acid is released from activated platelets. Biochem J 291: 677680, 1993.[Web of Science][Medline]
10. Gibbs TC and Meier KE. Expression and regulation of phospholipase D isoforms in mammalian cell lines. J Cell Physiol 182: 7787, 2000.[CrossRef][Web of Science][Medline]
11. Goetzl EJ and An S. Diversity of cellular receptors and functions for the lysophospholipid growth factors lysophosphatidic acid and sphingosine 1-phosphate. FASEB J 12: 15891598, 1998.
12. Gupta A and Sharma AC. Despite minimal hemodynamic alterations endotoxemia modulates NOS and p38-MAPK phosphorylation via metalloendopeptidases. Mol Cell Biochem 265: 4756, 2004.[CrossRef][Web of Science][Medline]
13. Hama K, Aoki J, Fukaya M, Kishi Y, Sakai T, Suzuki R, Ohta H, Yamori T, Watanabe M, Chun J, and Arai H. Lysophosphatidic acid and autotaxin stimulate cell motility of neoplastic and non-neoplastic cells through LPA1. J Biol Chem 279: 1763417639, 2004.
14. Heasley BH, Jarosz R, Carter KM, Lynch KR, and Macdonald TL. Initial structure-activity relationships of lysophosphatidic acid receptor antagonists: discovery of a high-affinity LPA1/LPA3 receptor antagonist. Bioorg Med Chem Lett 14: 27352740, 2004.[CrossRef][Medline]
15. Hikichi T, Yoshida A, Fukui Y, Hamano T, Ri M, Araki K, Horimoto K, Takamura E, Kitagawa K, Oyama M, Danjo Y, Kondo S, Fujishima H, Toda I, and Tsubota K. Prevalence of dry eye in Japanese eye centers. Graefes Arch Clin Exp Ophthalmol 233: 555558, 1995.[CrossRef][Web of Science][Medline]
16. Ishii I, Fukushima N, Ye X, and Chun J. Lysophospholipid receptors: signaling and biology. Annu Rev Biochem 73: 321354, 2004.[CrossRef][Web of Science][Medline]
17. Jeon ES, Song HY, Kim MR, Moon HJ, Bae YC, Jung JS, and Kim JH. phingosylphosphorylcholine induces proliferation of human adipose tissue-derived mesenchymal stem cells via activation of JNK. J Lipid Res 47: 653664.
18. Jester JV and Ho-Chang J. Modulation of cultured corneal keratocyte phenotype by growth factors/cytokines control in vitro contractility and extracellular matrix contraction. Exp Eye Res 77: 581592, 2003.[CrossRef][Web of Science][Medline]
19. Jung YD, Liu W, Reinmuth N, Ahmad SA, Fan F, Gallick GE, and Ellis LM. Vascular endothelial growth factor is upregulated by interleukin-1
in human vascular smooth muscle cells via the p38 mitogen-activated protein kinase pathway. Angiogenesis 4: 155162, 2001.[CrossRef][Medline]
20. Kim JI, Jo EJ, Lee HY, Kang HK, Lee YN, Kwak JY, and Bae YS. Stimulation of early gene induction and cell proliferation by lysophosphatidic acid in human amnion-derived WISH cells: role of phospholipase D-mediated pathway. Biochem Pharmacol 68: 333340, 2004.[CrossRef][Web of Science][Medline]
21. Kishi Y, Okudaira S, Tanaka M, Hama K, Shida D, Kitayama J, Yamori T, Aoiki J, Fujimaki T, and Arai H. Autotaxin is overexpressed in glioblastoma multiforme and contributes to cell motility of glioblastoma by converting lysophosphatidylcholine to lysophosphatidic acid. J Biol Chem 281: 1749217500, 2006.
22. Kostenis E. Novel clusters of receptor for sphingosine-1-phosphate, sphingosylphosphorylcholine, and (lyso)-phosphatidic acid: new receptors for "old" ligands. J Cell Biochem 92: 923936, 2004.[CrossRef][Web of Science][Medline]
23. Lee Z, Swaby RF, Liang Y, Yu S, Liu S, Lu KH, Bast, RC Jr, Mills GB, and Fan X. Lysophosphatidic acid is a major regulator of growth-regulated oncogene
in ovarian cancer. Cancer Res 66: 27402748, 2006.
24. Lien E, Means TK, Heine H, Yoshimura A, Kusumoto S, Fukase K, Fenton MJ, Oikawa M, Qureshi N, Monks B, Finberg RW, Ingalls RR, and Golenbock DT. Toll-like receptor 4 imparts ligand-specific recognition of bacterial lipopolysaccharide. J Clin Invest 105: 497504, 2000.[Web of Science][Medline]
25. Liliom K, Guan Z, Tseng JL, Desiderio DM, Tigyi G, and Watsky MA. Growth factor-like phospholipids generated after corneal injury. Am J Physiol Cell Physiol 274: C1065C1074, 1998.
26. Ma X, Ottino P, Bazan HE, and Bazan NG. Platelet-activating factor (PAF) induces corneal neovascularization and upregulates VEGF expression in endothelial cells. Invest Ophthalmol Vis Sci 45: 29152921, 2004.
27. McCulley JP and Shine WE. The lipid layer: the outer surface of the ocular surface tear film. Biosci Rep 21: 407418, 2001.[CrossRef][Web of Science][Medline]
28. Miyashita T, Kawakami A, Tamai M, Izumi Y, Mingguo H, Tanaka F, Abiru S, Nakashima K, Iwanaga N, Aratake K, Kamachi M, Arima K, Ida H, Migita K, Origuchi T, Tagashira S, Nishikaku F, and Eguchi K. Akt is an endogenous inhibitor toward tumor necrosis factor-related apoptosis inducing ligand-mediated apoptosis in rheumatoid synovial cells. Biochem Biophys Res Commun 312: 397404, 2003.[CrossRef][Web of Science][Medline]
29. Moolenaar WH. Bioactive lysophospholipids and their G protein-coupled receptors. Exp Cell Res 253: 230238, 1999.[CrossRef][Web of Science][Medline]
30. Moolenaar WH, van Meeteren LA, and Giepmans BN. The ins and outs of lysophosphatidic acid signaling. Bioessays 26: 870881, 2004.[CrossRef][Web of Science][Medline]
31. Nakamura M, Nagano T, Chikama T, and Nishida T. Role of the small GTP-binding protein rho in epithelial cell migration in the rabbit cornea. Invest Ophthalmol Vis Sci 42: 941947, 2001.
32. Nelson JD, Helms H, Fiscella R, Southwell Y, and Hirsch JD. A new look at dry eye disease and its treatment. Adv Ther 17: 8493, 2000.[Web of Science][Medline]
33. Noguchi K, Ishii S, and Shimizu T. Identification of p2y9/GPR23 as a novel G protein-coupled receptor for lysophosphatidic acid, structurally distant from the Edg family. J Biol Chem 278: 256006, 2003.
34. Ohata H, Tanaka K, and Momose K. Sensitizing effect of lysophosphatidic acid on Ca2+ response to hypotonic stress in cultured lens epithelial cells. Life Sci 65: 297304, 1999.[CrossRef][Web of Science][Medline]
35. Ohta H, Sato K, Murata N, Damirin A, Malchinkhuu E, Kon J, Kimura T, Tobo M, Yamazaki Y, Watanabe T, Yagi M, Sato M, Suzuki R, Murooka H, Sakai T, Nishitoba T, Im DS, Nochi H, Tamoto K, Tomura H, and Okajima F. Ki16425, a subtype-selective antagonist for EDG-family lysophosphatidic acid receptors. Mol Pharmacol 64: 9941005, 2003.
36. Parrill AL, Sardar VM, and Yuan H. Sphingosine 1-phosphate and lysophosphatidic acid receptors: agonist and antagonist binding and progress toward development of receptor-specific ligands. Semin Cell Dev Biol 15: 467476, 2004.[CrossRef][Web of Science][Medline]
37. Pflugfelder SC. Advances in the diagnosis and management of keratoconjunctivitis sicca. Curr Opin Ophthalmol 9: 5053, 1998.[Medline]
38. Pflugfelder SC, Tseng SCG, Yoshino K, Monroy D, Felix C, and Reis BL. Correlation of goblet cell density and mucosal epithelial membrane mucin expression with rose bengal staining in patients with ocular irritation. Ophthalmology 104: 223235, 1997.[Web of Science][Medline]
39. Radeff-Huang J, Seasoltz TM, Matteo RG, and Brown JH. G protein mediated signaling pathways in lysophospholipid induced cell proliferation and survival. J Cell Biochem 92: 949966, 2004.[CrossRef][Web of Science][Medline]
40. Roy P, Petroll WM, Cavanagh HD, and Jester JV. Exertion of tractional force requires the coordinated up-regulation of cell contractility and adhesion. Cell Motil Cytoskeleton 43: 2334, 1999.[CrossRef][Web of Science][Medline]
41. Ruhul Amin AR, Senga T, Oo ML, Thant AA, and Hamaguchi M. Secretion of matrix metalloproteinase-9 by the proinflammatory cytokine, IL-1
: a role for the dual signalling pathways, Akt and Erk. Genes Cells 8: 515523, 2003.[Abstract]
42. Schottenfeld D and Beebe-Dimmer J. Chronic inflammation: a common and important factor in the pathogenesis of neoplasia. CA Cancer J Clin 56: 6983, 2006.
43. Schafer B, Marg B, Gschwind A, and Ullrich A. Distinct ADAM metalloproteinases regulate G protein-coupled receptor-induced cell proliferation and survival. J Biol Chem 279: 4792947938, 2004.
44. Schein OD, Munoz B, Tielsch JM, Bandeen-Roche K, and West S. Prevalence of dry eye among the elderly. Am J Ophthalmol 124: 723728, 1997.[Web of Science][Medline]
45. Schroder NW, Opitz B, Lamping N, Michelson KS, Zahringer U, Gobel UB, and Schumann RR. Involvement of lipopolysaccharide binding protein, CD14, and Toll-like receptors in the initiation of innate immune responses by Treponema glycolipids. J Immunol 165: 26832693, 2000.
46. Shams NB, Sigel MM, and Davis RM. Interferon-
, Staphylococcus aureus, and lipopolysaccharide/silica enhance interleukin-1
production by human corneal cells. Reg Immunol 2: 136148, 1989.[Medline]
47. Shiratori K, Ohgami K, Ilieva IB, Koyama Y, Yoshida K, and Ohno S. Inhibition of endotoxin-induced uveitis and potentiation of cyclooxygenase-2 protein expression by
-melanocyte-stimulating hormone. Invest Ophthalmol Vis Sci 45: 159164, 2004.
48. Siess W. Athero- and thrombogenic actions of lysophosphatidic acid and sphingosine-1-phosphate. Biochim Biophys Acta 1582: 204215, 2002.[Medline]
49. Solomon A, Dursun D, Liu Z, Xie Y, Macri A, and Pflugfelder SC. Pro- and anti-inflammatory forms of interleukin-1 in the tear fluid and conjunctiva of patients with dry-eye disease. Invest Ophthalmol Vis Sci 42: 22832292, 2001.
50. Song PI, Abraham TA, Park Y, Zivony AS, Harten B, Edelhauser HF, Ward SL, Armstrong CA, and Ansel JC. The expression of functional LPS receptor proteins CD14 and toll-like receptor 4 in human corneal cells. Invest Ophthalmol Vis Sci 42: 286777, 2001.
51. Stadnyk AW. Cytokine production by epithelial cells. FASEB J 8: 10411047, 1994.[Abstract]
52. Svoboda KK, Orlow DL, Chu CL, and Reenstra WR. ECM-stimulated actin bundle formation in embryonic corneal epithelia is tyrosine phosphorylation dependent. Anat Rec 254: 348359, 1999.[CrossRef][Medline]
53. Tishler M, Yaron I, Geyer O, Shirazi I, Naftaliev E, and Yaron M. Elevated tear interleukin-6 levels in patients with Sjogren syndrome. Ophthalmology 105: 23272329, 1998.[CrossRef][Web of Science][Medline]
54. Wallert MA, Thronson HL, Korpi NL, Olmschenk SM, McCoy AC, Funfar MR, and Provost JJ. Two G protein-coupled receptors activate Na+/H+ exchanger isoform 1 in Chinese hamster lung fibroblasts through an ERK-dependent pathway. Cell Signal 17: 231242, 2005.[CrossRef][Web of Science][Medline]
55. Wang DA, Du H, Jaggar JH, Brindley DN, Tigyi GJ, and Watsky MA. Injury-elicited differential transcriptional regulation of phospholipid growth factor receptors in the cornea. Am J Physiol Cell Physiol 283: C1646C1654, 2002.
56. Wang J, Carbone LD, and Watsky MA. Receptor-mediated activation of a Cl current by LPA and S1P in cultured corneal keratocytes. Invest Ophthalmol Vis Sci 43: 32023208, 2002.
57. Watsky MA, Griffith M, Wang DA, and Tigyi GJ. Phospolipid growth factors and corneal wound healing. Ann NY Acad Sci 905: 142158, 2000.[Web of Science][Medline]
58. Watson SP, McConnell RT, and Lapetina EG. Decanoyl lysophosphatidic acid induces platelet aggregation through an extracellular action. Evidence against a second messenger role for lysophosphatidic acid. Biochem J 232: 6166, 1985.[Web of Science][Medline]
59. Xie Y, Gibbs TC, and Meier KE. Lysophosphatidic acid as an autocrine and paracrine mediator. Biochim Biophys Acta 1582: 270281, 2002.[Medline]
60. Xie Y, Gibbs TC, Mukhin YV, and Meier KE. Role for 18:1 lysophosphatidic acid as an autocrine mediator in prostate cancer cells. J Biol Chem 277: 3251632526, 2002.
61. Xie Y and Meier KE. Assays for phospholipase D metabolites in mammalian cells. Methods Enzymol 344: 294305, 2001.
62. Yamada T, Sato K, Komachi M, Malchinkhuu E, Tobo M, Kimura T, Kuwabara A, Yanagita Y, Ikey T, Tanahashi Y, Ogawa T, Ohwada S, Morishita Y, Ohta H, Im DS, Tamoto K, Tomura H, and Okajima F. Lysophosphatidic acid (LPA) in malignant ascites stimulates motility of human pancreatic cancer cells through LPA1. J Biol Chem 279: 64966605, 2004.
63. Ye X, Ishii I, Kingsbury MA, and Chun J. Lysophosphatidic acid as a novel cell survival/apoptotic factor. Biochim Biophys Acta 1585: 108113, 2002.[Medline]
64. Zhou D, Luini W, Bernasconi S, Diomede L, Salmona M, Mantovani A, and Sozzani S. Phosphatidic acid and lysophosphatidic acid induce haptotactic migration of human monocytes. J Biol Chem 270: 2554925556, 1995.
This article has been cited by other articles:
![]() |
A. J. Snider, Z. Zhang, Y. Xie, and K. E. Meier Epidermal growth factor increases lysophosphatidic acid production in human ovarian cancer cells: roles for phospholipase D2 and receptor transactivation Am J Physiol Cell Physiol, January 1, 2010; 298(1): C163 - C170. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Kassel, P. R. Dodmane, N. A. Schulte, and M. L. Toews Lysophosphatidic Acid Induces Rapid and Sustained Decreases in Epidermal Growth Factor Receptor Binding via Different Signaling Pathways in BEAS-2B Airway Epithelial Cells J. Pharmacol. Exp. Ther., June 1, 2008; 325(3): 809 - 817. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-P. Xu, J. Yin, and F.-S. X. Yu Lysophosphatidic Acid Promoting Corneal Epithelial Wound Healing by Transactivation of Epidermal Growth Factor Receptor Invest. Ophthalmol. Vis. Sci., February 1, 2007; 48(2): 636 - 643. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |