Am J Physiol Cell Physiol  AJP: Regulatory, Integrative and Comparative Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 291: C589-C599, 2006. First published May 3, 2006; doi:10.1152/ajpcell.00623.2005
0363-6143/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/4/C589    most recent
00623.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Berfield, A. K.
Right arrow Articles by Abrass, C. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Berfield, A. K.
Right arrow Articles by Abrass, C. K.

EXTRACELLULAR MATRIX, CELL INTERACTIONS

Rat glomerular mesangial cells require laminin-9 to migrate in response to insulin-like growth factor binding protein-5

Anne K. Berfield,1 Kim M. Hansen,1 and Christine K. Abrass2

1Department of Medicine, School of Medicine, University of Washington; and 2Veterans Affairs Puget Sound Health Care System, Seattle, Washington

Submitted 13 December 2005 ; accepted in final form 25 April 2006


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Temporal and spatial differences in extracellular matrix play critical roles in cell proliferation, differentiation and migration. Different migratory stimuli use different substrates and receptors to achieve cell migration. To understand the mechanism of insulin-like growth factor binding protein-5 (IGFBP-5)-induced migration in mesangial cells, the roles of integrins and substrates were examined. IGFBP-5 induced an increase in mRNA expression for laminin (LN) chains lama4, lamb2, and lamc1, suggesting that LN-9 might be required for migration. Antibodies to the LN{alpha}4 and LNbeta2 chains, but not LNbeta1, blocked IGFBP-5-induced migration. Anti-sense morpholino oligonucleotide inhibition of expression of LN{alpha}4 substantially reduced expression of LN-8/9 ({alpha}4beta1{gamma}1/{alpha}4beta2{gamma}1, 411/421) and prevented IGFBP-5-induced migration. Anti-sense inhibition of lamb2 reduced expression of LN-9. Absence of LN-9 prevented IGFBP-5-induced migration, which was not preserved by continued expression of LN-8. The requirement for LN-9 was further supported by studies of T98G cells, which express predominantly LN-8. IGFBP-5 had little effect on migration in these cells, but increased migration when T98G cells were plated on LN-8/9. IGFBP-5-mediated mesangial cell migration was inhibited by antibodies that block attachment to {alpha}6beta1-integrins but was unaffected by antibodies and disintegrins that block binding to other integrins. Furthermore, in cells with anti-sense inhibited expression of LN-9, integrin {alpha}6beta1 was no longer detected on the cell surface. These studies suggest the specificity of mechanisms of migration induced by specific stimuli and for the first time demonstrate a unique function for LN-9 in mediating IGFBP-5-induced migration.

migration; integrins; extracellular matrix


CELL MIGRATION plays a critical role during development, wound healing, and in response to injury. There is growing evidence that different migratory stimuli utilize specific matrix substrates, integrins, and signal transduction cascades (18, 58). In vivo, this specificity provides migration of particular cells to the location where they are required. Growth factors and other migratory stimuli often require matrix binding to transduce their effects on cells (18). Matrix-bound growth factors interact with their receptors to modulate membrane incorporation and inside-out signaling of integrins, which activates integrins and enhances matrix attachment. Platelet-derived growth factor (PDGF) binding to laminin-5 (LN{alpha}3beta3{gamma}2, LN-332) (6) is one of the best-studied examples (41). Prevention of matrix binding reduces the response to PDGF. Insulin-like growth factor (IGF)-1 modulates surface expression of integrins and binding to different beta1-integrin isoforms, which in turn influences attachment to LN. In Chinese hamster ovary and PC3 cells, IGF-1 increases adhesion to LN via integrin beta1C, which can inhibit cell proliferation. In contrast, binding of integrin beta1A to other matrix proteins enhances migration and proliferation (24). The mechanisms whereby IGF-1 induces migration differ in different cell types. In vascular smooth muscle cells (34), and the related glomerular mesangial cells (7), IGF-1 induces migration via {alpha}vbeta3 binding to fibronectin. Insulin-like growth factor binding protein (IGFBP)-5 is one of the IGFBPs with the capacity to modify cellular responses to IGF-1, but it also has direct effects on cells that are independent of IGF-1 and are influenced by binding to LN (54, 59). Changes in expression of IGFBP-5 occur with cancer and have been postulated to influence the risk for progression; however, the mechanism by which IGFBP-5 influences tumor invasion remains unknown (11, 23). Expression of IGFBP-5 temporally correlates with mesangial cell (MC) development during nephrogenesis and alterations in IGFBP-5 expression have been postulated to contribute to progression of diabetic nephropathy through increased matrix accumulation (9, 53). We have previously shown that IGFBP-5 stimulates MC migration and that this response differs from that induced by IGF-1, as the {alpha}vbeta3-integrin is not required. The present studies were undertaken to better define the requirements for IGFBP-5-induced migration.

The glomerular MC is a smooth muscle-like pericyte that provides structural support for endothelial cells and podocytes that make up the glomerular tuft. MC migration is critical during nephrogenesis when mesangial progenitors migrate into the vascular cleft of the developing glomerulus (5). In models of mesangiolysis, the mesangium is repopulated and repaired by MCs that migrate in from the extraglomerular mesangium (32). In other glomerular diseases, MCs migrate into the subendothelial space causing mesangial interposition (44). Little is known about the mechanisms that regulate MC migration in each of these circumstances. We have previously shown that MCs express predominantly LN-8/9 ({alpha}4beta1{gamma}1/{alpha}4beta2{gamma}1, 411/421) in vitro and in vivo (28, 29), and that MC migration on specific matrix substrates is influenced by the migratory stimulus (1, 7, 29). IGFBP-5 stimulates MC migration using a unique phenotype that is mimicked by plating MC on LN-8/9 (7). The present studies were conducted to further explore the role of LN isoforms in IGFBP-5-mediated migration.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Reagents and antibodies. The following reagents were obtained from the designated suppliers. IGFBP-5 peptide (AA201–218, RKGFYKRKQCPKSRGRKR) (Fred Hutchinson Cancer Research Center, Seattle, WA), kistrin, mouse anti-chicken beta1-integrin (Sigma, St. Louis, MO), mouse anti-{alpha}6beta1-integrin (Chemicon, Temecula, CA), mouse anti-human {alpha}6-integrin with blocking activity (Abcam, Cambridge, UK), a nonblocking mouse anti-human {alpha}6-integrin, mouse anti-rat {alpha}3-integrin and goat anti-human LN{alpha}4 (V20) (Santa Cruz Biotechnology, Santa Cruz, CA), mouse anti-collagen IV (Becton Dickinson, Bedford, MA), peroxidase-conjugated goat anti-rabbit IgG (Pierce, Rockford, IL) and Alexa Fluor secondary antibodies to mouse and rabbit IgG (Molecular Probes, Eugene, OR). Polyclonal rabbit antibodies to fibronectin, LN-1, LN{alpha}4, LNbeta1, and LNbeta2 were generated as previously described (2, 28, 29). Mouse anti-rabbit {alpha}-dystroglycan clone 11H6 was a gift from Dr. K. Campbell (Howard Hughes Medical Institute, University of Iowa, Iowa City, IA).

Cell culture. Rat glomerular MC were prepared by modification (3, 4) of routine methods (39). In brief, minced rat kidney cortex was sieved. Isolated glomeruli were plated in medium containing a 1:1 mix of 20% FCS-RPMI 1640 and previously collected glomerular conditioned medium. Insulin routinely added to supplement MC cultures was omitted. MC outgrowths were harvested and passed in this medium for an additional week, after which the conditioned medium was omitted. MC were cloned and studied at passages 812. TG98 cells, a human glioblastoma cell line, was obtained from ATCC (Manassas, VA) and grown as described previously (20). These cells synthesize predominantly LN-8 with little LN-9 (20).

Cell migration. MC migration was measured with and without IGFBP-5201–218 (30 µg/ml) in a wounding assay as described previously (8). In brief, MCs were plated in 60-mm tissue culture dishes, grown to near confluence, growth arrested in 2% FCS-RPMI, and scraped with a sterile razor blade to create a linear wound across the dish. IGFBP-5201–218 peptide was added to the cultures and migration was examined 48 h later. Controls were maintained in 2% FCS-RPMI medium. Cultures were stained with toluidine blue and migrating cells along 1-mm length of the wound edge were counted in 0.1-mm increments. Five areas were examined per sample. Experiments were repeated three times. Data were analyzed as the total number of migrating cells and were expressed as a percentage of control. Individual control samples are also divided by the average for all controls and expressed as a percentage of control. A standard deviation for these results is calculated and shown in the graph to indicate the variability of repeat control experiments, as well as the experimental conditions. To test the role of specific LN isoforms, MCs previously treated with morpholino oligonucleotides as described below were used. To test the requirements for specific cell-matrix attachments, blocking antibodies were added at a 1:200 dilution with or without IGFBP-5. Normal serum or antibodies preabsorbed with specific substrate served as controls. The inhibitor kistrin was used at 10 nM.

To examine the role of LN isoforms in migration, T98G cells or MC were plated and grown to confluence. Cells were lysed with 20 mM NH4OH and washed away, leaving the matrix previously secreted by the cells. In separate experiments this matrix was solubilized and analyzed by Western blotting (40), confirming that the plate was coated with LN-8 by T98G cells or LN-8/9 by MC. T98G cells were then plated on these substrates at confluence and assayed for migration with and without IGFBP-5 as described above.

Morpholino anti-sense inhibition of protein expression. Both lissamine-labeled and unlabeled anti-sense morpholino oligonucleotides for LN{alpha}4 (A4AS), LNbeta2 (B2AS), and several sense control oligonucleotides (StdC, A4S, B1S) were prepared by the manufacturer's instructions (Gene Tools, Philomath, OR) (36). The sequences used were as follows: LAMA4AS: 5'-AGCACCAGGCTCTGTTCCAAGCCAT; LAMB2AS: 5'-CACTCCATCCGTGTGGGTACTGGGC, StdC: 5'-CCTCTTACCTCAGTTACAATTTATA, LAMA4S: 5'-ATGGCTTGGAACACAGCCTGGTGCT, and LAMB1S: 5'-TGGGAGCGGCAGGAAATGGAAAGGC. The LNbeta2 was derived from the published rat sequence (GenBank accession no. X16563). Rat sequences for LN{alpha}4 and beta1 were generated by RT-PCR from rat MC RNA and primers derived from mouse sequences as follows: LN{alpha}4 (U69176 [GenBank] ) sense 5' GGGAGACCGGAGACAAAGTGAG, anti-sense 5' ACGCTGCGTTGGAGCAGACA and LNbeta1 (M15525 [GenBank] ) sense 5'CGTGGGAGCGGCAGGAAAT, antisense 5' AAGGAGGACGCAGCAGGCAAG. The resulting products were sequenced by Dyedeoxy sequencing (Applied Biosystems, Foster City, CA). These sequences were used to design the anti-sense oligonucleotides. MC were plated in growth media at 200,000 cells per well in 24-well plates. Anti-sense and sense control morpholino oligonucelotides were administered using ethoxylated polyethylenimine according to the manufacturer's instructions. To test the effects of morpholino anti-sense inhibition, cell counts were performed in triplicate 24, 48, and 72 h after treatment. Total RNA was extracted 72 h after treatment for use in RT-PCR to examine LN chain mRNA expression. Protein expression was assessed by immunofluorescence microscopy and Western blot analysis. For use in immunofluorescence studies, cells were treated with lissamine-labeled oligonucleotides, trypsinized after treatment, plated in growth medium overnight, and then maintained in 2% FCS-RPMI 1640 medium for 48 h before fixation with 2% paraformaldehyde. For use in Western blots, cell layers were extracted at 72 h after treatment in PBS containing 0.1% Triton X-100, 0.025 M EDTA, 0.1 M N-ethylmalimide, 2 mM PMSF, and 0.02 mg/ml pepstatin A. For migration studies, cells were growth arrested for 24 h in 2% FCS-RPMI 1640 before treatment with morpholino oligonucleotides.

Immunofluorescence and light microscopy. Slides were stained with antibodies to LN{alpha}4, LNbeta1, LNbeta2, the beta1-integrin chain, or the {alpha}6beta1-integrin, followed by Alexa Fluor 488-labeled secondary antibodies as described previously (2). Slides were viewed using a Leitz microscope equipped for epi-illumination, and photographed using a digital RT-Color Spot camera. Migrating MC were fixed in 2% paraformaldehyde, stained with toluidine blue, and photographed with a Polaroid Land camera on a Leitz inverted microscope.

Western blot analysis. Extracts of morpholino oligonucleotide-treated cell layers were normalized by cell number and cleared by centrifugation. Equal volume aliquots were immunoprecipitated with anti-LN-1 antibodies. The resulting immune complex was washed with 3% polyethylene glycol (MW 8,000) in borate buffer. The LN immune complexes were separated by SDS-PAGE and transferred to nitrocellulose. The membranes were incubated with anti-LN{alpha}4 and anti-LNbeta2 antibodies, followed by peroxidase-conjugated anti-rabbit IgG antibodies. Blots were developed with SuperSignal West Pico chemiluminescence substrate (Pierce) and exposed onto X-Omat film. The expression level of LN was quantified using an EDAS camera system and 1D software (Eastman Kodak, Rochester, NY). Proteins were extracted from secreted matrix of MC and T98G cells and analyzed by Western blot analysis using antibodies to LN subunits as described above.

RT-PCR. Total RNA (0.5 µg) was prepared using RNace Total Pure kit (Bioline, Kenilworth, NJ) was used per RT-PCR reaction. An aliquot of the resulting cDNA generated for each condition was used for amplification of LN{alpha}4, LN{alpha}5, LNbeta1, LNbeta2, and GAPDH. The primers were as follows: LN{alpha}4 (mouse sequence, GenBank accession no. U69176) sense 5'-TGGTCAGGTGACTCGCTTTG, anti-sense 5'-GCTCTTAACGTGCCGTCTGT; LN{alpha}5 (mouse sequence, GenBank accession no. U37501) sense 5'-GCTGCGTACACTGCCCTCAAGT, anti-sense 5'-GATGCTGACGGCTGCAAACTGC; LNbeta1 (rat sequence generated in our laboratory) sense 5'TTCCAGTCGCACCAGTTCTT, anti-sense 5'-GTCAGCAGATGCCAGGAGGA; LNbeta2 (rat sequence, GenBank accession no. X16563) sense 5'-GTGGCAGTCGGAGAACGGTGTT, anti-sense 5'-CAGCGGGATTCCTGGGAAGTCA, and GAPDH sense 5'-ACCACAGTCCATGCCATCAC, anti-sense 5'-TCCACCACCCTGTTGCTGTA (Clontech, Palo Alto, CA). Amplification was preformed using HotStarTaq (Qiagen, Valencia, CA), and the amplification cycles were limited to ensure that the resulting products remained within the linear detection range. The expression level of LN and GAPDH mRNA was quantified with the use of a Kodak EDAS camera system and 1D software. The identity of the products was confirmed by Dyedeoxy sequencing (Applied Biosystems). To demonstrate that IGFBP-5 induced a change in LN mRNA expression, real-time PCR was performed on a multiplex quantitative PCR system (model Mx4000, Stratagene, La Jolla, CA) using the following primers: LN{alpha}4 (AAGAAACCTTAGGAGTTGGTTATGGA, ATAAAACTTTGCCCGTTGAAATATG and 6FAM-CCAGAGGACTCCCTGATCTCTCGCAG-BHQ1), LNbeta2 (TaqMan Gene Expression Assay; Applied Biosystems), LN{gamma}1 (ATGACATCTCCTCGACCTTTCAG, GCCTCCGAGCCATCTCTCT, and 6FAM-CACACGCCACCCGTCCTCATCA-BHQ1), GAPDH (CGGCCTCGTCTCATAGACAAG, ACCAGGCGGCCAATACG and HEX-AAATCCGTTGACACCGACCTTCACCA-BHQ1).

Statistical analysis. Group means were compared using one-way ANOVA with subgroup testing by contrasts. A value of P < 0.05 was considered significant.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
IGFBP-5 induces increased mRNA expression for LN{alpha}4, LNbeta2, and LN{gamma}1. Rat glomerular MC synthesize collagen IV, fibronectin, thrombospondin, LN-8 ({alpha}4beta1{gamma}1, 411) and LN-9 ({alpha}4beta2{gamma}1, 421), and small amounts of LN-2 ({alpha}2beta1{gamma}1, 211) and LN-10/11 ({alpha}5beta1{gamma}1/{alpha}5beta2{gamma}1, 511/521) (3, 4, 28). Total RNA was isolated from untreated or IGFBP-5-treated MC and subjected to real-time PCR analysis of mRNA expression for LN{alpha}4, LNbeta2, and LN{gamma}1. As shown in Fig. 1, IGFBP-5 induced a twofold increase in expression of mRNA for subunits that compose LN-9. Because prior studies had shown no effect on other LN subunits (LN{alpha}2, LN{alpha}5, and LNbeta1, data not shown), the effect appears to be specific for LN-9. Although this change in mRNA expression does not establish that newly synthesized LN-9 is required for IGFBP-5-induced migration, it suggested that this LN isoform might mediate migration in these cells.


Figure 1
View larger version (6K):
[in this window]
[in a new window]
 
Fig. 1. Real-time PCR. Total RNA isolated from mesangial cells (MC) without or with 2 and 6 h of treatment with IGF binding protein (IGFBP)-5 was analyzed by real-time PCR using probe primer sets specific for laminin (LN){alpha}4, LNbeta2, and LN{gamma}1. Results are expressed as a ratio of mRNA for GAPDH. Samples were run in triplicate (n = 3, ANOVA, P < 0.05).

 
IGFBP-5-treated MC utilize LN to migrate. IGFBP-5 induces MC to migrate using a unique phenotype that does not require attachment to fibronectin via {alpha}vbeta3-integrins (7). Because data described above show that IGFBP-5 induced increased mRNA expression for LN-9, we examined the role of LN in mediating migration induced by IGFBP-5. Migration induced by IGFBP-5 was partially retarded when polyclonal antibody to LN-1 was added (Fig. 2). Cultured rat glomerular MC do not synthesize the LN{alpha}1 chain (28); however, inhibition of migration by antibodies to LN-1 ({alpha}1beta1{gamma}1, 111) that bind to beta1 and {gamma}1 chains suggests that LN isoforms synthesized by MC might be important. This was substantiated by antibodies to the globular domain of the LN{alpha}4 chain, which significantly inhibited IGFBP-5-mediated migration. Preimmune serum or antibodies to the globular domains of LN{alpha}2 and LN{alpha}5 had no effect (data not shown). These data suggest that {alpha}4-containing isoforms support a migratory phenotype and that IGFBP-5-induced MC migration requires attachment to the {alpha}4 chain of LN-8/9. Because this antibody is specific to the LG4–5 domain, it suggests that the unprocessed carboxy-terminus of the LN{alpha}4 subunit interacts with the cell. Disruption of a single type of cell-matrix attachment, in this case mediated by LN{alpha}4, is not sufficient to detach cells, thus reduced migration does not merely represent detachment form the substrate. Furthermore, antibodies that inhibit IGFBP-5-mediated migration have no impact on IGF-1-dependent migration (data not shown), indicting that the cells are still able to migrate using other matrix attachment sites. These data indicate that migration induced by IGFBP-5 is similar to that induced by PDGF (29), and further characterizes the ways in which it differs from IGF-1 (9).


Figure 2
View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2. IGFBP-5-mediated MC migration utilizes LN. Migration of MC with (+BP-5) and without (untreated) IGFBP-5 is compared with (+) and without (–) the addition of designated antibodies. The results are expressed as a percentage of the untreated control. IGFBP-5-induced MC migration is inhibited by antibodies to LN-1 ({alpha}1beta1{gamma}1) and the LN{alpha}4 chain.

 
IGFBP-5-treated MC require the LN chain beta2 to migrate. The role of LN-8 and LN-9 in cell migration has received considerable attention recently because of their contribution to the invasiveness of cancer cells (42) and angiogenesis (15). Although regions in the globular domain of LN {alpha}4-chain that bind to integrins, dystroglycan, and heparin have been defined (52, 64, 65), little is known about the functional differences between LN isoforms with substituted beta-chains. Endothelial cells migrate on LN-8 using {alpha}3beta1-, {alpha}6beta1-, and {alpha}vbeta3-integrins (26); yet, specific integrin interactions with LN-9 have not been reported previously. In prior studies, we showed that MCs treated with IGFBP-5 develop a phenotype that mimics MC plated on an LNbeta2 peptide (28); thus we postulated that IGFBP-5-mediated migration might require LN-9. The following experiments were performed to distinguish between these roles of LN-8 and LN-9. As shown in Fig. 3, antibodies to LNbeta1 enhance basal MC migration after wounding and do not block migration induced by IGFBP-5. Conversely, antibodies to the LRE domain of LNbeta2 (which supports MC attachment; see Ref. 28) inhibit migration induced by IGFBP-5. These observations suggest that attachment to LN-9 is required for IGFBP-5-mediated migration. Also, the finding that inhibition of attachment to LN-8 facilitates basal migration suggests that attachments to LN-8 may be severed as attachments to LN-9 are formed during IGFBP-5-mediated migration.


Figure 3
View larger version (12K):
[in this window]
[in a new window]
 
Fig. 3. LNbeta chain usage in IGFBP-5-induced MC migration. Migration of MC with (+BP-5) and without (untreated) IGFBP-5 was examined with (+) or without (–) antibodies to LNbeta1 and LNbeta2 chains. The results are expressed as a percentage of untreated MC. Treatment with antibodies to LNbeta1 was associated with an increase in the migration of untreated MC after wounding and had no affect on the increase associated with IGFBP-5. In contrast, antibodies to LNbeta2 inhibited the migration induced by IGFBP-5.

 
MC with decreased expression of LN{alpha}4 or LNbeta2 fail to migrate in response to IGFBP-5. To further define the role of LN in IGFBP-5-mediated migration, LN{alpha}4 and LNbeta2 expression in MC were specifically inhibited by the use of anti-sense morpholino oligonucleotides (36). Inhibition of expression of the LN{alpha}4 chain was expected to reduce synthesis of both LN-8 and LN-9. Inhibition of LNbeta2 was expected to reduce expression of LN-9 while preserving expression of LN-8. As shown in Fig. 4A, MC treated with anti-sense morpholino oligonucleotides had cell counts that were slightly reduced compared with sense-treated controls; yet all cells continued to proliferate, which suggests that there was no significant toxicity from treatment with the morpholino oligonucleotides at doses used in these experiments. To confirm that anti-sense treatment knocked down expression of LN chains, matrix proteins were extracted and subjected to Western blot analysis. As shown in Fig. 4B, treatment with anti-sense morpholino oligonucleotides for LN{alpha}4 decreased LN{alpha}4 expression, indicating a loss of synthesis of both LN-8 and LN-9. The anti-sense morpholino for LNbeta2 reduced expression of LNbeta2, consistent with loss of LN-9, as well as other LNbeta2-containing isoforms. To further evaluate the affect of anti-sense inhibition on LN chain expression, total RNA was isolated and mRNA levels were analyzed by RT-PCR. As shown in Fig. 4C, mRNA expression was unaffected for the chain targeted by the anti-sense treatment, as morpholinos reduce translation, but had no effect on transcription (36). There were no compensatory changes in expression of LN{alpha}4, LN{alpha}5, LNbeta1, or LNbeta2 mRNA with any of the anti-sense treatments; thus it is unlikely that alterations in other LN isoforms influenced the effects on MC migration (see below). Immunofluorescence microscopy (Fig. 4D) shows loss of expression of the appropriate LN chain in cells treated with anti-sense morpholino oligonucleotides. In those with suppression of LNbeta2, the detection of abundant LNbeta1 and LN{alpha}4 indicates continued expression of LN-8 in these cells. This specificity of suppression of LN-9 allowed us to test the effects of loss of LN-9 with continued expression of LN-8. Suppression of LN{alpha}4 results in a reduction in total laminin (Figs. 4D and 5). This was not surprising because LN{alpha}4 is the predominant LN{alpha} chain expressed by these cells and reduction in {alpha} chain expression results in the loss of the heterotrimer. This reduction in total laminin is further illustrated in Fig. 5. Anti-sense treatment results in a significant reduction in laminin by both immunofluorescence microscopy and Western blot as detected by anti-LN-1 antibodies. These cultures were also stained with antibodies to collagen IV (data not shown) and fibronectin (Fig. 5). A fibrillar ECM containing these proteins was detected in anti-sense-treated cells, which was identical in appearance to normal cultures. This suggests that loss of LN-8/9 or LN-9 did not disrupt expression and assembly of other ECM proteins.


Figure 4
View larger version (40K):
[in this window]
[in a new window]
 
Fig. 4. MC treated with anti-sense morpholino oligonucleotides. A: cell counts in cultures treated with morpholino oligonucleotides. Cells were counted at the designated times following treatment with the morpholino oligonucleotides; sense control (solid bars); LNbeta2 anti-sense, open bars; LN{alpha}4 anti-sense (hatched bars). Inhibition of synthesis of LN{alpha}4 or beta2 was associated with a 12–15% reduction in cell number compared with sense-treated controls (ANOVA, P < 0.05). B: LN protein expression by Western blot analysis of MC extracts from sense control and anti-sense-treated-MC. LNbeta2 anti-sense-treated MC (lane 2) showed nearly complete loss of the LNbeta2 chain compared with the sense control (lane 1). LN{alpha}4 anti-sense treatment (lane 4) showed significant reduction in LN{alpha}4 protein compared with the sense-treated control (lane 3). C: LN mRNA expression. mRNA expression for LNbeta1, LNbeta2, LN{alpha}4, and LN{alpha}5 were analyzed by RT-PCR and compared with GAPDH (GPDH). Sense control-treated MC (lane 1), anti-sense for LNbeta2 (lane 2), anti-sense for LN{alpha}4 (lane 3). There were no differences in the mRNA expression for either chain in cells treated with anti-sense morpholino oligonucleotides to LNbeta2 or LN{alpha}4. D: immunofluorescence microscopy for LNbeta1, beta2, and {alpha}4. MC untreated (A, F, K) or treated with anti-sense oligonucleotides for LNbeta2 (B, C, G, H, L, M) or anti-sense for LN{alpha}4 (D, E, I, J, N, O) were stained with antibodies to LNbeta2 (AE); LNbeta1 (FJ), or LN{alpha}4 (KO), followed by a secondary antibody to rabbit IgG (green). Lissamine-labeled morpholino oligonucleotides are shown in red. Note the loss of staining for LNbeta2 and preserved staining for LNbeta1 and LN{alpha}4 in LNbeta2 knock-down cells. LN{alpha}4 anti-sense treatment resulted in loss of staining for LN{alpha}4, as well as a reduction in both LNbeta1 and LNbeta2 indicating a significant reduction in total LN.

 

Figure 5
View larger version (65K):
[in this window]
[in a new window]
 
Fig. 5. Fibronectin and LN expression in control, LN{alpha}4, and LNbeta2 knock-down cells. Control (A and D), LNbeta2 anti-sense (B and E), and LN{alpha}4 anti-sense (C and F) cells were stained with antibody to fibronectin (FN) (AC) or laminin-1 (LN-1) (DF) (green). Lissamine-labeled morpholino oligonucleotides are shown in red. Note the fibrillar extracellular assembly of both fibronectin and laminin in control and anti-sense-treated cells. Although the pattern of staining is unaffected by anti-sense treatment, the amount of laminin is significantly reduced compared with fibronectin. This is confirmed by Western blot analysis. (1, control; 2, LNbeta2 anti-sense; 3, LN{alpha}4 anti-sense).

 
Having confirmed that the use of anti-sense morpholino oligonucleotides for LN{alpha}4 and LNbeta2 could specifically reduce expression of LN-8/9 and LN-9, respectively, we tested sense control and anti-sense-treated MC for their ability to migrate in response to IGFBP-5. By 48 h after creating a wound edge, sense control-treated MC migrated into and nearly filled the wound (Fig. 6A). In contrast, neither LN{alpha}4 nor LNbeta2 anti-sense-treated MCs, filled in the wound area after treatment with IGFBP-5. When migrating cells were counted as described above, it confirmed that migration of cells that failed to express LN-9 was significantly reduced in response to IGFBP-5 (Fig. 6B). Because the LNbeta2 anti-sense cells continued to express LN-8, it implies that this LN isoform could not substitute for LN-9 in the migratory response to IGFBP-5. These cells were still able to migrate in response to IGF-1, a finding that was expected based on our previous studies (data not shown) (7, 9).


Figure 6
View larger version (71K):
[in this window]
[in a new window]
 
Fig. 6. MC migration in LNbeta2 and LN{alpha}4 knock-down MC. A: MC migration in LNbeta2 and LN{alpha}4 knock-down MC. Light micrographs of MC migration induced by IGFBP-5 in sense-treated control MC, LNbeta2 anti-sense-treated MC and LN{alpha}4 anti-sense-treated MC. B: IGFBP-5-induced MC migration in morpholino oligonucleotides-treated MC. MC migration with (+BP-5, open bars) and without (untreated, solid bars) IGFBP-5 was examined in control, sense oligonucleotides, LNbeta2 and LN{alpha}4 anti-sense-treated MC. Results were expressed as a percentage of the untreated control (ANOVA, P < 0.05).

 
Migration of T98G cells in response to IGFBP-5. T98G cells are known to express predominately LN-8 and little or no LN-9 (20). To further test the role of LN-9 in IGFBP-5-mediated migration, T98G cells were plated on LN-8 or LN-8/9 and examined for their migratory response to IGFBP-5. As shown in Fig. 7, T98G cell migration was enhanced in cells plated on LN-8/9 in response to IGFBP-5 compared with those plated on LN-8 alone. These studies complement those described above in MC and further support the preference for LN-9 in IGFBP-5-induced migration.


Figure 7
View larger version (11K):
[in this window]
[in a new window]
 
Fig. 7. Migration in T98G Cells. Migration of T98G cells with (open bars) and without (solid bars) IGFBP-5 was examined using T98G cells plated on LN-8 (derived from T98G cells) or LN-8/9 (derived from mesangial cells). Results were expressed as a percentage of untreated control (ANOVA, P < 0.05).

 
Integrin requirements for migration on LN-9. In prior studies, we demonstrated that IGF-1 induced MC to migrate using {alpha}vbeta3 bound to fibronectin and that this integrin-matrix pair was not involved in migration induced by IGFBP-5 (9). To define the integrin required for IGFBP-5-induced migration, attachments to known matrix receptors were examined including integrins beta1-, {alpha}6beta1-, {alpha}vbeta3-, {alpha}3beta1-, and {alpha}-dystroglycan. As shown in Fig. 8, blocking antibodies to beta1-integrins completely blocked IGFBP-5-mediated migration, whereas preimmune serum had no affect. Antibodies to the {alpha}6-integrin also blocked IGFBP-5-induced migration. To confirm the specificity of this result, a nonblocking antibody to the {alpha}6-integrin chain and a blocking antibody to the {alpha}3-integrin, were examined, and neither antibody affected migration. In keeping with previously published data (9), kistrin, a disintegrin that blocks the {alpha}vbeta3-integrin, had no effect on IGFBP-5-induced MC migration. In addition to integrins, LN binds to nonintegrin receptors including {alpha}-dystroglycan (61). Blocking antibodies to {alpha}-dystroglycan had no affect on IGFBP-5-induced migration. These data suggest that the integrin that mediates IGFBP-5-induced migration is {alpha}6beta1. As the primary ligand for {alpha}6beta1 is LN, these studies are consistent with those described above showing the requirement for LN-9.


Figure 8
View larger version (17K):
[in this window]
[in a new window]
 
Fig. 8. Integrin requirements for IGFBP-5-induced MC migration. MC migration with (+BP-5, open bars) and without (untreated, solid bars) IGFBP-5 was examined with or without integrin blocking antibodies or kistrin. Antibodies include anti-beta1 integrin (int beta1), blocking anti-{alpha}6 integrin (int {alpha}6b), nonblocking anti-{alpha}6 integrin (int {alpha}6n), kistrin (disintegrin for {alpha}vbeta3), anti-{alpha}3 integrin (int {alpha}3), and {alpha}-dystroglycan (DG). Only antibodies to the beta1-integrin chain and {alpha}6 significantly blocked IGFBP5-induced migration (ANOVA; P < 0.05).

 
Inhibition of LN-9 expression is associated with absence of surface expression of {alpha}6beta1-integrins. As shown in Fig. 9, anti-sense inhibition of LN{alpha}4 or LNbeta2 was associated with absence of {alpha}6beta1 expression on the surface of those cells that contained the oligonucleotides. These observations suggest that LN-9 is the only LN that binds to this integrin in MC and further supports the role of integrin {alpha}6beta1 in IGFBP-5-mediated MC migration using LN-9. It is of note that staining only for the beta1-integrin chain is still detected, which indicates that beta1-integrins with other {alpha}6-chains are still expressed and engaged by other ligands. Several studies (30, 47) have shown that integrin expression, in cooperation with dystroglycan, is required for LN assembly on cell surfaces, yet Miner et al. (47) reported that basal expression of specific integrins was absent when their LN ligands were absent. Nothing is known about the role of LN-9 in mediating insertion of {alpha}6beta1 into the cell membrane. Because this integrin is normally expressed by MC, it suggests that LN-9 may be required for its expression.


Figure 9
View larger version (65K):
[in this window]
[in a new window]
 
Fig. 9. Surface expression of {alpha}6beta1- and beta1- integrins in MC with inhibited expression of LN{alpha}4 and LNbeta2. MC treated with lissamine-labeled anti-sense oligonucleotides (red) were stained with antibodies to {alpha}6beta1-integrin (top) or beta1-integrins (bottom), followed by a FITC-labeled secondary antibody (green). Note the presence of {alpha}6beta1- (A) (arrows) and beta1-integrins (B) (arrows) on the cell surface of cells with uptake of control oligonucleotides (red). Note that anti-sense inhibition of LN{alpha}4 expression is associated with normal surface staining for the beta1-integrin chain (E) (arrows), whereas no surface staining for {alpha}6beta1 is detected in those cells (B) (arrows). {alpha}6beta1-integrin staining is also absent in cells with anti-sense inhibition of LNbeta2 (C) (arrows). Continued surface integrin expression in adjacent cells lacking lissamine-labeled oligonucleotides (B and C, arrowheads) indicates that the loss of {alpha}6beta1-integrin expression is associated with loss of synthesis of LN-9.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We have previously shown that MCs migrate in response to IGF-1, PDGF, and IGFBP-5 (7, 9, 29). IGF-1 stimulates formation of a beta-actin-rich leading lamella that is associated with activation of Rac, and migration on fibronectin using {alpha}vbeta3-integrins (9, 34, 49). PDGF induces an elongated, bipolar phenotype and migration using a MC-derived LN containing the LN{alpha}4 chain and a beta1-integrin (29). In contrast, IGFBP-5-treated MC take on a spider-like morphology, a phenotype (7) that can be reproduced by plating on LN-8/9 (29) or the LRE peptide of the LNbeta2 subunit (28). IGFBP-5-mediated MC migration is characterized by filopodia formation and is associated with activation of cdc42 (7). Intact IGFBP-5 can modify IGF-1 actions; however, the carboxy-terminal fragment of IGFBP-5 (including the AA201–218 peptide) has effects that are independent of IGF-1 (1). Furthermore, when added to IGF-1, IGFBP-5201–218 augments MC migration (1). A similar phenomenon in vascular smooth muscle cells requires binding of IGFBP-5 to cell-surface proteoglycan (31). These observations suggest that different migratory stimuli utilize specific cell-matrix interactions and signal transduction pathways. In this study, we demonstrate that IGFBP-5-mediated migration in MC specifically utilizes LN-9 bound to {alpha}6beta1-integrins. Maneuvers that disrupt attachments to LN-8 enhance spontaneous migration after wounding and do not inhibit IGFBP-5-mediated migration. Because quiescent MCs are bound to both LN-8 and LN-9, these data suggest that cellular attachments to LN-8 are severed as new attachments to LN-9 are formed during IGFBP-5-mediated migration. Because IGFBP-5 induces an increase in expression of LN-9, new synthesis of this isoform might be required. Anti-sense inhibition of expression of LN-9 is associated with loss of integrin {alpha}6beta1 from the cell surface, which suggests that these processes might be linked. Future studies are required this confirm relationship.

The {alpha}4 chain of LN-8 and -9 has received considerable attention recently because of studies showing that it is important to angiogenesis and microvessel integrity (26, 62), as well as being responsible for proper alignment of axons and the motor end plate in the neuromuscular junction (55). Although blood vessels appear to form normally in the LN{alpha}4 null mutant mouse, LN{alpha}4 is required for maintenance of vessel integrity and protection from vessel injury (62). In part, this is due to impaired recruitment of pericytes, a process known to require PDGF (10). Our observations showing that both PDGF (29) and IGFBP-5, two migratory stimuli for the pericyte-like MC require LN{alpha}4, may explain the reduced number of pericytes in the LN{alpha}4-null mice (62). The potential importance of LN{alpha}4 to other vascular smooth muscle cells or pericytes has not been described previously.

Specific studies have attempted to define the relative roles of LN-8 and LN-9 in angiogenesis and tumor invasion. Glial tumors overexpress LN-8, particularly in blood vessels (42). This is in contrast to normal blood vessels that express predominantly LN-9. This difference was postulated to play a role in neovascularization and early tumor recurrence (42). Khazenzon et al. (36) have shown that in contrast to normal glial cells, glioblastoma cells stimulate endothelial cells to switch from expression of LN-9 to LN-8, and with that change in isoform, it promotes migration and glioblastoma invasion. When LN-8 expression is suppressed, there is less tumor invasion (36). Proliferating vessels and tumor invasion in vivo are associated with increased expression of {alpha}-dystroglycan, a receptor for LN-8. The factor responsible for a shift in expression from LN-9 to LN-8 in glioblastomas in not known, but modulation of IGFBP-5 expression, which can have tumor-promoting or inhibitory effects, may play a role (11). To our knowledge, our studies are the first showing a specific role for LN-9, which differs from LN-8-dependent migration characterized in endothelial cells (19), monocytes (56), and lymphocytes (22). As LN-9 inhibits migration of lymphocytes (22), regulated expression of this isoform within the mesangium may retard infiltration of inflammatory cells. Conversely, stimuli other than IGFBP-5, which enhance expression of LN-8, might be anticipated in various forms of glomerulonephritis.

LN exerts effects on cells by binding to integrins and other matrix receptors. In endothelial cells LN-8/9 codistributes with {alpha}vbeta3-, {alpha}6beta1-, and {alpha}3beta1-integrins, and inhibition of binding of the {alpha}4LG1–4 domain of LN-8 blocks angiogenesis (20, 26). Subsequent studies (38, 50) with purified proteins and reconstituted cells have shown that LN{alpha}4 binds only to {alpha}6beta1-integrin; yet subsequent cooperation with {alpha}vbeta3 induces branching morphogenesis (25). In our studies blocking antibodies to the {alpha}6 and beta1-integrin chains also blocked IGFBP-5-induced migration, which argues that the LN{alpha}4 chain is binding to this integrin. The absence of an effect with kistrin indicates that cooperation with {alpha}vbeta3 was not necessary in our system. Although other LN subunits expressed by MC can also bind to {alpha}6beta1-integrins, including LN{alpha}2 and LN{alpha}5, it is unlikely that they contribute to IGFBP-5-mediated MC migration. Attachment of MC to LN-2 and LN-10/11 induce a different phenotype than LN-9 (29) and antibodies to the globular domain of the LN{alpha}2 chain had no affect on IGFBP-5-mediated migration (data not shown). Furthermore, these LN isoforms continue to be expressed in the cells with anti-sense-inhibited LN{alpha}4 expression, yet they were unable to support IGFBP5-induced migration. Considerable data document interaction between the LN{alpha}-subunits and integrins, but these binding studies have not elucidated the mechanisms that distinguish the biological response to LN isoforms that contain the same {alpha} chain, but have substituted beta-chains. Our finding that MC lacking LN-9 did not express {alpha}6beta1 on their surface indicates shifts in LN isoform expression may in turn affect the integrins that are expressed and the consequent biological events that follow. Functional differences have been attributed to isoforms of {alpha}6 and beta1-integrin chains (13, 17, 24), yet it is unknown whether they have different binding specificities for LN-8 and LN-9. Additional studies are needed to further understand the molecular interactions between the LN-9 and {alpha}6beta1-integrin, as well as the isoform of {alpha}6beta1 that is involved.

In addition to binding to integrins, LN also binds to nonintegrin receptors, including dystroglycan (33). The extracellular domain of {alpha}-dystroglycan binds to LN-{alpha} chains, including {alpha}1, {alpha}2, {alpha}4, and {alpha}5; however, the affinity of binding for {alpha}4 is quite low (65). MCs express dystroglycan (16) (and unpublished data from our laboratory), yet the blocking antibody to dystroglycan had no affect on IGFBP-5-mediated migration. This suggests that even if LN-8/9 is bound to dystroglycan in quiescent MC, this attachment is not required for migration on LN-9. Recent studies have shown that LN{alpha}4 binds to syndecan-4 (14, 45, 52) and that IGFBP-5-mediated migration that is independent of IGF-1 requires attachment of IGFBP-5 to a cell-surface proteoglycan (31). Additional studies are needed to explore the role of syndecan-4 in mediating MC migration and attachments to LN. Differences in engagement of matrix receptors in addition to {alpha}6beta1-integrin may eventually explain the different biological functions of LN-8 and LN-9.

The glomerulus is a unique capillary structure in which the vascular smooth muscle, pericyte-like MC directly interfaces with both the glomerular endothelial cell and the podocytes. In each of the interfacing sites extracellular matrix with a specific composition is expressed (12, 27, 60). Some of this specificity is conveyed by the isoforms of LN. Evolution of expression of different LN isoforms corresponds to critical stages during glomerulogenesis (46) and becomes disrupted or altered during disease (2, 35). During glomerulogenesis, the mesangium first contains the {alpha}1 chain, which later is replaced by {alpha}4, the predominant {alpha}-chain in the adult mesangium (29, 57). As the glomerulus matures, smaller amounts of {alpha}2 and {alpha}5 become detectable in the mesangial zone (35, 46). While the critical importance of the {alpha}5 chain has been demonstrated in elegant studies by Miner and colleagues (37, 48), the role of other LN chains is less clear. Null mutations of the beta2 chain produce nephrotic syndrome in mice (51) and proteinuria and mesangial sclerosis in humans (66). Null mutations in the {alpha}4 chain are associated with microvascular disease that leads to progressive organ dysfunction later in life (63). Kidney architecture has not been reported in these animals, but is likely that they have abnormalities in renal microvessels as well. In culture, MCs synthesize predominantly LN-8/9, and small amounts of LN {alpha}2 and {alpha}5 chains (27, 28). Although key cellular properties have been mapped to peptides within specific LN{alpha} chains, the role of LNbeta1 compared with LNbeta2 is less clear. As discussed above, a switch between LN-8 and LN-9 may influence blood vessel growth, quiescence with differentiation, responses to injury, and infiltration by inflammatory and malignant cells. Each of these effects may rely on a different set of growth factors, cells, and matrix proteins. These differences have been exploited in studies of retinal ischemia (21), where specific peptide inhibitors have shown the capacity to control abnormal vessel proliferation, while not impeding restoration of perfusion to ischemic retina. It is hoped that detailed characterization of similar interactions in normal and diseased glomeruli might provide insights with therapeutic implications for chronic kidney disease.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
These studies were supported by the Medical Research service of the Department of Veterans Affairs and the National Institutes of Health Grant CKA R01-DK49971-08.


    FOOTNOTES
 

Address for reprint requests and other correspondence: C. K. Abrass, Univ. of Washington, Dept. of Medicine, South Lake Union, 815 Mercer St., Seattle, WA 98109 (e-mail: cabrass{at}u.washington.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Abrass CK, Berfield AK, and Andress DL. Heparin binding domain of insulin-like growth factor binding protein-5 stimulates mesangial cell migration. Am J Physiol Renal Physiol 273: F899–F906, 1997.[Abstract/Free Full Text]

2. Abrass CK, Spicer D, Berfield AK, St. John PL, and Abrahamson DR. Diabetes induces changes in glomerular development and laminin beta2 (s-laminin) expression. Am J Pathol 151: 1131–1140, 1997.[Abstract]

3. Abrass CK, Spicer D, and Raugi GJ. Insulin induces a change in extracellular matrix glycoproteins synthesized by rat mesangial cells in culture. Kidney Int 46: 613–620, 1994.[Web of Science][Medline]

4. Abrass CK, Spicer D, and Raugi GJ. Induction of nodular sclerosis by insulin in rat mesangial cells in vitro: studies of collagen. Kidney Int 47: 25–37, 1995.[Web of Science][Medline]

5. Arar M, Xu YC, Elshihabi I, Barnes JL, Choudhury GG, and Abboud HE. Platelet-derived growth factor receptor beta regulates migration and synthesis in metanephric mesenchymal cells. J Biol Chem 275: 9527–9533, 2000.[Abstract/Free Full Text]

6. Aumailley M, Bruckner-Tuderman L, Carter WG, Deutzmann R, Edgar D, Ekblom P, Engel J, Engvall E, Hohenester E, Jones JCR, Kleinman H, Marinkovich MP, Martin GR, Mayer U, Meneguzzi G, Miner JH, Miyazaki K, Patarroyo M, Paulsson M, Quaranta V, Sanes JR, Sasaki T, Sekiguchi K, Sorokin L, Talts JF, Tryggvason K, Uitto J, Virtanen I, Von der Mark H, Wewer UM, Yamada Y, and Yurchenco P. A simplified laminin nomenclature. Matrix Biol 24: 326–332, 2005.[CrossRef][Web of Science][Medline]

7. Berfield AK, Andress DL, and Abrass CK. IGFBP-5201–218 stimulates Cdc42 aggregation and filopodia formation in migrating mesangial cells. Kidney Int 57: 1991–2003, 2000.[CrossRef][Web of Science][Medline]

8. Berfield AK, Andress DL, and Abrass CK. IGF-1-induced lipid accumulation impairs mesangial cell migration and contractile function. Kidney Int 62: 1229–1237, 2002.[CrossRef][Web of Science][Medline]

9. Berfield AK, Spicer D, and Abrass CK. Insulin-like growth factor I (IGF-I) induces unique effects in the cytoskeleton of cultured rat glomerular mesangial cells. J Histochem Cytochem 45: 583–593, 1997.[Abstract/Free Full Text]

10. Bjarnegard M, Enge M, Norlin J, Gustafsdottir S, Fredriksson S, Abramsson A, Takemoto M, Gustafsson E, Fassler R, and Betsholtz C. Endothelium-specific ablation of PDGFB leads to pericyte loss and glomerular, cardiac and placental abnormalities. Development 131: 1847–1857, 2004.[Abstract/Free Full Text]

11. Butt AJ, Dickson KA, McDougall F, and Baxter RC. Insulin-like growth factor-binding protein-5 inhibits the growth of human breast cancer cells in vitro and in vivo. J Biol Chem 278: 29676–29685, 2003.[Abstract/Free Full Text]

12. Chai Q, Krag S, Miner JH, Nyengaard JR, Chai S, and Wogensen L. TGF-beta1 induces aberrant laminin chain and collagen type IV isotype expression in the glomerular basement membrane. Nephron Exper Nephrol 94: E123–E136, 2003.[CrossRef]

13. Cooper HM, Tamura RN, and Quaranta V. The major laminin receptor of mouse embryonic stem cells is a novel isoform of the {alpha}6beta1 integrin. J Cell Biol 115: 843–850, 1991.[Abstract/Free Full Text]

14. Couchman JR and Woods A. Syndecan-4 and integrins: combinatorial signaling in cell adhesion. J Cell Sci 112: 3415–3420, 1999.[Abstract]

15. DeHahn KC, Gonzales M, Gonzalez AM, Hopkinson SB, Chandel NS, Brunelle JK, and Jones JC. The {alpha}4 laminin subunit regulates endothelial cell survival. Exp Cell Res 294: 281–289, 2004.[CrossRef][Web of Science][Medline]

16. Durbeej M, Henry MD, Ferletta M, Campbell KP, and Ekblom P. Distribution of dystroglycan in normal adult mouse tissues. J Histochem Cytochem 46: 449–457, 1998.[Abstract/Free Full Text]

17. Ferletta M, Kikkawa Y, Yu H, Talts JF, Durbeej M, Sonnenberg A, Timpl R, Campbell KP, Ekblom P, and Genersch E. Opposing roles of integrin {alpha}6Abeta1 and dystroglycan in laminin-mediated extracellular signal-regulated kinase activation. Mol Biol Cell 14: 2088–2103, 2003.[Abstract/Free Full Text]

18. French-Constant C and Colognato H. Integrins: versatile integrators of extracellular signals. Trends Cell Biol 14: 678–686, 2004.[CrossRef][Web of Science][Medline]

19. Fujiwara H, Gu J, and Sekiguchi K. Rac regulates integrin-mediated endothelial cell adhesion and migration on laminin-8. Exp Cell Res 292: 67–77, 2003.

20. Fujiwara H, Kikkawa Y, Sanzen N, and Sekiguchi K. Purification and characterization of human laminin-8. Laminin-8 stimulates cell adhesion and migration through {alpha}3beta1 and {alpha}6beta1 integrins. J Biol Chem 276: 17550–17558, 2001.[Abstract/Free Full Text]

21. Gebarowska D, Stitt AW, Gardiner TA, Harriott P, Greer B, and Nelson J. Synthetic peptides interacting with the 67-kd laminin receptor can reduce retinal ischemia and inhibit hypoxia-induced retinal neovascularization. Am J Pathol 160: 307–313, 2002.[Abstract/Free Full Text]

22. Geberhiwot T, Assefa D, Kortesmaa J, Ingerpuu S, Pedraza C, Wondimu Z, Charo J, Kiessling R, Virtanen I, Tryggvason K, and Patarroyo M. Laminin-8 ({alpha}4beta1{gamma}1) is synthesized by lymphoid cells, promotes lymphocyte migration and costimulates T cell proliferation. J Cell Sci 114: 423–433, 2001.[Abstract]

23. Gleave M and Jansen B. Clusterin and IGFBPs as antisense targets in prostate cancer. Ann NY Acad Sci 1002: 95–104, 2003.[CrossRef][Web of Science][Medline]

24. Goel HL, Fornaro M, Moro L, Teider N, Rhim JS, King M, and Languino LR. Selective modulation of type 1 insulin-like growth factor receptor signaling and functions by beta1 integrins. J Cell Biol 166: 407–418, 2004.[Abstract/Free Full Text]

25. Gonzales M, Weksler B, Tsuruta D, Goldman RD, Yoon KJ, Hopkinson SB, Flitney FW, and Jones JCR. Structure and function of a vimentin-associated matrix adhesion in endothelial cells. Mol Biol Cell 12: 85–100, 2001.[Abstract/Free Full Text]

26. Gonzalez AM, Gonzalez M, Herron GS, Nagavarapu U, Hopkinson SB, Tsuruta D, and Jones JCR. Complex interactions between the laminin {alpha}4 subunit and integrins regulate endothelial cell behavior in vitro and angiogenesis in vivo. Proc Natl Acad Sci USA 99: 16075–16080, 2002.[Abstract/Free Full Text]

27. Hansen K and Abrass CK. Role of laminin isoforms in glomerular structure. Pathobiology 67: 84–91, 1999.[CrossRef][Web of Science][Medline]

28. Hansen K, Berfield AK, Spicer D, and Abrass CK. Rat mesangial cells express two unique isoforms of laminin which modulate mesangial cell phenotype. Matrix Biol 17: 117–130, 1998.[CrossRef][Web of Science][Medline]

29. Hansen KM and Abrass CK. Laminin-8/9 is synthesized by rat glomerular mesangial cells and is required for PDGF-induced mesangial cell migration. Kidney Int 64: 110–118, 2003.[CrossRef][Web of Science][Medline]

30. Henry MD, Satz JS, Brakebusch C, Costell M, Gustafsson E, Fässler R, and Campbell KP. Distinct roles for dystroglycan, beta1 integrin and perlecan in cell surface laminin organization. J Cell Sci 114: 1137–1144, 2005.

31. Hsieh T, Gordon RE, Clemmons DR, Busby WH Jr, and Duan C. Regulation of vascular smooth muscle cell responses to insulin-like growth factor (IGF)-I by local IGF-binding proteins. J Biol Chem 278: 42886–42892, 2003.[Abstract/Free Full Text]

32. Hugo C, Shankland SJ, Bowen-Pope DF, Couser WG, and Johnson RJ. Extraglomerular origin of the mesangial cell after injury. J Clin Invest 223: 72–82, 1997.

33. Ido H, Harada K, Futaki S, Hayashi Y, Nishiuchi R, Natsuka Y, Li S, Wada Y, Combs AC, Ervasti JM, and Sekiguchi K. Molecular dissection of the {alpha}-dystroglycan- and integrin-binding sites within the globular domain of human laminin-10. J Biol Chem 279: 10946–10954, 2004.[Abstract/Free Full Text]

34. Jones JI, Prevette T, Gockerman A, and Clemmons DR. Ligand occupancy of the {alpha}Vbeta3 integrin is necessary for smooth muscle cells to migrate in response to insulin-like growth factor I. Proc Natl Acad Sci USA 93: 2482–2487, 1996.[Abstract/Free Full Text]

35. Kashtan CE, Kim Y, Lees GE, Thorner PS, Virtanen I, and Miner JH. Abnormal glomerular basement membrane laminins in murine, canine, and human Alport syndrome: Aberrant laminin {alpha}2 deposition is species independent. J Am Soc Nephrol 12: 252–260, 2001.[Abstract/Free Full Text]

36. Khazenzon NM, Ljubimov AV, Lakhtar AJ, Fujita M, Fujiwara H, Sekiguchi K, Sorokin LM, Petäjäniemi N, Virtanen I, Black KL, and Ljubimova JY. Antisense inhibition of laminin-8 expression reduces invasion of human gliomas in vitro. Mol Cancer Ther 2: 985–994, 2003.[Abstract/Free Full Text]

37. Kikkawa Y, Virtanen I, and Miner JH. Mesangial cells organize the glomerular capillaries by adhering to the G domain of laminin {alpha}5 in the glomerular basement membrane. J Cell Biol 161: 187–196, 2003.[Abstract/Free Full Text]

38. Kortesmaa J, Yurchenco P, and Tryggvason K. Recombinant laminin-8 ({alpha}4beta1{gamma}1) production, purification, and interactions with integrins. J Biol Chem 275: 14853–14859, 2000.[Abstract/Free Full Text]

39. Kreisberg JI and Karnovsky MJ. Glomerular cells in culture. Kidney Int 23: 439–447, 1983.[Web of Science][Medline]

40. Langhofer M, Hopkinson SB, and Jones JCR. The matrix secreted by 804G cells contains laminin-related components that participate in hemidesmosome assembly in vitro. J Cell Sci 105: 753–764, 1993.[Abstract]

41. Lindblom P, Gerhardt H, Liebner S, Abramsson A, Enge M, Hellstrom M, Backstrom G, Fredriksson S, Landegren U, Nystrom HC, Bergstrom G, Dejana E, Ostman A, Lindahl P, and Betsholtz C. Endothelial PDGF-B retention is required for proper investment of pericytes in the microvessel wall. Genes Dev 17: 1835–1840, 2003.[Abstract/Free Full Text]

42. Ljubimova JY, Lakhter AJ, Loksh A, Yong WH, Riedinger MS, Miner JH, Sorokin LM, Ljubimov AV, and Black KL. Overexpression of {alpha}4 chain-containing laminins in human glial tumors identified by gene microarray analysis. Cancer Res 61: 5601–5610, 2001.[Abstract/Free Full Text]

43. Lohikangas L, Gullberg D, and Johansson S. Assembly of laminin polymers is dependent on beta1-integrins. Exp Cell Res 265: 135–144, 2005.

44. Maruyama Y. An electron microscopic study of circumferential mesangial interposition in various renal diseases. Nippon Jinzo Gakkai Shi 40: 263–275, 1998.[Medline]

45. Matsuura H, Momota Y, Murata K, Matsushima H, Suzuki N, Nomizu M, Shinkai H, and Utani A. Localization of the laminin {alpha}4 chain in skin and identification of a heparin-dependent cell adhesion site within the laminin {alpha}4 chain C-terminal LG4 module. J Invest Dermatol 122: 614–620, 2004.[CrossRef][Web of Science][Medline]

46. Miner JH. Developmental biology of glomerular basement membrane components. Curr Opin Nephrol Hypertens 7: 13–19, 1998.[Web of Science][Medline]

47. Miner JH, Cong L, and Patton BL. Laminins {alpha}1 and {alpha}4 in pancreatic acinar basement membranes are required for basal receptor localization. J Histochem Cytochem 52: 153–156, 2005.

48. Miner JH and Li C. Defective glomerulogenesis in the absence of laminin alpha5 demonstrates a developmental role for the kidney glomerular basement membrane. Dev Biol 217: 278–289, 2000.[CrossRef][Web of Science][Medline]

49. Nam TJ, Busby WH Jr, Rees C, and Clemmons DR. Thrombospondin and osteopontin bind to insulin-like growth factor (IGF)-binding protein-5 leading to an alteration in IGF-I-stimulated cell growth. Endocrinology 141: 1100–1106, 2000.[Abstract/Free Full Text]

50. Nishiuchi R, Murayama O, Fujiwara H, Gu J, Kawakami T, Aimoto S, Wada Y, and Sekiguchi K. Characterization of the ligand-binding specificities of integrin {alpha}3beta1 and {alpha}6beta1 using a panel of purified laminin isoforms containing distinct {alpha} chains. J Biochem (Tokyo) 134: 497–504, 2003.[Abstract/Free Full Text]

51. Noakes PG, Miner JH, Gautam M, Cunningham JM, Sanes JR, and Merlie JP. The renal glomerulus of mice lacking s-laminin/laminin beta2: nephrosis despite molecular compensation by laminin beta1. Nat Genet 10: 400–406, 1995.[CrossRef][Web of Science][Medline]

52. Okazaki I, Suzuki N, Nishi N, Utani A, Matsuura H, Shinkai H, Yamashita H, Kitagawa Y, and Nomizu M. Identification of biologically active sequences in the laminin {alpha}4 chain G domain. J Biol Chem 277: 37070–37078, 2002.[Abstract/Free Full Text]

53. Park IS, Kiyomoto H, Alvarez F, Xu YC, Abboud HE, and Abboud SL. Preferential expression of insulin-like growth factor binding proteins-1, -2, -5 during early diabetic renal hypertrophy in rats. Am J Kidney Dis 32: 1000–1010, 1998.[Web of Science][Medline]

54. Parker A, Clarke JB, Busby WH Jr, and Clemmons DR. Identification of the extracellular matrix binding sites for insulin-like growth factor-binding protein 5. J Biol Chem 271: 13523–13529, 1996.[Abstract/Free Full Text]

55. Patton BL, Cunningham JM, Thyboll J, Kortesmaa J, Westerblad H, Edstrom L, Tryggvason K, and Sanes JR. Properly formed but improperly localized synaptic specializations in the absences of laminin alpha4. Nat Neurosci 4: 597–604, 2001.[CrossRef][Web of Science][Medline]

56. Pedraza C, Geberhiwot T, Ingerpuu S, Assefa D, Wondimu Z, Kortesmaa J, Tryggvason K, Virtanen I, and Patarroyo M. Monocytic cells synthesize, adhere to, and migrate on laminin-8 ({alpha}4beta1{gamma}1). J Immunol 165: 5831–5838, 2001.

57. Petäjäniemi N, Korhonen M, Kortesmaa J, Tryggvason K, Sekiguchi K, Fujiwara H, Sorokin L, Thornell LE, Wondimu Z, Assefa D, Patarroyo M, and Virtanen I. Localization of laminin {alpha}4-chain in developing and adult human tissues. J Histochem Cytochem 50: 1113–1130, 2002.[Abstract/Free Full Text]

58. Ridley AJ, Schwartz MA, Burridge K, Firtel RA, Ginsberg MH, Borisy G, Parsons JT, and Horwitz AR. Cell migration: integrating signals from front to back. Science 302: 1704–1709, 2003.[Abstract/Free Full Text]

59. Schneider MR, Wolf E, Hoeflich A, and Lahm H. IGF-binding protein-5: flexible player in the IGF system and effector on its own. J Endocrinol 172: 423–440, 2002.[Abstract]

60. St. John PL and Abrahamson DR. Glomerular endothelial cells and podocytes jointly synthesize laminin-1 and laminin-11 chains. Kidney Int 60: 1037–1046, 2001.[CrossRef][Web of Science][Medline]

61. Talts JF, Sasaki T, Miosge N, Gohring W, Mann K, Mayne R, and Timpl R. Structural and functional analysis of the recombinant G domain of the laminin {alpha}4 chain and its proteolytic processing in tissues. J Biol Chem 275: 35192–35199, 2000.[Abstract/Free Full Text]

62. Thyboll J, Kortesmaa J, Cao R, Soininen R, Wang L, Iivanainen A, Sorokin L, Risling M, Cao Y, and Tryggvason K. Deletion of the laminin {alpha}4 chain leads to impaired microvessel maturation. Mol Cell Biol 22: 1194–1202, 2002.[Abstract/Free Full Text]

63. Wang J, Hoshijima M, Lam J, Zhou Z, Jokiel A, Dalton ND, Hultenby K, Ruiz-Lozano P, Ross J Jr, Tryggvason K, and Chien KR. Cardiomyopathy associated with microcirculation dysfunction in laminin {alpha}4 chain-deficient mice. J Biol Chem 281: 213–220, 2006.[Abstract/Free Full Text]

64. Yamaguchi H, Yamashita H, Mori H, Okazaki I, Nomizu M, Beck K, and Kitagawa Y. High and low affinity heparin-binding sites in the G domain of the mouse laminin {alpha}4 chain. J Biol Chem 275: 29458–29465, 2000.[Abstract/Free Full Text]

65. Yamashita H, Beck K, and Kitagawa Y. Heparin binds to the laminin {alpha} chain LG4 domain at a site different from that found for other laminins. J Mol Biol 335: 1145–1149, 2004.[CrossRef][Web of Science][Medline]

66. Zenker M, Aigner T, Wendler O, Tralau T, Müntefering H, Fenski R, Pitz S, Schumacher V, Royer-Pokora B, Wühl E, Cochat P, Bouvier R, Kraus C, Mark K, Maldon H, Dötsch J, Rascher W, Maruniak-Chudek I, Lennert T, Neumann LM, and Reis A. Human laminin beta2 deficiency causes congenital nephrosis with mesangial sclerosis and distinct eye abnormalities. Hum Mol Genet 2004.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/4/C589    most recent
00623.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Berfield, A. K.
Right arrow Articles by Abrass, C. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Berfield, A. K.
Right arrow Articles by Abrass, C. K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.