Am J Physiol Cell Physiol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 291: C546-C554, 2006. First published May 10, 2006; doi:10.1152/ajpcell.00011.2006
0363-6143/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/3/C546    most recent
00011.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Meng, J. P.
Right arrow Articles by Bouscarel, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meng, J. P.
Right arrow Articles by Bouscarel, B.

GROWTH, DIFFERENTIATION, AND APOPTOSIS

Biphasic regulation by bile acids of dermal fibroblast proliferation through regulation of cAMP production and COX-2 expression level

Jian Ping Meng,1 Susan Ceryak,2 Zaheer Aratsu,1 Loren Jones,1 Lauren Epstein,1 and Bernard Bouscarel1,3

1Gastroenterology Research Laboratory, Department of Biochemistry and Molecular Biology, 2Department of Pharmacology and Physiology, and 3Department of Medicine, The George Washington University Medical Center, Washington, District of Columbia

Submitted 11 January 2006 ; accepted in final form 25 March 2006


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We have previously reported that the bile acids chenodeoxycholate (CDCA) and ursodeoxycholate (UDCA) decreased PGE1-induced cAMP production in a time- and dose-dependent manner not only in hepatocytes but also in nonhepatic cells, including dermal fibroblasts. In the present study, we investigated the physiological relevance of this cAMP modulatory action of bile acids. PGE1 induced cAMP production in a time- and dose-dependent manner. Moreover, PGE1 (1 µM), forskolin (1–10 µM), and the membrane-permeable cAMP analog CPT-cAMP (0.1–10 µM) decreased dermal fibroblast proliferation in a dose-dependent manner with a maximum inhibition of ~80%. CDCA alone had no significant effect on cell proliferation at a concentration up to 25 µM. However, CDCA significantly reduced PGE1-induced cAMP production by 80–90% with an EC50 of ~20 µM. Furthermore, at concentrations ≤25 µM, CDCA significantly attenuated the PGE-1-induced decreased cell proliferation. However, at concentrations of 50 µM and above, while still able to almost completely inhibit PGE-1-induced cAMP production, CDCA, at least in part through an increased cyclooxygenase-2 (COX-2) expression level and PGE2 synthesis, produced a direct and significant decrease in cell proliferation. Indeed, the CDCA effect was partially blocked by ~50–70% by both indomethacin and dexamethasone. In addition, overexpression of COX-2 cDNA wild type resulted in an increased efficacy of CDCA to block cell proliferation. The effects of CDCA on both cAMP production and cell proliferation were similar to those of UDCA and under the same conditions cholate had no effect. Results of the present study underline pathophysiological consequences of cholestatic hepatobiliary disorders, in which cells outside of the enterohepatic circulation can be exposed to elevated bile acid concentrations. Under these conditions, low bile acid concentrations can attenuate the negative hormonal control on cell proliferation, resulting in the stimulation of cell growth, while at high concentrations these bile acids provide for a profound and prolonged inhibition of cell proliferation.

chenodeoxycholic acid; cyclic adenosine monophosphate


cAMP, which can be induced by the prostaglandins (PG) PGE1 and PGE2, is known to have both proliferative and antiproliferative effects, according to cell type. For example, cAMP stimulates the proliferation of cells, such as hepatocytes and 3T3 cells, while inhibiting the proliferation of normal human skin fibroblasts, gastric cells, and hepatic stellate cells (20, 30, 38, 55). The PGE2 is also a potent inhibitor of fibroblast migration, proliferation and collagen synthesis (23, 24, 54). PGs are derived from arachidonic acid through the cyclooxygenase (COX) pathway. COX catalyzes the rate-limiting oxidative cyclization of arachidonic acid to prostaglandin endoperoxide, which is the immediate precursor of PGs, thromboxane, and prostacyclin (40). Two isoforms of COX have been recognized. COX-1 (72 kDa) is expressed constitutively, whereas COX-2 (72/74 kDa) is induced by growth factors, oncogenes, tumor promoters, and proinflammatory cytokines (see Ref. 4 for review). Furthermore, while COX-1 is expressed in most tissues, COX-2 is usually quiescent or absent in most tissues but can be rapidly expressed in large amounts by physiological, pathological, and mitogenic stimuli (32, 50). The regulation of COX-2 activity occurs principally through control of gene expression and is cell type specific. For example, TGF-beta augments COX-2 induction by IL-1 in fibroblasts while it inhibits COX-2 induction in macrophages (49). Therefore, cAMP and COX-2 are key factors in the regulation of cell proliferation by PG.

Bile acids are known to be co-carcinogenic agents. They are synthesized in the liver and secreted into bile conjugated mainly to either glycine (G) or taurine (T). Under physiological conditions, while chiefly confined to the enterohepatic circulation, bile acid concentration in the systemic circulation can increase postprandially two- to threefold from a fasting level of ~1–3 µM (2, 44). In the serum, bile acids are mainly in the amidated form. The level of unconjugated bile acids exhibits a diurnal variation, attaining a maximum concentration of 30–40% of the total serum bile acids after breakfast (44). In several pathological conditions, tissues outside of the enterohepatic circulation can come in contact with high concentrations of both unconjugated and conjugated bile acids. For example, in cholestatic hepatobiliary disorders, bile acids accumulate in the systemic circulation, resulting in a 20- to 100-fold increase in serum bile acid concentration (29). Under these conditions, serum levels of unconjugated bile acids can increase dramatically, particularly if portal cirrhosis is present (29). Finally, in patients with stagnant loop syndrome, serum unconjugated bile acid levels increase due to bacterial overgrowth in the small intestine (27).

Sodium-dependent bile acid transporters have been reported to be functionally present mainly in the liver, ileum, and kidney (1, 46). However, bile acids can enter cells by a sodium-independent transporter, as well as by passive diffusion, which is a function of their respective hydrophobicity (11, 53). Thus these observations underline the relevance that increases of either or both conjugated and unconjugated bile acids in the systemic circulation could have in their accumulation in extrahepatic tissues (12, 19, 34). This is in light of considerable evidence both in human and in animal models that cholestasis is associated with increased deposition of bile acids in extrahepatic tissues, with the skin being one of the predominant ones (5, 12, 16, 43).

Both the physiological and the pathophysiological effects of bile acids have been well documented for the liver and intestine, while they are less understood for tissues outside of the enterohepatic circulation, despite their exposure to bile acids, which is particularly significant in hepatobiliary diseases. Therefore, the present study was designed to investigate the chronic effect of bile acids on stimulated cAMP synthesis in human dermal fibroblasts. Moreover, the functional consequence of bile acid-induced inhibition of stimulated cAMP on fibroblast proliferation was assessed. We show that physiological concentrations of bile acids inhibit stimulated cAMP formation after chronic exposure and that the cAMP-induced inhibition of cell proliferation is partially abrogated in the presence of bile acids. However, at concentrations >50 µM, certain bile acids like chenodeoxycholic acid (CDCA) directly inhibit cell proliferation through an increased COX-2 expression and PGE2 synthesis.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Materials. Ursodeoxycholic acid (UDCA) was supplied by Tanabe (Tokyo, Japan), and CDCA was supplied by Dr. Falk (Pharma, Freiburg, Germany). Deoxycholic acid (DCA) and cholic acid (CA) were purchased from Steraloids (Wilton, NH). All bile acids used were 98–99% pure, as judged by gas-liquid chromatography. Prostaglandin (PG) E1, forskolin (FK), and 8-(4-chlorophenylthio)-cAMP sodium salt (cpt-cAMP) were purchased from Calbiochem (San Diego, CA). PGE1, PGE2, 1OH-PGE1 were from Cayman (Ann Arbor, MI). RPMI and 3-isobutyl-1-methylxanthine (IBMX) were purchased from Sigma (St. Louis, MO). [125I]cAMP was purchased from Linco Research Products (St. Charles, MO), and [methyl-3H]thymidine (specific activity, 80 Ci/mmol) was from Amersham (Piscataway, NJ). Dulbecco’s modified Eagle’s minimum essential medium (DMEM; CellGro) was purchased from Fisher Scientific (Pittsburgh, PA). Fetal bovine serum (FBS) was purchased from Hyclone (Logan, UT). Other chemicals were from either Sigma or Fisher Scientific and were of the highest purity available.

Culture of human skin fibroblasts. Human skin fibroblasts obtained from forearm skin biopsy were purchased from Coriell Institute for Medical Research (Camden, NJ). The cells were cultured, as previously described (8), in DMEM with 1% L-glutamine, 2% essential and nonessential amino acids, 1% penicillin and streptomycin, and 10% FBS. The cells were plated at a density of 3–5 x 104 cells·ml·well–1 in 12-well plates. Four to eight hours before an experiment, the cells were cultured in DMEM, containing either 0.1% FBS for cAMP determination or 1% FBS to measure cell proliferation.

cAMP determination. Cells were either incubated alone or with the sodium salt of the respective bile acid for the designated period of time. cAMP synthesis was stimulated either simultaneously, or following bile acid preincubation, with PGE1 in the presence or absence of 50 µM IBMX, for the indicated period of time. Following incubation with the designated agents, cAMP was measured in cellular HClO4 extracts, as well as in the medium, by radioimmunoassay as previously described (8), using the method of Gettys et al. (15). The results were expressed either per milligram of total cell protein as determined by the BCA assay (Pierce, Rockford, IL) or as percentage of the maximum obtained by incubating the cells with PGE1 + IBMX alone.

Cell proliferation assessment. Cells were seeded at 3–5 x 104 cells/well in 12-well plates. After 24 h, the culture medium was replaced with medium containing 1% FBS 4 h before preincubation with the respective bile acid or tested agents. Cells were incubated for an additional 24 h after PGE1 addition, and the uptake of [methyl-3H]thymidine was determined as an index of cell proliferation. Briefly, 1 µCi [methyl-3H]thymidine was added to each well, and the cells were incubated for an additional 4 h. Cells were then washed, harvested with trypsin, and pipetted onto glass fiber filters (Whatman, GF/B). Filters were washed four times with Tris-buffered saline (20 mM Tris·HCl and 150 mM NaCl, pH 7.4), and cellular [3H]thymidine incorporation was measured by scintillation counting (model SL6000; Beckman, Palo Alto, CA).

RNA extraction and reverse transcription. Total RNA was extracted from fibroblasts using RNA Bee (Tel-Test, Friendswood, TX). Oligo dT and Superscript III were used for transcription containing 1–2 µg of RNA. Reverse transcription was conducted at 50°C for 60 min after RNAse H treatment for 30 min. DNA (5–10 ng) was used for PCR reaction using Taq DNA polymerase (GIBCO-BRL). PCR reactions were conducted at 94°C for 3 min for denaturation, followed by 94°C for 45 s, 55°C for 30 s, 72°C for 40–60 s, for either 24–27 cycles for GAPDH or 27–32 cycles for human COX2, followed by a final extension at 72°C for 1 min. The reaction products were analyzed by electrophoresis on 1.5% agarose gels. The gels were analyzed by densitometric scanning with the use of photo imaging (Molecular Dynamics, Sunnyvale, CA). The densities of the COX-2 bands were normalized with the respective GAPDH bands.

Immunoblot analysis and PGE2 synthesis. Total cellular homogenates were prepared from cultured fibroblasts in modified RIPA buffer (0.5 M Tris·HCl, pH 7.4, 1.5 M NaCl, 2.5% deoxycholic acid, 10% Nonidet P-40, and 10 mM EDTA) containing one tablet of protease inhibitor (Roche, Indianapolis, IN). In addition, 1 mM of Na3VO4 and 1 mM of NaF were used in all the buffer preparations when phosphorylation studies were performed. Protein samples (20–30 µg) of the respective cellular fractions were separated by SDS-PAGE, using a mini-gel apparatus (Invitrogen, Carlsbad, CA) and transferred to Hybond-P Amersham Biosciences (Arlington Heights, IL) membranes using the Invitrogen transfer apparatus according to the manufacturer’s directions. The protein-containing membranes were blocked in 5% casein and 0.1% Tween (pH 7.4) and further incubated overnight at 4°C with either goat anti-human COX-2 (1:500), rabbit anti-human PKC{alpha} (1:1,000), anti-phospho P38 (1:500), anti-P38 (1:1,000), or anti-beta-actin (1:5,000) antibodies. The protein content was visualized using horseradish peroxidase-conjugated corresponding secondary antibodies, followed by enhanced chemiluminescence (Amersham), and analyzed densitometrically. The immunoreactive signals were normalized against that of beta-actin. The production of PGE2 was determined spectrometrically (Spectra-MAX, Molecular Dynamics) using an ELISA assay kit according to the manufacturer’s protocol (Cayman).

Statistical analysis. Except as otherwise indicated, the results were expressed as means ± SE. The statistical significance was determined by either Student’s t-test or ANOVA when more than two groups were compared.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Comparative effect of various agents on cAMP production. Several hormones and agents were investigated for their ability to significantly stimulate cAMP synthesis in human dermal fibroblasts. Histamine, PGE1, 1OH-PGE1, and PGE2 were found to stimulate cAMP synthesis in these cells as previously reported (10). Among the different agents tested, PGE1 was the most potent to stimulate cAMP production. Furthermore, the PGE1-induced cAMP production was time dependent with little receptor desensitization up to 24 h. The basal level of cAMP was 28–45 pmol/mg protein and was increased to 2,200 pmol/mg protein after 2 h of incubation with 1 µM PGE1 and 50 µM IBMX. cAMP production was induced by 1OH-PGE1 a EP2/EP4 agonist and little effect was observed with either sulprostone or misoprostol an EP1/EP3 and EP2/EP3 agonist, respectively (data not shown).

Comparative effect of bile acids on PGE1-induced cAMP production. Two-hour incubation of human skin fibroblasts with the dihydroxy bile acids DCA, CDCA, and UDCA had no effect on the basal cellular level of cAMP synthesis (data not shown). However, DCA, CDCA, and UDCA dramatically inhibited PGE1-induced cAMP production after 2-h incubation (Fig. 1A). The approximate 80-fold increase in cAMP induced by 1 µM PGE1 plus 50 µM IBMX exposure was inhibited by 50% at a concentration (EC50) of 4.6 µM by DCA and of 20 to 25 µM by CDCA and UDCA, respectively (Table 1). Under these conditions, 50–100 µM of either DCA or CDCA almost completely (96%-98%) inhibited the maximum production of cAMP. Furthermore, as previously reported (8, 9), bile acids inhibited PGE1-induced cAMP production to a similar extent in the presence and absence of IBMX following incubation with the fibroblasts for 2 h (data not shown). Thus the effect of the bile acid is not at the level of the phophodiesterase and cAMP breakdown. Therefore, IBMX is not required for the bile acid to induce this inhibitory effect.


Figure 1
View larger version (12K):
[in this window]
[in a new window]
 
Fig. 1. Dose-dependent effect of bile acids on PGE1-induced cAMP formation. Cultured human dermal fibroblasts were incubated at 37°C for either 2 h (A) or 20 h (B) with 1 µM PGE1 and 50 µM 3-isobutyl-1-methylxanthine (IBMX), as well as in the presence of increasing concentrations of the indicated bile acids. At the end of this period, the total cellular cAMP level was determined by radioimmunoassay. Results are expressed as a percentage of the maximum level of cAMP (~2,200 pmol/mg protein at 2 h, and 7,500 pmol/mg protein at 20 h), corrected for the basal level (28–45 pmol/mg protein), and determined in the presence of PGE1 and IBMX and in the absence of bile acids. Results are means ± SE of 3–4 determinations. CA, cholic acid; DCA, deoxycholic acid; CDCA, chenodeoxycholic acid; UDCA, ursodeoxycholic acid.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Bile acid concentrations eliciting 50% inhibition of the maximum PGE1-induced cAMP synthesis

 
After 20 h of exposure of the fibroblasts to DCA, CDCA, or UDCA, and in the presence of 1 µM PGE1 and 50 µM IBMX, the cellular cAMP formation was inhibited to the same extent as that measured after 2 h (Fig. 1B). However, as previously observed in acute studies (8, 9), CA remained without effect on PGE-1-induced cAMP formation. Furthermore, the basal level of cAMP at ~45 pmol/mg protein, was not affected by prolonged exposure of the cells to any of the bile acids studied (data not shown). The maximum cAMP formation, in the presence of PGE1 and IBMX, at 7,500 pmol/mg protein, was inhibited by 50% at similar respective EC50 concentration that was observed after 2 h of exposure (Table 1). The respective level of inhibition at a bile acid concentration of 100 µM was also similar as that observed at 2 h, suggesting that the bile acid inhibitory effect was maximum by 2 h and persisted for at least 20 h. Under the same 20-h conditions, the increased cAMP production induced by 1 µM 1OH-PGE1 was decreased by CDCA in a dose-dependent manner with an almost complete inhibition with CDCA concentrations >25 µM (Fig. 2).


Figure 2
View larger version (12K):
[in this window]
[in a new window]
 
Fig. 2. Dose-dependent effect of CDCA on 1-OH-PGE1-induced cAMP formation. Fibroblasts were incubated for 20 h with 1 µM 1OH-PGE1 and 50 µM IBMX, as well as in the presence of increasing concentrations (1–100 µM) of CDCA. See Fig. 1 for details. Result is a representative experiment performed in quadruplicate. *P < 0.01, significantly different from control determined in the absence of bile acid.

 
To determine whether the bile acid effect to inhibit cAMP production was dependent on the initial presence of PGE1, the fibroblasts were incubated first with CDCA for 20–24 h and then with PGE 1 + IBMX for 8 min before the cellular cAMP production was assessed. Under these conditions, CDCA decreased PGE1-induced cAMP production by 70% compared with >90% when both CDCA and PGE1 are chronically incubated together (data not shown).

Effect of cAMP synthesis-stimulating agents on cell proliferation. The various agents tested, which stimulate cAMP production, including IBMX, PGE1, 1OH-PGE1, FK, and the nonhydrolyzable, cell-permeable cAMP analog cpt-cAMP, were able to significantly inhibit human dermal fibroblast proliferation, as measured by thymidine incorporation. As shown in Fig. 3A, 20–24 h incubation with 50 µM IBMX, a phosphodieasterase inhibitor that prevents cAMP breakdown, inhibited cell growth by 40%. Furthermore, this inhibitory effect was mimicked by 1 µM of both PGE1 and 1-OH-PGE after 20–24 h incubation, and the PGE1 effect was potentiated by IBMX. Although not shown, little inhibition of cell proliferation was observed when sulprostone, an EP1/EP3 agonist, and misoprostol, an EP2/EP3 agonist, were tested. Likewise, FK, an activator of adenylate cyclase, decreased cell growth to 40% of the control, whereas cpt-cAMP evoked a dose-dependent decrease in [3H]thymidine DNA incorporation, with a maximum inhibition of ~80%. These results confirm the inhibitory effect of cAMP on cell proliferation in human dermal fibroblasts. However, under the same conditions, 1 µM of either 15{Delta}PGJ2 or PJD2 did not significantly affect fibroblast proliferation (data not shown).


Figure 3
View larger version (34K):
[in this window]
[in a new window]
 
Fig. 3. Effect of cAMP-modulating agents and bile acids on cell proliferation. Fibroblasts were incubated in the absence and presence of IBMX, 10H-PGE1, forskolin (FK), a membrane-permeable cAMP analog (cpt-cAMP) and PGE1 (A) or increasing concentrations of CDCA, UDCA, and CA (B). These agents were present for 20 h. One µCi [methyl-3H]thymidine was then added to each well and maintained at 37°C for an additional 4 h. Finally, the cells were harvested, washed, and filtered, and the uptake of [3H]thymidine was determined as an index of cell proliferation and expressed as percentage of control, i.e., in the absence of added agents. Results are means ± SE of 3–6 experiments performed in triplicate or quadruplicate. CTL, control; cpt-cAMP, 8-(4-chlorophenylthio)-cAMP. The concentrations of the various agents tested are in µM. *P < 0.05, significantly different from control; **P < 0.01, significantly different from control.

 
Effect of bile acid on the modulation of cell proliferation by PGE-1. As reported in Fig. 3B, only concentrations of CDCA >25 µM were able to directly and significantly inhibit fibroblasts proliferation by 35–45%. Under these conditions, 50 and 100 µM UDCA decreased cell proliferation by 50 and 65%, respectively, whereas 25 µM CA had no significant inhibitory effect (Fig. 3B). However, in keeping with its observed effect on PGE1-induced cAMP formation, 10 µM CDCA preincubation was associated with a significant attenuation of PGE1-induced growth arrest (Fig. 4A). Moreover, UDCA, which has a similar effect on PGE1-induced cAMP formation, was also able to significantly attenuate the PGE1 effect, while CA was again without effect (Fig. 4A). Finally, CDCA also induced a dose-dependent reversal of the inhibition of cell proliferation induced by 0.5 µM of the EP2/EP4-specific agonist 1-OH-PGE (Fig. 4B). Collectively, these results suggest that bile acids, at physiologically relevant concentrations that reduce PGE1-induced cAMP production, are also able to reverse the cAMP-mediated PGE1-induced inhibition of cell proliferation.


Figure 4
View larger version (37K):
[in this window]
[in a new window]
 
Fig. 4. Combined effect of PGE1 and bile acids on cell proliferation. Fibroblasts were incubated in the absence and presence of IBMX and either PGE1 (A) or 1OH-PGE1 (B), as well as various concentrations of CDCA, UDCA, or CA for 20 h. One µCi [methyl-3H]thymidine was then added to each well and maintained at 37°C for an additional 4 h. The cells were processed as described in the legend of Fig. 3. In addition, see legend of Fig. 1 for abbreviations. Results are means ± SE of 3–4 determinations. *P < 0.05, significantly different from respective control determined in the absence of bile acid; **P < 0.05, significantly different from control; #P < 0.05, significantly different from 1OH-PGE1 without CDCA.

 
Role of COX-2 on regulation of cell proliferation by cAMP and bile acid. To study the role of COX in the regulation of cell proliferation by cAMP and bile acids, the fibroblasts were incubated with 1 µM indomethacin, a nonspecific COX inhibitor. Indomethacin had no effect alone at this concentration but significantly reduced the inhibitory effect of PGE1, FK, and 50 µM CDCA by 25–65% (Fig. 5A). Moreover, incubation of fibroblasts with 2 µM NS-398, a specific COX-2 inhibitor reduced the effect of PGE1 and FK by 40–60% and that of CDCA by ~42% (Fig. 5B). Furthermore, preincubation of the cells with 1 µM dexamethasone, which prevents COX-2 protein synthesis, results in an almost complete abrogation of the inhibitory effect of PGE1 and PGE2 on cell proliferation, while it significantly reduces that of 50–100 µM CDCA by >45% (Fig. 5C). Together, these results suggest that at least COX-2 is involved in the inhibition of cell proliferation by PGE and higher concentrations of certain bile acids.


Figure 5
View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5. Effect of COX-2 inhibitors on cell proliferation in the presence of cAMP modulating agents and CDCA. Fibroblasts were incubated in the absence and presence of 1 µM indomethacin (A), 2 µM NS-398 (B), or 1 µM dexamethasone (DEX; C) 2–4 h before the addition of either the cAMP modulating agents (PGE1, PGE2, or FK) and CDCA for 20 h. One µCi [methyl-3H]thymidine was then added to each well and maintained at 37°C for an additional 4 h. The cells were processed as described in Fig. 3. Results are means ± SE of 4 determinations. *P < 0.01, significantly different from control; **P < 0.05, significantly different from respective condition without COX-2 inhibitor.

 
Effect of bile acids on COX-2 mRNA expression and PG2 synthesis. A recent report (25) demonstrating that the PGE-2 induced inhibition of fibroblast proliferation was abrogated in COX-2 but not COX-1 knockout mice supports a fundamental role of COX-2 and PG synthesis in the regulation of cell proliferation. Therefore, we undertook experiments to study the COX-1 and COX-2 mRNA expression level by RT-PCR in human dermal fibrobalts after exposure to different agents. The basal COX-1 mRNA expression was not affected by any of the agents tested (data not shown). The basal COX-2 mRNA level was barely detectable (Fig. 6A). Furthermore, while 1 µM PGE1 and 10 µM CDCA induced a slight but statistically insignificant increase in COX-2 mRNA expression, 100 µM of either CDCA, UDCA, or DCA stimulated COX-2 mRNA expression by 8-, 6-, and 4-fold, respectively (Fig. 6, A and B); 200 nM PMA was used as control. Furthermore, although not shown, the increase in COX-2 mRNA expression by the bile acids was time and dose dependent, i.e., a maximum effect observed at 12 h and with 200–400 µM CDCA. CDCA and PMA stimulated COX-2 protein expression by ~4- and ~9-fold, respectively, 8 and 12 h after their addition to the cell culture (Fig. 6B). In addition, this COX-2 transcriptional stimulation was associated with an increased PGE2 synthesis. Indeed, whereas 10 µM CDCA had no effect on PGE2 synthesis, 10 µM FK and 100 µM CDCA significantly increased prostaglandin synthesis by 20–30% and 80%, respectively (Fig. 7). After 24 h of incubation, 300 µM DCA increased PGE2 synthesis by over fivefold.


Figure 6
View larger version (50K):
[in this window]
[in a new window]
 
Fig. 6. COX-2 mRNA and protein expression level. A: fibroblasts were incubated with 100 µM of the indicated bile acids, 100 nM PMA, or 1 µM PGE1 for 12–14 h. Total cellular RNA was extracted using the Total RNA Mini kit (Qiagen, Valencia, CA). The oligonucleotide primers used were the following (forward CAAGTCCCTGAGCATCTACG and reverse CATAGGGCTTCAGCATAAAGC). The PCR mixture contained the RNA, 10 x Hotstar Taq DNA polymerase reaction buffer (Qiagen), 15 mM MgCl2, 1 µl of the oligonucleotide primer mixture (containing each target primer at 10 µM and the internal control primers at 1 µM), and 10 mM deoxynucleoside triphosphates. The following amplification conditions were used: denaturation and enzyme activation at 94°C for 3 min, followed by 27 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 60 s. The reaction products were analyzed by electrophoresis on 1.5% agarose gels. P < 0.05, significantly different from control, for CDCA, UDCA and PMA; P < 0.01, significantly different from control for DCA. B: Cox-2 protein expression following incubation of fibroblasts with various agents for 24 h was determined by immunoblotting using a specific anti-Cox-2 primary antibody and a horseradish peroxidase-labeled secondary antibody. The representative gels and membranes were analyzed by densitometric scanning (ImageQuant software; Molecular Dynamics). The values expressed between parentheses are fold increase over control. The arbitrary value for control was set at 1. The results are representative of at least three different experiments. Results from the mean of the three experiments were analyzed by one-way ANOVA and Bonferroni’s posttest. P < 0.001, significantly different from CTL for CDCA and PMA.

 

Figure 7
View larger version (16K):
[in this window]
[in a new window]
 
Fig. 7. Effect of bile acids and FK on PGE2 synthesis. Fibroblasts were stimulated with the indicated bile acid and 10 µM FK for 6 h. PGE2 synthesis was measured in the cultured medium using an immunoassay kit from Cayman. Results are means ± SE from 3 different experiments. *P < 0.01, significantly different from control; #P < 0.001, significantly different from control.

 
To further confirm the role of COX-2 on the CDCA-induced inhibition of cell proliferation, the fibroblasts were transfected with wild-type COX-2 cDNA using the procedure described by Amaxa (Gaithersburg, MD). Under these conditions, the transfection efficiency measured by fluorescent microscopy using GFP cDNA and expressed as a ratio of the fluorescent cells to the total cell expression was always >50%. Thirty-five to forty-eight hours after COX-2 cDNA transfection, a concentration of 20 µM CDCA, which was without significant effect on cell proliferation, decreased fibroblast proliferation by 80%, while the 68% inhibition observed with 100 µM CDCA was almost complete at 99% after COX-2 overexpression (Fig. 8).


Figure 8
View larger version (9K):
[in this window]
[in a new window]
 
Fig. 8. Dose-dependent effect of CDCA on cell proliferation following COX-2 overexpression. Fibroblasts were transfected with either the empty PGL3 vector or the WT COX-2 cDNA containing PGL3 vector following the procedure described by Amaxa (Gaithersburg, MD). Sixteen to twenty hours later, the cells were incubated in the absence and presence of increasing concentrations (20–200 µM) CDCA for 18–20 h and the uptake of [3H]thymidine was determined as described in Fig. 3. Results are the means ± SE of a representative experiment. Results were analyzed by one-way ANOVA and Bonferroni’s posttest. *P < 0.001, significantly different from respective control.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The results from the present study clearly demonstrate that chronic exposure of human dermal fibroblasts to dihydroxy bile acids causes an almost complete inhibition (>90%) of the PGE1-induced cAMP production. This inhibitory effect was maximal after 2 h for CDCA, UDCA, or DCA and plateaued for at least 20 h, suggesting that the bile acid inhibitory effect was not significantly desensitized even after chronic exposure. The loss of responsiveness of the G protein-coupled receptor signal transduction is an integral part of the adaptive receptor regulatory mechanism to prevent either overstimulation or signal termination, as previously reported for the beta-adrenergic receptor (see Ref. 22 for review). Furthermore, the fact that the bile acids are able to attenuate PGE1-induced cAMP production even when added before PGE1 stimulation supports a mechanism independent of both increased cAMP production and activated cAMP-dependent protein kinase.

In the present study, the respective EC50 for UDCA and CDCA was similar at both 2 and 20 h, at ~20 µM, whereas that for DCA was just ~5 µM. These EC50 concentrations are clearly attainable in the systemic circulation during cholestasis, and possibly, even postprandially (2, 29, 44), and further underline the relevance of this bile acid effect. Even after 20 h of exposure, CA was without effect on stimulated cAMP formation, which is consistent with our previous reports (8, 9), suggesting that the potency of the bile acid to inhibit stimulated cAMP formation varied with its hydroxylation state. On the other hand, the present results also differ somewhat from our previous report (9). While in isolated hepatocytes the order of potency among the bile acids tested to inhibit stimulated cAMP formation was UDCA>CDCA≥DCA, in dermal fibroblasts, the order of potency is the following: DCA>CDCA≥UDCA. Different hypotheses can be proposed to explain this discrepancy in bile acid potency between these two cellular models. First, although the PGE1 and glucagon receptors are coupled to cAMP synthesis in fibroblasts and hepatocytes, respectively, either or both the mechanism of desensitization or/and the cellular machinery available to desensitize the respective receptor signaling cascade may be different. In addition, the difference in relative potency of the dihydroxy bile acids in fibroblasts and hepatocytes may reflect the respective levels of intracellular bile acid-binding proteins in these two cell types (47).

There is considerable evidence in human and in animal models, that cholestasis is associated with increased deposition of bile acids in the skin (5, 12, 16, 19, 34, 43). In two hamster models of hepatic failure, namely bile duct ligation and functional hepatectomy, we have shown that bile acids were targeted to several tissues outside of the enterohepatic circulation, most notably, the skin (12). Thus, one could imagine that in the event of hepatobiliary disorders, which result in cholestasis, similar effects may be observed in vivo, as those observed in situ, in the present study. Furthermore, under conditions of impaired liver function and decreased bile secretion, such as those found in patients with portal cirrhosis (29) and in infants with extrahepatic biliary atresia and neonatal hepatitis (21), serum concentrations of unconjugated CDCA could reach a level ≥20 µM, which is shown in the present study to completely inhibit the PGE1/G protein-coupled receptor signaling response.

Elevated serum bile acid levels under cholestatic conditions have been associated with hepatotoxicity (17, 18), hepatic fibrosis (33), pruritus (39), cardiomyopathy (28), and vasodilation (7). Ligation of the common bile duct in rodents is associated with increased fibroblast proliferation and fibrosis (52). This condition is also associated with a delayed or impaired wound healing of the skin combined with a weaker scar (3, 13). Bile and bile acids in particular have been suggested to be central to the pathologies associated to disorders of hepatic, coagulation, renal, skin, or immune function coincident with deep jaundice, which can be reduced via biliary drainage (36).

Results from the present study are suggesting that bile acids affect fibroblast proliferation at least in part through modulation of the PGE1-induced cAMP production (see Fig. 9). Previously, Okuyama et al. (37) have reported that prostaglandins inhibit cell proliferation through the EP2/EP4 receptor population, which involves cAMP. Furthermore, our data support this inhibitory effect by PGE1, PGE2, and 1-OH-PGE, a EP2/EP4 specific agonist. Although not shown, we observed virtually no inhibition of cell proliferation with sulprostone, an EP1/EP3 agonist, or misoprostol, an EP2/EP3 agonist, thus suggesting a predominant EP4 receptor-dependent growth inhibitory mechanism in these cells. Moreover, the ability of the bile acid to abrogate the PG effect was observed with both PGE1 and 1-OH-PGE1. Finally, the bile acid effect was observed with CDCA and UDCA, but not CA, in keeping with their respective effect on inhibition of cAMP production.


Figure 9
View larger version (58K):
[in this window]
[in a new window]
 
Fig. 9. Effect of PGE1/PGE2 and CDCA on cell proliferation. Fibroblasts stimulated by PGE1 or PGE2 will, through activation of the EP2/EP4 receptor, and mediated through the trimeric stimulatory G protein (Gs), activate the adenylyl cyclase (AC) and cAMP synthesis. In turn, cAMP will activate the cAMP-dependent kinase (PKA) and COX-2 increased protein expression. COX-2 activation will result in an increased PGE2 synthesis from arachidonic acid. The bile acid, CDCA, has a dual effect decreasing the production of cAMP and stimulating COX-2 protein expression and activity. {alpha}s, beta, and {gamma}; stimulatory trimeric G protein. Solid arrows, stimulation; broken arrows, inhibition.

 
The implications for bile acid-induced modulation of PGE-1-induced cAMP formation and the consequent effects on PGE-1 induced cell proliferation are significant. We hypothesize that an increased deposition of bile acids not only in the liver but also in the skin could lead to tissue injury and the alteration of the balance between cell proliferation and cell death induced by various hormones, cytokines, and growth factors. In addition, PGE1 has been suggested to play an important role in tissue regeneration, due to its ability to regulate hepatocyte growth factor expression in human dermal fibroblasts in a cAMP-dependent fashion (31). Finally, PGE1 has been shown to inhibit collagenase gene expression in human skin fibroblasts (14). It is tempting to speculate that the bile acid-induced modulation of stimulated cAMP formation and cell proliferation could similarly occur in mesenchyme-derived cells of the liver under certain liver disease conditions.

Most studies have found COX-2 to be primarily, if not exclusively, located in the stromal compartment in human and rodent tissues (45). In the skin, COX-2 is mostly expressed in keratinocytes (26). Topical PGE2 application to the skin results in an increased expression of COX-2 (41). Furthermore, co-culture of dermal fibroblasts with keratinocytes resulted in an increased COX-2 activity in fibroblasts (42), supporting cross-talk between the dermis and epidermis. The results of the present study suggest that COX-2 expression can also be induced in fibroblasts. Indeed, the direct incubation of fibroblasts with concentrations >20 µM CDCA results in a significant increase in COX-2 mRNA and protein level. This supports reports showing that bile acid-induced increased COX-2 expression and PGE2 synthesis in various cell lines, including human pancreatic cancer cell lines (51), human pharyngeal cells (48), and colonic cell lines (57, 58). In the skin, the stimulation of PGE2 by bile acids could have not only an autocrine but also a paracrine effect. This increased COX-2 expression and PGE2 synthesis could in turn influence the cellular cAMP production as previously demonstrated in fibroblasts (8) and the phenotype not only of the fibroblasts but of the keratinocytes, as well by affecting proliferation, apoptosis, intercellular adhesion, and extracellular matrix production, which are key steps in the pathology of fibrosis.

Furthermore, in support of the findings from the present study, it is worthwhile to mention that several other reports associate COX-2 overexpression to suppression of tumor development. Indeed, Wilson and Potten (56) have reported that topically applied PGE2 inhibited tumor promotion in Min/+ mice. Furthermore, Lama et al. (25) have shown that fibroblasts from COX-1 knockout but not from COX-2 knockout mice were able to synthesize PGE2 and to inhibit cell proliferation. Finally, Bol et al. (6) have reported that COX-2 overexpression conferred resistance to skin tumor development to the K14.COX-2 trangenic mice. Therefore, these studies would support a biphasic effect of bile acid, i.e., a high concentration will decrease cell proliferation and potentially tumor formation, whereas low doses that can be reached under mild cholestatic conditions in the skin could perturb the local hormonal balance leading to increased cell proliferation. Furthermore, pathological conditions would be consequential to the loss by the cells of a normal response of COX-2 gene expression to extracellular agents, including prostanoids.

The biphasic effect of CDCA on cell proliferation is of interest in light of recent findings by Nishioka et al. (35). These authors suggest that CDCA stimulated proliferation of squamous cell carcinomas at low concentrations, while having a profound effect on the inhibition of cell proliferation at concentrations >30 µM. Those results are in agreement with the present findings as far as the regulation of cell proliferation is concerned. However, these authors have suggested that the bile acid effect on cell proliferation was independent of the bile acid-induced increase COX-2 expression. Those results are in contrast to those of the present study in normal diploid dermal fibroblasts, which demonstrates that the bile acid effect on cell proliferation was at least partially inhibited by both indomethacin and NS-398 while enhanced after COX-2 overexpression, supporting at least a partial COX-2 mediated inhibition of cell proliferation.

In summary, these findings underline the importance of potential pathophysiological mechanisms by which significant increase in particular systemic bile acids may not only result in cytotoxicity but also lead to changes in the response of extrahepatic tissues to hormones and transmittors, which are regulated by second messengers.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported in part by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-46954 and DK-56108.


    FOOTNOTES
 

Address for reprint requests and other correspondence: B. Bouscarel, Gastroenterology Research Laboratory, The George Washington Univ. Medical Center, 2300 I St. NW, 523 Ross Hall, Washington, DC 20037 (e-mail: bbouscarel{at}mfa.gwu.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Ananthanarayanan M, Bucuvalas JC, Shneider BL, Sippel CJ, and Suchy FJ. An ontogenically regulated 48-kDa protein is a component of the Na+-bile acid cotransport of rat liver. Am J Physiol Gastrointest Liver Physiol 261: G810–G817, 1991.[Abstract/Free Full Text]

2. Angelin B, Björkhem I, Einarsson K, and Ewerth S. Hepatic uptake of bile acids in man: fasting and postprandial concentrations of individual bile acids in portal venous and systemic blood serum. J Clin Invest 70: 724–731, 1982.[Web of Science][Medline]

3. Arnaud JP, Humbert W, Eloy MR, and Adloff M. Effect of obstructive jaundice on wound healing. An experimental study in rats. Am J Surg 141: 593–596, 1981.[CrossRef][Web of Science][Medline]

4. Bakhle YS. COX-2 and cancer: a new approach to an old problem. Br J Pharmacol 134: 1137–1150, 2001.[CrossRef][Web of Science][Medline]

5. Bartholomew TC, Summerfield JA, Billing BH, Lawson AM, and Setchell KDR. Bile acid profiles of human serum and skin interstitial fluid and their relationship to pruritus studies by gas chromatography-mass spectrometry. Clin Sci (Colch) 63: 65–73, 1982.[Medline]

6. Bol DK, Rowley RB, Ho CP, Pilz B, Dell J, Swerdel M, Kiguchi K, Muga S, Klein R, and Fischer SM. Cyclooxygenase-2 overexpression in the skin of transgenic mice results in suppression of tumor development. Cancer Res 62: 2516–2521, 2002.[Abstract/Free Full Text]

7. Bomzon A and Ljubuncic P. Bile acids as endogenous vasodilators? Biochem Pharmacol 5: 581–589, 1995.

8. Bouscarel B, Ceryak S, Gettys TW, Fromm H, and Noonan F. Alteration of cAMP-mediated hormonal responsiveness by bile acids in cells of nonhepatic origin. Am J Physiol Gastrointest Liver Physiol 268: G908–G916, 1995.[Abstract/Free Full Text]

9. Bouscarel B, Gettys TW, Fromm H, and Dubner H. Ursodeoxycholic acid inhibits glucagon-induced cAMP formation in hamster hepatocytes: a role for PKC. Am J Physiol Gastrointest Liver Physiol 268: G300–G310, 1995.[Abstract/Free Full Text]

10. Bouscarel B, Noonan F, Ceryak S, Gettys TW, Phillips TM, and De Fabo EC. Regulation of stimulated cyclic AMP synthesis by urocanic acid. Photochem Photobiol 68: 324–331, 1998.

11. Bouscarel B, Nussbaum R, Dubner H, and Fromm H. The role of sodium in the uptake of ursodeoxycholic acid in isolated hamster hepatocytes. Hepatology 21: 145–154, 1995.[CrossRef][Web of Science][Medline]

12. Ceryak S, Bouscarel B, Malavolti M, and Fromm H. Extrahepatic deposition and cytotoxicity of lithocholic acid: studies in two hamster models of hepatic failure and in cultured human fibroblasts. Hepatology 27: 546–556, 1998.[CrossRef][Web of Science][Medline]

13. Dawiskiba J, Kwiatkowska D, Zimecki M, Kornafel P, Tyran W, Czapinska E, and Wozniak Z. The impairment of wound healing process is correlated with abnormalities of TNF-{alpha} production by peritoneal exudate cells in obstructive jaundiced rats. HPB Surg 11: 311–318, 2000.[Medline]

14. DiBattista JA, Martel-Pelletier J, Fujimoto N, Obata K, Zafarullah M, and Pelletier JP. Prostaglandins E2 and E1 inhibit cytokine-induced metalloprotease expression in human synovial fibroblasts. Mediation by cyclic-AMP signalling pathway. Lab Invest 71: 270–278, 1994.[Web of Science][Medline]

15. Gettys TW, Okonogi K, Tarry WC, Johnston J, Horton C, and Taylor IL. Examination of relative rates of cAMP synthesis and degradation in crude membranes of adipocytes treated hormones. Second Messengers Phosphoproteins 13: 37–50, 1990.[Web of Science][Medline]

16. Ghent CN, Bloomer JR, and Klatskin G. Elevations in skin tissue levels of bile acids in human cholestasis: relation to serum levels and to pruritus. Gastroenterology 73: 1125–1130, 1977.[Web of Science][Medline]

17. Greim H, Trulzsch D, Czygan P, Rudick J, Hutterer F, Schaffner F, and Popper H. Mechanisms of cholestasis. 6. Bile acids in human livers with or without biliary obstruction. Gastroenterology 63: 846–850, 1972.[Web of Science][Medline]

18. Greim H, Trulzsch D, Roboz J, Dressler K, Czygan P, Hutterer F, Schaffner F, and Popper H. Mechanisms of cholestasis. 5. Bile acids in normal rat livers and in those after bile duct ligation. Gastroenterology 63: 837–845, 1972.[Web of Science][Medline]

19. Hedenborg G, Norlander A, and Norman A. Bile acid conjugates present in tissues during extrahepatic cholestasis. Scand J Clin Lab Invest 46: 539–544, 1986.[Web of Science][Medline]

20. Heldin NE, Paulsson Y, Forsberg K, Heldin CH, and Westermark B. Induction of cyclic AMP synthesis by forskolin is followed by a reduction in the expression of c-myc messenger RNA and inhibition of 3H-thymidine incorporation in human fibroblasts. J Cell Physiol 138: 17–23, 1989.[CrossRef][Web of Science][Medline]

21. Javitt NB, Keating JP, Grand RJ, and Harris RC. Serum bile acid patterns in neonatal hepatitis and extrahepatic biliary atresia. J Pediatr 90: 736–739, 1977.[CrossRef][Web of Science][Medline]

22. Kohout TA and Lefkowitz RJ. Regulation of G protein-coupled receptor kinases and arrestins during receptor desensitization. Mol Pharmacol 63: 9–18, 2003.[Free Full Text]

23. Kohyama T, Ertl RF, Valenti V, Spurzem J, Kawamoto M, Nakamura Y, Veys T, Allegra L, Romberger D, and Rennard SI. Prostaglandin E2 inhibits fibroblast chemotaxis. Am J Physiol Lung Cell Mol Physiol 281: L1257–L1263, 2001.[Abstract/Free Full Text]

24. Kolodsick JE, Peters-Golden M, Larios J, Toews GB, Thannickal VJ, and Moore BB. Prostaglandin E2 inhibits fibroblast to myofibroblast transition via E. prostanoid receptor 2 signaling and cyclic adenosine monophosphate elevation. Am J Respir Cell Mol Biol 29: 537–544, 2003.[Abstract/Free Full Text]

25. Lama V, Moore BB, Christensen P, Toews GB, and Peters-Golden M. Prostaglandin E2 synthesis and suppression of fibroblast proliferation by alveolar epithelial cells is cyclooxygenase-2-dependent. Am J Respir Cell Mol Biol 27: 752–758, 2002.[Abstract/Free Full Text]

26. Lee JL, Mukhtar H, Bickers DR, Kopelovich L, and Athar M. Cyclooxygenases in the skin: pharmacological and toxicological implications. Toxicol Appl Pharmacol 192: 294–306, 2003.[CrossRef][Web of Science][Medline]

27. Lewis B, Panveliwalla D, Tabaqchali S, and Wootoon IDP. Serum-bile acids in the stagnant-loop syndrome. Lancet 1: 219–220, 1969.[Web of Science][Medline]

28. Ma Z, Lee SS, and Meddings JB. Effects of altered cardiac membrane fluidity on beta-adrenergic receptor signalling in rats with cirrhotic cardiomyopathy. J Hepatol 26: 904–912, 1997.[CrossRef][Web of Science][Medline]

29. Makino I, Nakagawa S, and Mashimo K. Conjugated and unconjugated serum bile acid level in patients with hepatobiliary diseases. Gastroenterology 56: 1033–1039, 1969.[Web of Science][Medline]

30. Mallat A, Gallois C, Tao J, Habib A, Maclouf J, Mavier P, Preaux AM, and Lotersztajn S. Platelet-derived growth factor-BB and thrombin generate positive and negative signals for human hepatic stellate cell proliferation. Role of a prostaglandin/cyclic AMP pathway and cross-talk with endothelin receptors. J Biol Chem 273: 27300–27305, 1998.[Abstract/Free Full Text]

31. Matsumoto K, Okazaki H, and Nakamura T. Novel function of prostaglandins as inducers of gene expression of HGF and putative mediators of tissue regeneration. J Biochem (Tokyo) 117: 458–464, 1995.[Abstract/Free Full Text]

32. Molina MA, Sitja-Arnau M, Lemoine MG, Frazier ML, and Sinicrope FA. Increased cyclooxygenase-2 expression in human pancreatic carcinomas and cell lines: growth inhibition by nonsteroidal anti-inflammatory drugs. Cancer Res 59: 4356–4362, 1999.[Abstract/Free Full Text]

33. Muriel P and Castro V. Dose-response studies of interferon-{alpha}2b on liver fibrosis and cholestasis induced by biliary obstruction in rats. Pharmacology 54: 179–185, 1997.[Web of Science][Medline]

34. Ng PY and Hofmann AF. Tissue distribution of [114C]cholyglycine in rats and hamsters with a bile fistula or bile duct ligation. Proc Soc Exp Biol Med 154: 134–137, 1977.[Medline]

35. Nishioka K, Doki Y, Miyata H, Tamura S, Yasuda T, Kimura Y, Kishi K, Yoshida K, Fujiwara Y, Yano M, and Monden M. Bile acid promotes the proliferation of squamous cell carcinoma of the esophagus, independent of its inducing COX-2 expression. J Surg Res 132: 130–135, 2005.[Medline]

36. Nyman R, Eklof H, Eriksson LG, Karlsson BM, Rasmussen I, Lundgren D, and Thomsen P. Soft-tissue-anchored transcutaneous port for long-term percutaneous transhepatic biliary drainage. Cardiovasc Intervent Radiol 28: 53–59, 2005.[CrossRef][Web of Science][Medline]

37. Okuyama T, Ishihara S, Sato H, Rumi MA, Kawashima K, Miyaoka Y, Suetsugu H, Kazumori H, Cava CF, Kadowaki Y, Fukuda R, and Kinoshita Y. Activation of prostaglandin E2-receptor EP2 and EP4 pathways induces growth inhibition in human gastric carcinoma cell lines. J Lab Clin Med 140: 92–102, 2002.[Web of Science][Medline]

38. Piontek M, Hengels KJ, Porschen R, and Strohmeyer G. Protein kinase C and adenylate cyclase as targets for growth inhibition of human gastric cancer cells. J Cancer Res Clin Oncol 119: 697–699, 1993.[CrossRef][Web of Science][Medline]

39. Raiford DS. Pruritus of chronic cholestasis. QJM 88: 603–607, 1995.[Abstract/Free Full Text]

40. Samuelsson B, Goldyne M, Granstrom E, Hamberg M, Hammarstrom S, and Malmsten C. Prostaglandins and thromboxanes. Annu Rev Biochem 47: 997–1029, 1978.[CrossRef][Web of Science][Medline]

41. Sanchez T and Moreno JJ. Role of prostaglandin H synthase isoforms in murine ear edema induced by phorbol ester application on skin. Prostaglandins Other Lipid Mediat 57: 119–131, 1999.[CrossRef][Web of Science][Medline]

42. Sato T, Kirimura Y, and Mori Y. The co-cultured of dermal fibroblasts with human epidermal keratinocytes induces increased prostaglandin E2 production and cyclooxygenase activity in fibroblasts. J Invest Dermatol 109: 334–339, 1997.[CrossRef][Web of Science][Medline]

43. Schoenfield LJ, Sjovall J, and Perman E. Bile acids on the skin of patients with pruritic hepatobiliary disease. Nature 213: 93–94, 1967.

44. Setchell KDR, Lawson AM, Blackstock EJ, and Murphy A. Diurnal Changes in serum unconjugated bile acids in normal man. Gut 23: 637–642, 1982.[Abstract/Free Full Text]

45. Shattuck-Brandt RL, Varilek GW, Radhika A, Yang F, Washington MK, and DuBois RN. Cyclooxygenase 2 expression is increased in the stroma of colon carcinomas from IL-10(–/–) mice. Gastroenterology 118: 337–345, 2000.[CrossRef][Web of Science][Medline]

46. Shneider BL, Dawson PA, Christie DM, Hardikar W, Wong MH, and Suchy FJ. Cloning and molecular characterization of the ontogeny of a rat ileal sodium-dependent bile acid transporter. J Clin Invest 95: 745–754, 1995.[Web of Science][Medline]

47. Stolz A, Takikawa H, Ookhtens M, and Kaplowitz N. The role of cytoplasmic proteins in hepatic bile acid transport. Annu Rev Physiol 51: 161–176, 1989.[CrossRef][Web of Science][Medline]

48. Sung MW, Roh JL, Park BJ, Park SW, Kwon TK, Lee SJ, and Kim KH. Bile acid induces cyclo-oxygenase-2 expression in cultured human pharyngeal cells: a possible mechanism of carcinogenesis in the upper aerodigestive tract by laryngopharyngeal reflux. Laryngoscope 113: 1059–1063, 2003.[CrossRef][Web of Science][Medline]

49. Suzawa H, Kikuchi S, Ichikawa K, and Koda A. Inhibitory action of tranilast, an anti-allergic drug, on the release of cytokines and PGE2 from human monocytes-macrophages. Jpn J Pharmacol 60: 85–90, 1992.[Medline]

50. Tjandrawinata RR, Dahiya R, and Hughes-Fulford M. Induction of cyclo-oxygenase-2 mRNA by prostaglandin E2 in human prostatic carcinoma cells. Br J Cancer 75: 1111–1118, 1997.[Web of Science][Medline]

51. Tucker ON, Dannenberg AJ, Yang EK, and Fahey TJ III. Bile acids induce cyclooxygenase-2 expression in human pancreatic cancer cell lines 1. Carcinogenesis 25: 419–423, 2004.[Abstract/Free Full Text]

52. Uchio K, Tuchweber B, Manabe N, Gabbiani G, Rosenbaum J, and Desmouliere A. Cellular retinol-binding protein-1 expression and modulation during in vivo and in vitro myofibroblastic differentiation of rat hepatic stellate cells and portal fibroblasts. Lab Invest 82: 619–628, 2002.[CrossRef][Web of Science][Medline]

53. Van Dyke RW, Stephens JE, and Scharschmidt BF. Bile acid transport in cultured rat hepatocytes. Am J Physiol Gastrointest Liver Physiol 243: G484–G492, 1982.[Abstract/Free Full Text]

54. Varga J, Diaz-Perez A, Rosenbloom J, and Jimenez SA. PGE2 causes a coordinate decrease in the steady state levels of fibronectin and types I and III procollagen mRNAs in normal human dermal fibroblasts. Biochem Biophys Res Commun 147: 1282–1288, 1987.[CrossRef][Web of Science][Medline]

55. Watanabe T, Satoh H, Togoh M, Taniguchi S, Hashimoto Y, and Kurokawa K. Positive and negative regulation of cell proliferation through prostaglandin receptors in NIH-3T3 cells. J Cell Physiol 169: 401–409, 1996.[CrossRef][Web of Science][Medline]

56. Wilson JW and Potten CS. The effect of exogenous prostaglandin administration on tumor size and yield in Min/+ mice. Cancer Res 60: 4645–4653, 2000.[Abstract/Free Full Text]

57. Zhang F, Altorki NK, Mestre JR, Subbaramaiah K, and Dannenberg AJ. Curcumin inhibits cyclooxygenase-2 transcription in bile acid- and phorbol ester-treated human gastrointestinal epithelial cells. Carcinogenesis 20: 445–451, 1999.[Abstract/Free Full Text]

58. Zhang F, Altorki NK, Wu YC, Soslow RA, Subbaramaiah K, and Dannenberg AJ. Duodenal reflux induces cyclooxygenase-2 in the esophageal mucosa of rats: evidence for involvement of bile acids. Gastroenterology 121: 1391–1399, 2001.[CrossRef][Web of Science][Medline]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/3/C546    most recent
00011.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Meng, J. P.
Right arrow Articles by Bouscarel, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meng, J. P.
Right arrow Articles by Bouscarel, B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.