|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
NERVOUS SYSTEM CELL BIOLOGY
1Department of Pharmacological and Physiological Science, St. Louis University School of Medicine, St. Louis, Missouri; and 2Department of Neurobiology, Pharmacology and Physiology, University of Chicago, Chicago, Illinois
Submitted 15 October 2005 ; accepted in final form 31 January 2006
| ABSTRACT |
|---|
|
|
|---|
RNA interference; amperometry; exocytosis
Although a number of proteins are involved in the release of vesicles and are reported to be critical for release, one vesicle protein, synaptotagmin (syt), has been established as a Ca2+ sensor and regulator of both exo- and endocytosis (35, 40). The family of syt proteins is composed of at least 16 different genes, syt IXVI (9). Syt I, the best studied isoform, is composed of a short intravesicular NH2 terminus followed by a single transmembrane domain and two extravesicular Ca2+-binding domains, or C2 domains, that are highly conserved among species (36, 37). Subtle differences among Syt isoforms potentially lead to a large number of possible functions within this protein family (for review, see Ref. 45). Although many of the isoforms are integral vesicle membrane proteins found in neuronal and neuroendocrine vesicles (36), the isoforms vary in their ability to bind Ca2+ and to bind phospholipids as a function of Ca2+ through their two C2 domains (1, 10, 26, 40, 42, 48, 52, 54). Syt isoforms also can form homo- and heterooligomers that lead to further complexity of the syt family (25, 56).
Evidence from a number of systems indicates that syt I is involved in vesicle docking, fusion, and recycling (for reviews, see Refs. 43, 45). For example, fast synchronous release was abolished in mice and Drosophila that lack syt I, but slow asynchronous release remained (19, 57) and even compensated for the loss of fast synchronous release (33). Early evidence that syt I plays a role in secretion came from results with antibodies, recombinant fragments, and peptides designed against specific regions of syt I protein that interfered with vesicle release (12). Furthermore, because mutations in the syt I gene disrupted the fourth-order Ca2+ dependence of synchronous release, it was proposed that syt I is a Ca2+ sensor for regulated release of transmitter (15, 28, 42, 57). However, alternative explanations may explain the observations, as syt I may act to control the expression and trafficking of other proteins, or it may physically act as a link between the vesicle release machinery and the pore of the Ca2+ channel. Syt I also is abundantly localized in endocrine vesicle membranes of adrenal chromaffin cells and pheochromocytoma (PC12) cells. Both of these cells have been well utilized to study the mechanism of Ca2+-dependent transmitter release from vesicles. In this study, we investigated whether syt I is essential for Ca2+-evoked release of catecholamines in the model neuroendocrine PC12 cells by using plasmid-based RNA interference (RNAi) to establish a cell line in which syt I levels are stably and specifically reduced. Although viability, phenotype, and resting Ca2+ levels are not altered compared with control cells, syt I knockdown cells exhibit significantly reduced, but not eliminated, release of catecholamines.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
-actin mouse monoclonal antibodies were obtained from the Developmental Studies Hybridoma Bank (University of Iowa, Iowa City, IA). The anti-syt II and anti-syt VII goat antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA), and anti-syt III rabbit antibody was a generous gift from Dr. Bryan A. Wolf (University of Pennsylvania, Philadelphia, PA). The anti-syt IX mouse antibody was obtained from BD Biosciences-Pharmingen (termed syt V; San Diego, CA) and recognizes the isoform whose amino acid sequence begins with MFPEP. Anti-SNAP-25 and anti-VAMP-2 rabbit antibodies were obtained from Alomone Labs (Jerusalem, Israel); anti-syntaxin I mouse antibody was obtained from Medical and Biological Laboratories (Nagoya, Japan); and anti-synaptophysin I mouse monoclonal antibody was obtained from Chemicon (Temecula, CA). For immunoblots, horseradish peroxidase-conjugated secondary antibodies were obtained from Santa Cruz Biotechnology and also recognize the Cruz molecular weight standards. For immunocytochemistry, secondary goat-anti-mouse FITC-conjugated antibody was obtained from Jackson ImmunoResearch Laboratories (West Grove, PA). Plasmids. We constructed a plasmid designed to express short hairpin RNAs (shRNAs) from a U6 RNA polymerase III promoter and to allow selection of stably transfected cells with G418 (6). The vector (pG418-shRNA) was analyzed using extensive restriction enzyme digestion and partial sequencing. A human syt I plasmid was purchased from American Type Culture Collection (GenBank accession no. BC058917).
Design of shRNA insert. Target sites for silencing syt I were selected using Target Finder (Ambion, Austin, TX). Two complementary DNA oligonucleotides incorporating the chosen target site AGACTTAGGGAAGACCATG (bp 846864 of GenBank accession no. X52772), a loop sequence, and the reverse complement of the target site were designed. A nine-nucleotide loop sequence was used, TTCAAGAGA (4). The pair of 56-bp DNA oligonucleotides was purchased from Integrated DNA Technologies (Coralville, IA), 5' phosphorylated, and PAGE purified. The pair of oligonucleotides was annealed and ligated into pG418-shRNA digested with XbaI and BpiI. The resulting plasmid, termed shRNA-Syt I, was sequenced to ensure that the insert was present and correct.
Cell culture. An early passage of rat PC12 cells was maintained in culture according to standard methods (21, 22). Cells were grown in medium that consisted of RPMI 1640, 10% heat-inactivated horse serum, 5% fetal bovine serum, 100 U/ml penicillin, and 100 µg/ml streptomycin in a 37°C, 5% CO2 incubator. The cells were passaged every 7 days, and after 10 passages, a new vial of cells was thawed from stocks frozen in liquid nitrogen to help ensure minimal line drift. The cells were plated for either further passages or experimentation. Cells were treated with 200 ng/ml nerve growth factor (NGF; 2.5S grade II from mouse submaxillary gland; Roche, Indianapolis, IN) for 512 days until use.
Transfection.
Cells were transfected with 4 µg of transfection grade shRNA-syt I plasmid DNA or shRNA plasmid that did not contain an insert (referred to as control transfection, or CT) per 35-mm tissue culture plate of cells with Lipofectamine 2000 (Invitrogen, Carlsbad, CA) as described previously (23). Cells were replated 24 h later. Selection media that contained 100 µg/ml G418 (Sigma, St. Louis, MO) was added to the cells 24 h after replating. This concentration of G418 was found to be optimal to kill untransfected cells. Cells grew in selection medium up to
28 days, and single colonies were picked from the plates and expanded for freezing and testing for stable incorporation of the shRNAs.
PCR.
Drug-resistant cell lines were screened for insertion of shRNA plasmids into the genome by PCR with genomic DNA, plasmid-specific primers, and MasterTaq PCR reagents (Eppendorf, Westbury, NY). PCR reactions were performed with 35 cycles of 95°C for denaturing (30 s), 54°C for annealing (1 min), and 72°C for elongating (1 min). A final elongation step was run for 10 min at 72°C. The plasmid-specific primers were designed to match sequences on either side of the multiple cloning site to determine whether the plasmid had incorporated into the genome. The forward primer matched the plasmid sequence 100-bp 5' from the KpnI site in the multiple cloning site (GGCGATTAAGTTGGGTAACG) and was used with the reverse primer that was situated about 100 bp into the PGK polyA tail and 3' to the multiple cloning site (GCCTGAAGAACGAGATCAGC). This set of primers resulted in a PCR product of
570 bp for the empty plasmid (shRNA) and
600 bp for the plasmid that contained the insert (shRNA-syt I). Because PC12 cells can develop spontaneous resistance to G418, we determined that cell lines that tested positive with the primers described above also tested positive for the neomycin cassette. A second set of primers was designed to match sequences within the neomycin cassette; the forward primer was GACAATCGGCTGCTCTGATG, and the reverse primer was ACCATGATATTCGGCAAGCA. Incorporation of the neomycin resistance cassette resulted in a PCR product of 512 bp with this set of primers.
Immunoblot analysis. Cells were grown in culture to confluency, removed from the plates, washed, and lysed by resuspension in buffer containing 20 mM Tris, pH 7.5, 1% Triton X-100, 10% glycerol, 2 mM EDTA, and 0.1% protease inhibitor cocktail (Sigma). After 30 min on ice, the cells were sonicated for three short bursts and centrifuged for 2 min at 16,000 g at 4°C. Portions of the supernatant were used to determine protein concentration (see below) or mixed with lithium dodecyl sulfate (LDS) loading buffer (Invitrogen). Crude membranes were prepared from rat cerebellum by homogenization for 10 s on ice in 20 mM Tris, pH 7.5, 2 mM EDTA, and 0.25 M sucrose using a Polytron. After incubation for 1 min on ice, the homogenization was repeated three times. The tissue was further disrupted in a Dounce homogenizer with 15 strokes and centrifuged for 10 min at 1,000 g at 4°C. The supernatant was collected and centrifuged for 30 min at 16,000 g at 4°C. The supernatant was removed, and the pellet was resuspended in homogenization buffer without sucrose. Protein concentration was determined with Coomassie Plus protein assay reagent (Pierce, Rockford, IL) with BSA as a standard. The protein was mixed with LDS loading buffer and heated to 70°C for 10 min.
Total lysates were electrophoresed on a 10% NuPAGE Bis-Tris gel (Invitrogen), transferred to polyvinylidene difluoride membrane (Millipore, Billerica, MA), and blocked overnight at 4°C in 5% nonfat dried milk in Tris-buffered saline with 0.1% Tween 20. The membrane was incubated with primary antibody (all 1:1,000 dilutions except synaptophysin, used at 1:5,000 dilution), followed by a horseradish peroxidase-conjugated secondary antibody used at dilutions that ranged from 1:30,000 to 1:50,000 (Santa Cruz Biotechnology). Immunoreactive bands were detected and visualized using ECL Advance reagent (GE Healthcare, Piscataway, NJ), exposed to X-ray film, and developed. A positive control tissue or cellular lysate that is known to express the particular syt isoform protein of interest was included on each immunoblot. Rat cerebellar tissue was used for syt I, II, and IX, and the RINm5F pancreatic
-cell line was used for syt III and VII (generously provided by Dr. John Corbett, St. Louis University, St. Louis, MO). All immunoblots are representative of three or more independent experiments. Quantitative analysis of the immunoblots was performed with ImageJ (http://rsb.info.nih.gov/ij/) and normalized to arbitrary densitometry units of
-actin.
Immunocytochemistry. Cells were replated to collagen-treated Permonox chamber slides and fixed 1 (PC12 cells) or 2 days later (NGF-PC12 cells) with 2% paraformaldehyde. The cells were permeabilized with 0.1% Triton X-100, blocked with 2 mg/ml BSA, and incubated with anti-syt I mouse monoclonal antibody (1:5 dilution) or anti-syt IX mouse antibody (1:200 dilution), blocked, and incubated with a secondary goat-anti-mouse FITC-conjugated antibody (1:200; Jackson ImmunoResearch Laboratories). The cells were washed, mounted with Vectashield (Vector Laboratories, Burlingame, CA), and sealed. Images were acquired using a scanning confocal microscope (Bio-Rad MRC 1024; Hercules, CA) with a 4x zoom on a 60x oil-immersion lens (NA 1.4). For the human syt I rescue experiments, cells were permeabilized with 0.1% Triton X-100, blocked with 10% normal goat serum in PBS, and incubated with anti-syt I mouse monoclonal antibody (1:5 dilution), blocked, and incubated with a secondary rhodamine red-X-conjugated AffiniPure donkey anti-rabbit IgG (H+L) (1:2,000; Jackson ImmunoResearch Laboratories), sealed, and mounted as described above. Images were acquired using a 3x zoom on a 60x oil-immersion lens (NA 1.4). All immunocytochemistry results are representative of three or more independent experiments.
Ca2+ imaging. Intracellular Ca2+ concentrations ([Ca2+]i) were measured using ratiometric fluorescence imaging with fura-2. Cells were replated 48 h before experimentation, loaded with fura-2, and prepared for recording as described previously (23). For each experiment, 2040 cells were selected and individually imaged using a commercial imaging system (InCytIM2; Intracellular Imaging, Cincinnati, OH). Image pairs were obtained every 10 s at 340- and 380-nm wavelengths. Backgrounds were subtracted from each wavelength, and the 340-nm image was divided by the 380-nm image to provide a ratiometric image. Ratios were converted to free [Ca2+]i by comparing data with fura-2 calibration curves made in vitro by adding fura-2 (50 µM free acid) to solutions that contained known Ca2+ concentrations (0 to 602 nM; Molecular Probes-Invitrogen). Cells were exposed to a high-K+ solution that contained (in mM) 50 KCl, 87 NaCl, 1 MgCl2, 5 CaCl2, 10 D-glucose, and 12 HEPES (pH 7.3). Resting Ca2+ level was determined from the average of measurements from all cells in four independent experiments during the 60 s before stimulation. The change in Ca2+ was calculated from the five points during the peak change in Ca2+ levels that occurred in response to stimulation.
Amperometry. Carbon fibers (6-µm diameter; Goodfellow, Huntingdon, UK) were threaded into electrodes, pulled with a vertical puller, sealed with epoxy, painted with Sylgard (Dow-Corning, Midland, MI), and stored at 95°C until use. A newly cut surface of a carbon fiber electrode (5) was gently pressed against the side of a cell, because the collection efficiency of detectable events is thought to provide the highest yield in this recording configuration (5, 39). The electrode was backfilled with 3 M KCl and clamped at +700 mV versus a Ag-AgCl ground with an NPI amplifier (ALA Scientific, Westbury, NY) to detect the oxidized catecholamine transmitter. The signal was low-pass filtered at 2 kHz (8-pole Bessel; Warner Instruments, Hamden, CT). A 16-bit analog-to-digital converter (National Instruments, Austin, TX) was interfaced with custom-written software (graciously provided by Dr. Aaron P. Fox, University of Chicago, Chicago, IL), acquired at 10 kHz, and stored on a personal computer. Root mean square (RMS) noise was typically <1 pA. Amperometric spike features such as amplitude, quantal charge, and kinetic parameters were analyzed using custom-written analysis software (graciously provided by Dr. Eugene Mosharov, Columbia University, New York, NY). The detection threshold for an event was set for five times the baseline RMS noise level, and no trace was analyzed with RMS noise >2.5 pA. Overlapping events, those whose spike had not returned to baseline before the next event, were not considered in the analysis even though they were uncommon events. Rise time was measured over 1090% of the spike's maximal amplitude. The area under individual amperometric spikes is equal to the charge (Q, measured in pC) per release event.
Recording.
Cells were treated with NGF for 510 days, replated to glass coverslips, and cultured overnight. Before recordings, cells were preloaded with 200 nM norepinephrine (Sigma) for 25 h at 37°C. Recordings were conducted on adherent cells exposed to constant and uniform perfusion (
1 ml/min) in a recording chamber with an approximate volume of 200 µl. Cells were perfused for 510 min with Hanks' buffered salt solution (HBSS), and recording was begun during the HBSS perfusion for
20 s during recording for basal release before changing to a high (50 mM)-K+ solution for stimulation of transmitter release for the remainder of the 4-min recording period. All experiments were performed at ambient temperature, 2224°C.
Catecholamine measurements. Catecholamines were identified and quantified using high-performance liquid chromatography (HPLC)-electrochemical detection, as previously described (7, 11), from cells treated with NGF for 1012 days. Release was stimulated with a 50 mM K+ solution. The system consists of a Varian Pro-Star solvent delivery system and a model 9090 autosampler (Varian) coupled to a C18 column and an ESA Coulochem II detector. Separations were performed isocratically with the use of a filtered and degassed mobile phase consisting of 12% methanol, 0.1 M sodium phosphate, 0.2 mM sodium octyl sulfate, and 0.1 mM EDTA, adjusted to pH 2.7 with phosphoric acid. A computer was used to collect and store the chromatograms that were analyzed using Varian Star software.
Syt I rescue. We confirmed by sequencing that the target sequence of the shRNA for syt I differed by four base pairs from the human syt I plasmid. Because of this four-nucleotide difference, human syt I should not be silenced by the shRNA. Syt I knockdown cells were treated with NGF and transiently transfected for 2 days with the human syt I plasmid before experimentation.
Statistical analysis. All data are displayed as means ± SE, and Student's t-test was used to compare significance.
| RESULTS |
|---|
|
|
|---|
85% or greater. Therefore, we stably transfected cells with a plasmid designed to make hairpin RNAs and generated a homogeneous population of cells that express shRNAs. PC12 cells were stably transfected with two different plasmids, the shRNA-syt I plasmid and a plasmid that lacked an insert that was used as a positive control for the transfection (referred to as control transfection, or CT). Colonies were expanded, and genomic DNA was prepared from each of the stable cell lines. PCR was used to test for incorporation of the shRNA plasmid into genomic DNA with specific primers that recognized a sequence of the plasmid flanking the insert (and that does not recognize any known genomic sequence), or within the neomycin resistance cassette of the plasmid.
RNAi stably knocks down syt I expression. We tested whether syt I expression was specifically "silenced" in cells stably transfected with shRNA-syt I using immunoblot analysis. Lysates were made from cells expressing the shRNA designed to recognize and reduce the expression of syt I (shRNA-syt I) and from cells stably transfected with the empty vector (CT). Expression of proteins from these cells was compared with expression of syt I in untransfected PC12 cells and rat cerebellum as controls. Blots were probed with an anti-syt I antibody to detect a band of 65 kDa, the expected apparent molecular weight. Six of the seven shRNA empty plasmid cell lines (CT) tested positive for the plasmid with PCR and did not exhibit a reduction in expressed syt I as expected. In contrast, the four shRNA-syt I cell lines that tested positive for the shRNA insert by PCR exhibited varying degrees of reduction in expressed syt I protein. We continued experimentation with one of each of the stable cell lines, and all experiments described were performed with lines termed CT and shRNA-syt I. In addition, both of these lines tested positive for incorporation of neomycin resistance cassette by PCR. Figure 1A, top, shows a blot probed with the anti-syt I antibody. Both the untransfected PC12 cells (control) and the empty vector stable cells (CT) have a detectable band of protein at 65 kDa compared with cells expressing the shRNA designed specifically to knockdown syt I (shRNA-Syt I). Syt I levels in the knockdown cells were 0.02% of those in control cells (Fig. 1A, bottom), which was not different from zero.
|
To determine whether suppression of protein expression is specific for syt I, we performed immunoblot analysis to test whether the shRNA-syt I and CT cell lines exhibited a reduction in protein expression for syt IX, the most abundantly expressed syt isoform and one that is similar in sequence to Syt I. We also tested whether additional proteins involved in regulated secretory vesicle release were altered in their expression, such as SNAP-25, VAMP-2 (or synaptobrevin), syntaxin I, and a structural protein,
-actin. Figure 1A shows that cells stably transfected with shRNA-syt I specifically suppressed the expression of syt I. The shRNA-syt I cells were tested for low abundance expression by using increasing concentrations of loaded protein amounts. Even with 20 µg of lysate protein, the shRNA-syt I cells did not express detectable syt I protein (Fig. 1B). Syt IX was not affected by the shRNA-syt I, because the shRNA-syt I cells express syt IX at levels equivalent to that of the CT cells. Furthermore, none of the tested proteins exhibited any significant changes in expressed protein levels in the syt I knockdown cells compared with the CT cells. Thus RNAi targeted against syt I effectively and specifically knocked down expression of syt I in stably transfected cells.
In addition to specificity of knockdown, a primary concern with RNAi is whether suppression of one gene product results in compensatory upregulation of closely related gene products. We used immunoblot analysis to determine whether syt II, III, or VII was upregulated. Figure 1C shows that neither syt III nor syt VII exhibit an upregulation of protein expression in the shRNA-syt I cells compared with the CT cells. Each of the isoforms is shown compared with control tissue, cerebellum (syt II) or RINm5F pancreatic
cells (syt III and VII). Syt II was not detectable as expected.
Neither syt I protein expression nor knockdown of syt I decreases with time in culture. Because PC12 cells are maintained in culture for multiple passages, it was important to verify that endogenous syt I protein levels do not decrease with time in culture and therefore do not provide a false interpretation of RNAi in syt I knockdown stable cells. Immunoblot analysis was used to evaluate the expression levels of syt I with time in passage for PC12 cells and stably transfected shRNA-syt I cells. The expression levels of syt I did not decrease with time in culture for at least seven passages in control cells (data not shown). Furthermore, syt I in the stably transfected cell line remained stably knocked down for at least 9 wk when the cells were cultured in the presence of selection media.
To determine whether the cellular expression patterns of syt I and IX were affected in the syt I knockdown cells, we performed immunocytochemistry on both undifferentiated and NGF-treated cells to detect syt I and syt IX in untransfected control cells, shRNA-syt I cells, and CT cells. Figure 2 shows confocal images of single cells expressing syt I (A) and syt IX (B). The syt I knockdown cells did not express detectable syt I, whereas control cells and cells stably transfected with the shRNA plasmid did express syt I. syt IX expression was not affected in the syt I knockdown cells. From the images, regardless of NGF treatment, both syt I and IX appear to be expressed in the cytoplasm of the cell and along the surface of the cellular membrane, but are largely excluded from the nucleus. These data are similar to those reported for syt I and IX proteins localized to vesicle membrane (16, 17, 29). This experiment confirms at the cellular level that RNAi targeted against syt I completely and specifically knocked down expression of syt I in individual PC12 cells without affecting the other abundantly expressed syt IX protein.
|
Stable syt I knockdown cells have normal resting Ca2+ levels and respond to high-K+ stimulation. To determine whether cells stably transfected with shRNA-syt I have altered resting Ca2+ levels or altered Ca2+ influx in response to stimulation, we performed Ca2+ imaging experiments on individual cells with the Ca2+ indicator fura-2. Figure 3 shows averaged fura-2 imaging experiments. Each panel shows a representative group of cells imaged from one dish of cells. Average Ca2+ concentration is plotted as a function of time for control PC12 cells (Fig. 3A), shRNA-syt I cells (Fig. 3B), and CT cells (Fig. 3C). For each group of cells, data were averaged at each time point for all of the cells imaged. The cells were stimulated with 50 mM K+ solution (solid bar above each graph). Average values for resting Ca2+ and the change in [Ca2+]i are shown in the summary graph (Fig. 3D). Syt I knockdown cells did not exhibit any differences in resting Ca2+ compared with control untransfected or CT cells. When the cells were stimulated, syt I knockdown cells responded with a somewhat greater change in Ca2+ influx (P < 0.01) that is most likely due to the cells lacking Ca2+ binding sites, because each syt I molecule can coordinate 5 Ca2+ ions (14, 38).
|
20 s in a basal level K+ solution before switching to the high-K+ stimulating solution. Stimulated release events are shown as upward events that occurred after high-K+ solution was applied. The control cell (Fig. 4A, left) had 157 events after the stimulating solution was applied, whereas the shRNA-syt I cell (Fig. 4A, right) had 64 events. These cells are representative of the average number of events for the control cells (160 ± 52 events), the syt I knockdown cells (60 ± 22 events), and CT cells (155 ± 37 events) (Fig. 4C). The total number of events analyzed was 1,119 events for control cells (n = 7), 417 events for syt I knockdown cells (n = 7), and 1,399 events for CT cells (n = 9). Although the averaged number of events per cell was not significantly different (Student's t-test), there was an approximately two-thirds reduction in the total number of events in the shRNA-syt I knockdown cells compared with the control cells.
|
Expression of human syt I can rescue catecholamine secretion. To determine whether the reduced secretion in shRNA-syt I knockdown cells is actually due to lack of syt I, we attempted to rescue secretion by transiently transfecting the shRNA-Syt I knockdown cells with a plasmid designed to express human syt I. Human syt I differs from rat syt I in 4 of the 19 nucleotides in the shRNA target region. Therefore, human syt I mRNA should not be subject to RNAi elicited by the shRNA used in this study, which targets rat syt I. Using immunocytochemistry, we established that human syt I is indeed expressed in syt I knockdown cells transiently transfected with the human syt I expression plasmid (Fig. 4D). To determine whether the exogenously expressed human syt I protein functions similarly to endogenous rat syt I, we measured release events using amperometry from syt I cells transiently cotransfected with plasmids expressing human syt I and green fluorescent protein. Expression of green fluorescent protein was used to identify transfected cells. The average number of release events per cell measured in the syt I knockdown cells expressing human syt I (114 events ± 10, n = 7 cells, 798 total events) was not significantly different from the number of release events measured in either the control untransfected or CT cells (Fig. 4C). Because expression of human syt I rescued the secretion deficit observed in syt I knockdown cells, the decrease in secretion most likely is due to lack of syt I and is unlikely to be due simply to clonal variability between cell lines.
Catecholamine release is reduced determined by HPLC. To confirm that the reduction in release events measured in single cells with amperometry is reflective of a reduction of release from the cell lines, we used HPLC to quantify stimulated release of catecholamine from fields of cells. NGF-treated cells were stimulated with high-K+ solution for 5 min to evoke Ca2+-dependent vesicle release of the catecholamines norepinephrine and dopamine. Figure 4E shows the stimulated fractional release of norepinephrine and dopamine expressed as a percentage of total norepinephrine or dopamine content of the cells, respectively. Average stimulated fractional release of norepinephrine was reduced by 58% and that of dopamine by 51% in syt I knockdown cells compared with control cells (P < 0.001, n = 6 for each set of cells). Average basal fractional release was <0.85% (data not shown) for the same sets of experiments.
Quantal charge and kinetic characteristics are reduced in syt I knockdown cells. Quantification of the individual events shows that peak amplitude was reduced in shRNA-syt I cells. Peak amplitude of the averaged events was 15.6 ± 0.9 pA for control cells (n = 1,119) and 7.2 ± 0.6 pA for syt I knockdown cells (n = 417; P < 0.01) (Fig. 5A). Similarly, the kinetic rate of rise was significantly reduced from 27.3 pA/ms (±2.3 pA/ms) in control cells to 13.4 pA/ms (±1.9 pA/ms; P < 0.01) in syt I knockdown cells (Fig. 5B). The rising phase was reduced from 1.35 ms (±0.05 ms) in control cells to 1.11 ms (±0.08 ms) in syt I knockdown cells (P < 0.01). The bar histograms shown in Fig. 5, A and B, for peak amplitude and rate of rise kinetic parameters reveal that the distribution of events is different in the syt I knockdown cells compared with control cells.
|
170). To show the kinetics of the fusion pore opening, these averaged spikes from two individual cells are depicted in Fig. 6A : one control and one shRNA-syt I knockdown cell. The spike amplitude, rising phase, falling phase, time to half-width, and quantal charge were measured as indicated by arrows for the averaged spike event from each cell. The quantal charge was calculated by integrating the area under the curve. From this comparison, the difference between the amplitudes and rate of rise is apparent. These data can be interpreted to mean that the fusion pore opening does not occur with the same kinetics for the syt I knockdown cells as for the control cells.
|
| DISCUSSION |
|---|
|
|
|---|
Syt I knockdown was specific in that expression of syt I was abolished in the syt I knockdown cells, whereas other vesicle and structural protein expression levels were unaffected. Syt I knockdown cells did not exhibit either a reduction or compensatory upregulation of other endogenously expressed syt isoforms that bind phospholipids in a Ca2+-dependent manner, including the highly abundant syt IX isoform or the much less abundant syt III or VII isoforms. syt II, an isoform that is closely related to syt I in sequence and that has been postulated to be functionally complementary to syt I, is an isoform that is not expressed in the cells as protein even though the transcript is made in these cells. Syt II expression was not upregulated when syt I was abolished in the syt I knockdown cells.
We have begun to characterize the functional effects of removing syt I on catecholamine secretion from the neuroendocrine cells. Syt I knockdown cells exhibited reduced secretion events as measured using amperometry and reduced fractional catecholamine release as measured using HPLC. As a test of specificity of the shRNA, expression of human syt I not targeted by the shRNA reversed the effects of the syt I knockdown by functionally rescuing the secretion events. Quantitative kinetic analysis of the amperometric events shows that amplitude, quantal charge, rate of rise, half-width, and falling phase all were significantly reduced in the syt I knockdown cells compared with control cells. The amplitude of the spike events was reduced to 50% of control, and quantal charge was reduced, which translated to a sixfold decrease in catecholamine molecules released. This result may be due to 1) reduced time or size of pore opening, 2) reduced vesicle size and thus volume of stored transmitter, or 3) reduced numbers of transmitter molecules packaged in vesicles. Although our current results do not allow us to directly distinguish among these three possibilities, the measurements of reduced rate of rise time, reduced half-width, and reduced falling phase of the amperometric spike events in syt I knockdown cells are consistent with the idea that the fusion pore may remain open for a shorter time than in control cells.
The partial reduction of catecholamine secretion seen in our syt I knockdown cells is similar to the
60% reduction in catecholamine release measured using real-time amperometry in cracked PC12 cells after the introduction of recombinant C2A-C2B domain from syt I (51). The C2A-C2B domain presumably competes with endogenous Syt I for binding to Ca2+ and the SNARE complex, thus inhibiting the usual function of syt I. However, our data vary from results in chromaffin cells obtained from syt I knockout mice (53). In their studies of secretion from Ca2+-dialyzed chromaffin cells in adrenal slices, the authors found that the Ca2+ dependence of release was altered, exocytosis of large dense-core vesicles was delayed, and Ca2+-dependent fusion rates were slowed as measured using membrane capacitance techniques (53). They did not detect differences in amperometric release events between wild-type and syt I knockout cells. One possibility for the differences between our study and that of Voets et al. (53) may be the stimulation protocols for vesicle release. Because Voets et al. used Ca2+ dialysis to stimulate, the release machinery may have become saturated with Ca2+ and caused the subsequent shift in Ca2+ dependence of vesicle release, whereas our stimulation protocol may not have saturated the release machinery. This possible explanation would fit well with results measured in wild-type chromaffin cells that exhibit a strong Ca2+ dependence for release of vesicle content; that is, for small Ca2+ influx, only a fraction of the contents of vesicles is released, but with strong stimulation and hence a large Ca2+ influx, all of the vesicle content is released (13).
In a spontaneously occurring mutant line of PC12 cells that lacked the syt I isoform, Ca2+-dependent secretion of dopamine as measured by HPLC was normal compared with that in wild-type PC12 cells (41). This observation led to the suggestion that neuroendocrine cells do not require syt I and that an alternative protein may function as the Ca2+ sensor for release (41). Our data differ from the mutant PC12 cell data, because the syt I knockdown cells exhibited differences in release of catecholamine compared with the parent cell line. It is not known at this time whether the differences between our results may arise from methodological measurement of secretion, variations between the PC12 cell lines, or the proteins that act to regulate Ca2+-dependent release. Yet another experimental difference between our results and the data for mutant PC12 cells that lack syt I is that the mutant cells exhibited an upregulation of syt IX expression compared with control cells, whereas our syt I knockdown cells did not exhibit any upregulation in syt IX. Even so, our results agree with the interpretation that additional proteins may function as regulators of evoked vesicle release.
Previous work has led to the suggestion that a protein other than Syt I has a role as a Ca2+ sensor in rapid, regulated release. Syt I deletion studies performed in various organisms such as Drosophila (29), Caenorhabditis elegans (34), and mice (19) revealed that syt I was required for fast synaptic release of neurotransmitter. In syt I knockout mice, fast synchronous release was abolished, but slow asynchronous release was still evident (19) and even increased to match the synchronous release of wild-type neurons, which led to the hypothesis that syt I inhibits slow asynchronous release (32, 33). Furthermore, upon either altering or neutralizing the Ca2+-binding pockets of the C2 domains by point mutagenesis, the Ca2+ dependency of release was shifted, which suggested that the C2A domain cannot represent the Ca2+ sensor in its entirety but, rather, is a necessary but not sufficient component of the sensor required for fast neurotransmission in the central nervous system (42). Additional experiments in a variety of systems have shown that interfering with either the C2A or C2B domain, or with Ca2+ ions, SNARE complex proteins, and/or phospholipid binding of syt I, results in altered secretion of vesicles (18, 27, 30, 49, 55).
To account for the remaining Ca2+-dependent fusion events, cells would require an additional protein to compensate as a Ca2+ sensor. Likely candidates include one of the additional Syt isoforms endogenously expressed by the cells, such as syt IX, or the less abundant syt isoforms, syt III or VII. Our results showing that syt I and IX are the two most abundant isoforms of syt expressed agree well with other reports of syt isoform expression in PC12 cells (16, 51, 59). Low expression levels of syt VII have been reported in PC12 cells (51). There is a discrepancy as to whether syt III is expressed; for example, Tucker et al. (51) did not detect syt III, but Sugita et al. (47) did detect this isoform. Both syt III and VII have been proposed to act as Ca2+ sensors (24, 46, 47), because recombinant fragments of the C2 domains of these isoforms inhibited secretion from cracked PC12 cells (51), and syt VII can function as a high-affinity Ca2+ sensor for secretion of large dense-core vesicles in PC12 cells (24).
In conclusion, this study has established a neuroendocrine cell line that utilizes the plasmid-based RNAi method to stably, specifically, and completely knock down expression of syt I in a homogenous population of cells. Release studies show that syt I knockdown cells have reduced release events and reduced amounts of transmitter released that may be due to a reduced open time of the fusion pore. These results support a role for syt I as a functional Ca2+ sensor, but not an exclusive Ca2+ sensor. RNAi-induced effects are unlikely to be due to a lack of Ca2+ ions, given that Ca2+ influx was similar between knockdown and control cells. Furthermore, it is unlikely that one of the other endogenously expressed syt isoforms or the closely related isoform, syt II, has compensated functionally for the lack of syt I.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
-actin antibody developed by Drs. Jim Jung and Ching Lin were obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the National Institute of Child Health and Human Development and maintained by The University of Iowa Dept. of Biological Sciences, Iowa City, IA 52242. | FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Bajjalieh S. SNAREs take the stage: a prime time to trigger neurotransmitter secretion. Trends Neurosci 24: 678680, 2001.[CrossRef][Web of Science][Medline]
3. Bajjalieh SM and Scheller RH. The biochemistry of neurotransmitter secretion. J Biol Chem 270: 19711974, 1995.
4. Brummelkamp TR, Bernards R, and Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science 296: 550553, 2002.
5. Bruns D, Riedel D, Klingauf J, and Jahn R. Quantal release of serotonin. Neuron 28: 205220, 2000.[CrossRef][Web of Science][Medline]
6. Cahill AL, Herring BE, and Fox AP. Stable silencing of SNAP-25 in PC12 Cells by RNA interference. BMC Neurosci 7: 9, 2006; doi:10.1186/1471-2202-7-9.[CrossRef][Medline]
7. Chen X and Westfall TC. Modulation of intracellular calcium transients and dopamine release by neuropeptide Y in PC-12 cells. Am J Physiol Cell Physiol 266: C784C793, 1994.
8. Chow RH, von Ruden L, and Neher E. Delay in vesicle fusion revealed by electrochemical monitoring of single secretory events in adrenal chromaffin cells. Nature 356: 6063, 1992.[CrossRef][Medline]
9. Craxton M. Synaptotagmin gene content of the sequenced genomes. BMC Genomics 5: 43, 2004; doi:10.1186/1471-2164-5-43.[CrossRef][Medline]
10. Davis AF, Bai J, Fasshauer D, Wolowick MJ, Lewis JL, and Chapman ER. Kinetics of synaptotagmin responses to Ca2+ and assembly with the core SNARE complex onto membranes. Neuron 24: 363376, 1999.[CrossRef][Web of Science][Medline]
11. DiMaggio DA, Farah JM Jr, and Westfall TC. Effects of differentiation on neuropeptide-Y receptors and responses in rat pheochromocytoma cells. Endocrinology 134: 719727, 1994.
12. Elferink LA, Peterson MR, and Scheller RH. A role for synaptotagmin (p65) in regulated exocytosis. Cell 72: 153159, 1993.[CrossRef][Web of Science][Medline]
13. Elhamdani A, Palfrey HC, and Artalejo CR. Quantal size is dependent on stimulation frequency and calcium entry in calf chromaffin cells. Neuron 31: 819830, 2001.[CrossRef][Web of Science][Medline]
14. Fernandez I, Arac D, Ubach J, Gerber SH, Shin O, Gao Y, Anderson RG, Sudhof TC, and Rizo J. Three-dimensional structure of the synaptotagmin 1 C2B-domain: synaptotagmin 1 as a phospholipid binding machine. Neuron 32: 10571069, 2001.[CrossRef][Web of Science][Medline]
15. Fernandez-Chacon R, Konigstorfer A, Gerber SH, Garcia J, Matos MF, Stevens CF, Brose N, Rizo J, Rosenmund C, and Sudhof TC. Synaptotagmin I functions as a calcium regulator of release probability. Nature 410: 4149, 2001.[CrossRef][Medline]
16. Fukuda M. RNA interference-mediated silencing of synaptotagmin IX, but not synaptotagmin I, inhibits dense-core vesicle exocytosis in PC12 cells. Biochem J 380: 875879, 2004.[CrossRef][Web of Science][Medline]
17. Fukuda M, Kowalchyk JA, Zhang X, Martin TF, and Mikoshiba K. Synaptotagmin IX regulates Ca2+-dependent secretion in PC12 cells. J Biol Chem 277: 46014604, 2002.
18. Fukuda M, Moreira JE, Lewis FM, Sugimori M, Niinobe M, Mikoshiba K, and Llinas R. Role of the C2B domain of synaptotagmin in vesicular release and recycling as determined by specific antibody injection into the squid giant synapse preterminal. Proc Natl Acad Sci USA 92: 1070810712, 1995.
19. Geppert M, Goda Y, Hammer RE, Li C, Rosahl TW, Stevens CF, and Sudhof TC. Synaptotagmin I: a major Ca2+ sensor for transmitter release at a central synapse. Cell 79: 717727, 1994.[CrossRef][Web of Science][Medline]
20. Gerst JE. SNAREs and SNARE regulators in membrane fusion and exocytosis. Cell Mol Life Sci 55: 707734, 1999.[CrossRef][Web of Science][Medline]
21. Greene LA, Aletta JM, Rukenstein A, and Green SH. PC12 pheochromocytoma cells: culture, nerve growth factor treatment, and experimental exploitation. Methods Enzymol 147: 207216, 1987.[Web of Science][Medline]
22. Greene LA and Tischler AS. Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc Natl Acad Sci USA 73: 24242428, 1976.
23. Harkins AB, Cahill AL, Powers JF, Tischler AS, and Fox AP. Expression of recombinant calcium channels support secretion in a mouse pheochromocytoma cell line. J Neurophysiol 90: 23252333, 2003.
24. Hui E, Bai J, Wang P, Sugimori M, Llinas RR, and Chapman ER. Three distinct kinetic groupings of the synaptotagmin family: candidate sensors for rapid and delayed exocytosis. Proc Natl Acad Sci USA 102: 52105214, 2005.
25. Leveque C, Hoshino T, David P, Shoji-Kasai Y, Leys K, Omori A, Lang B, el Far O, Sato K, Martin-Moutot N, Newsom-Davis J, Takahashi M, and Seagar M. The synaptic vesicle protein synaptotagmin associates with calcium channels and is a putative Lambert-Eaton myasthenic syndrome antigen. Proc Natl Acad Sci USA 89: 36253629, 1992.
26. Li C, Davletov BA, and Sudhof TC. Distinct Ca2+ and Sr2+ binding properties of synaptotagmins. Definition of candidate Ca2+ sensors for the fast and slow components of neurotransmitter release. J Biol Chem 270: 2489824902, 1995.
27. Littleton JT, Bai J, Vyas B, Desai R, Baltus AE, Garment MB, Carlson SD, Ganetzky B, and Chapman ER. Synaptotagmin mutants reveal essential functions for the C2B domain in Ca2+-triggered fusion and recycling of synaptic vesicles in vivo. J Neurosci 21: 14211433, 2001.
28. Littleton JT, Stern M, Perin M, and Bellen HJ. Calcium dependence of neurotransmitter release and rate of spontaneous vesicle fusions are altered in Drosophila synaptotagmin mutants. Proc Natl Acad Sci USA 91: 1088810892, 1994.
29. Littleton JT, Stern M, Schulze K, Perin M, and Bellen HJ. Mutational analysis of Drosophila synaptotagmin demonstrates its essential role in Ca2+-activated neurotransmitter release. Cell 74: 11251134, 1993.[CrossRef][Web of Science][Medline]
30. Llinas RR, Sugimori M, Moran KA, Moreira JE, and Fukuda M. Vesicular reuptake inhibition by a synaptotagmin I C2B domain antibody at the squid giant synapse. Proc Natl Acad Sci USA 101: 1785517860, 2004.
31. Miyagishi M and Taira K. U6 promoter-driven siRNAs with four uridine 3' overhangs efficiently suppress targeted gene expression in mammalian cells. Nat Biotechnol 20: 497500, 2002.[CrossRef][Web of Science][Medline]
32. Nishiki T and Augustine GJ. Dual roles of the C2B domain of synaptotagmin I in synchronizing Ca2+-dependent neurotransmitter release. J Neurosci 24: 85428550, 2004.
33. Nishiki T and Augustine GJ. Synaptotagmin I synchronizes transmitter release in mouse hippocampal neurons. J Neurosci 24: 61276132, 2004.
34. Nonet ML, Grundahl K, Meyer BJ, and Rand JB. Synaptic function is impaired but not eliminated in C. elegans mutants lacking synaptotagmin. Cell 73: 12911305, 1993.[CrossRef][Web of Science][Medline]
35. O'Connor V, Augustine GJ, and Betz H. Synaptic vesicle exocytosis: molecules and models. Cell 76: 785787, 1994.[CrossRef][Web of Science][Medline]
36. Perin MS, Brose N, Jahn R, and Sudhof TC. Domain structure of synaptotagmin (p65). J Biol Chem 266: 623629, 1991.
37. Perin MS, Johnston PA, Ozcelik T, Jahn R, Francke U, and Sudhof TC. Structural and functional conservation of synaptotagmin (p65) in Drosophila and humans. J Biol Chem 266: 615622, 1991.
38. Rizo J and Sudhof TC. C2-domains, structure and function of a universal Ca2+-binding domain. J Biol Chem 273: 1587915882, 1998.
39. Schroeder TJ, Jankowski JA, Kawagoe KT, Wightman RM, Lefrou C, and Amatore C. Analysis of diffusional broadening of vesicular packets of catecholamines released from biological cells during exocytosis. Anal Chem 64: 30773083, 1992.[Medline]
40. Shao X, Davletov BA, Sutton RB, Sudhof TC, and Rizo J. Bipartite Ca2+-binding motif in C2 domains of synaptotagmin and protein kinase C. Science 273: 248251, 1996.[Abstract]
41. Shoji-Kasai Y, Yoshida A, Sato K, Hoshino T, Ogura A, Kondo S, Fujimoto Y, Kuwahara R, Kato R, and Takahashi M. Neurotransmitter release from synaptotagmin-deficient clonal variants of PC12 cells. Science 256: 18211823, 1992.[CrossRef][Medline]
42. Stevens CF and Sullivan JM. The synaptotagmin C2A domain is part of the calcium sensor controlling fast synaptic transmission. Neuron 39: 299308, 2003.[CrossRef][Web of Science][Medline]
43. Sudhof TC. The synaptic vesicle cycle. Annu Rev Neurosci 27: 509547, 2004.[CrossRef][Web of Science][Medline]
44. Sudhof TC. The synaptic vesicle cycle: a cascade of protein-protein interactions. Nature 375: 645653, 1995.[CrossRef][Medline]
45. Sudhof TC. Synaptotagmins: why so many? J Biol Chem 277: 76297632, 2002.
46. Sugita S, Han W, Butz S, Liu X, Fernandez-Chacon R, Lao Y, and Sudhof TC. Synaptotagmin VII as a plasma membrane Ca2+ sensor in exocytosis. Neuron 30: 459473, 2001.[CrossRef][Web of Science][Medline]
47. Sugita S, Shin OH, Han W, Lao Y, and Sudhof TC. Synaptotagmins form a hierarchy of exocytotic Ca2+ sensors with distinct Ca2+ affinities. EMBO J 21: 270280, 2002.[CrossRef][Web of Science][Medline]
48. Sutton RB, Davletov BA, Berghuis AM, Sudhof TC, and Sprang SR. Structure of the first C2 domain of synaptotagmin I: a novel Ca2+/phospholipid-binding fold. Cell 80: 929938, 1995.[CrossRef][Web of Science][Medline]
49. Thomas DM and Elferink LA. Functional analysis of the C2A domain of synaptotagmin 1: implications for calcium-regulated secretion. J Neurosci 18: 35113520, 1998.
50. Tischler AS, Mobtaker H, Kwan PW, Jason WJ, DeLellis RA, and Wolfe HJ. Hypertrophy of pheochromocytoma cells treated with nerve growth factor and activators of adenylate cyclase. Cell Tissue Res 249: 161169, 1987.[CrossRef][Web of Science][Medline]
51. Tucker WC, Edwardson JM, Bai J, Kim HJ, Martin TF, and Chapman ER. Identification of synaptotagmin effectors via acute inhibition of secretion from cracked PC12 cells. J Cell Biol 162: 199209, 2003.
52. Ubach J, Zhang X, Shao X, Sudhof TC, and Rizo J. Ca2+ binding to synaptotagmin: how many Ca2+ ions bind to the tip of a C2-domain? EMBO J 17: 39213930, 1998.[CrossRef][Web of Science][Medline]
53. Voets T, Moser T, Lund PE, Chow RH, Geppert M, Sudhof TC, and Neher E. Intracellular calcium dependence of large dense-core vesicle exocytosis in the absence of synaptotagmin I. Proc Natl Acad Sci USA 98: 1168011685, 2001.
54. Von Poser C, Ichtchenko K, Shao X, Rizo J, and Sudhof TC. The evolutionary pressure to inactivate. A subclass of synaptotagmins with an amino acid substitution that abolishes Ca2+ binding. J Biol Chem 272: 1431414319, 1997.
55. Wang P, Wang CT, Bai J, Jackson MB, and Chapman ER. Mutations in the effector binding loops in the C2A and C2B domains of synaptotagmin I disrupt exocytosis in a nonadditive manner. J Biol Chem 278: 4703047037, 2003.
56. Yoshida A, Oho C, Omori A, Kuwahara R, Ito T, and Takahashi M. HPC-1 is associated with synaptotagmin and
-conotoxin receptor. J Biol Chem 267: 2492524928, 1992.
57. Yoshihara M and Littleton JT. Synaptotagmin I functions as a calcium sensor to synchronize neurotransmitter release. Neuron 36: 897908, 2002.[CrossRef][Web of Science][Medline]
58. Yu JY, DeRuiter SL, and Turner DL. RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells. Proc Natl Acad Sci USA 99: 60476052, 2002.
59. Zhang X, Kim-Miller MJ, Fukuda M, Kowalchyk JA, and Martin TF. Ca2+-dependent synaptotagmin binding to SNAP-25 is essential for Ca2+-triggered exocytosis. Neuron 34: 599611, 2002.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
E.-J. Yoon, H. E. Hamm, and K. P. M. Currie G protein {beta}{gamma} Subunits Modulate the Number and Nature of Exocytotic Fusion Events in Adrenal Chromaffin Cells Independent of Calcium Entry J Neurophysiol, November 1, 2008; 100(5): 2929 - 2939. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. H. Roden, J. B. Papke, J. M. Moore, A. L. Cahill, H. Macarthur, and A. B. Harkins Stable RNA interference of synaptotagmin I in PC12 cells results in differential regulation of transmitter release Am J Physiol Cell Physiol, December 1, 2007; 293(6): C1742 - C1752. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Lynch and T. F. J. Martin Synaptotagmins I and IX function redundantly in regulated exocytosis but not endocytosis in PC12 cells J. Cell Sci., February 15, 2007; 120(4): 617 - 627. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |