|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GROWTH, DIFFERENTIATION, AND APOPTOSIS
Cell Biology and Biochemistry Group, Biological Sciences Division, Pacific Northwest National Laboratory, Richland, Washington
Submitted 20 October 2005 ; accepted in final form 11 January 2006
| ABSTRACT |
|---|
|
|
|---|
B p65 subunit, phospho-c-Jun, Sp1) and subsequent increases in the proinflammatory cytokine TNF-
and inducible nitric oxide synthase (iNOS). Cellular apoptosis after LPS challenge is blocked upon inhibition of iNOS activity using the pharmacological inhibitor 1400W. LPS-mediated iNOS expression and apoptosis also were inhibited by siRNA-mediated silencing of TNF induction, indicating TNF induction both precedes and is necessary for subsequent regulation of iNOS expression. Increasing the level of cellular CaM by stable transfection results in reductions in LPS-induced expression of TNF and iNOS, along with reduced activation of their transcriptional regulators and concomitant protection against apoptosis. Thus the level of CaM available for Ca2+-dependent signaling regulation plays a key role in determining the expression of the proinflammatory and proapoptotic cascade during cellular activation by LPS. These results indicate a previously unrecognized central role for CaM in maintaining cellular homeostasis in response to LPS such that, under resting conditions, cellular concentrations of CaM are sufficient to inhibit the biosynthesis of proinflammatory mediators associated with macrophage activation. Although CaM and iNOS protein levels are coordinately increased as part of the oxidative burst, limiting cellular concentrations of CaM due to association with iNOS (and other high-affinity binders) commit the cell to an unchecked inflammatory cascade leading to apoptosis. inflammation; apoptosis; macrophage activation
Macrophage activation upon exposure to bacterial endotoxin involves coordinated increases in intracellular Ca2+ levels and the release of TNF and other primary response cytokines that function to initiate an inflammatory response (31, 32, 4648, 50, 62). The cellular responses initiated by TNF overlap with many LPS-mediated responses, consistent with their activation of common transcriptional regulators, including members of the NF-
B and activator protein (AP)-1 families (1, 5, 27, 33). For instance, NF-
B-dependent expression of iNOS is associated with both TNF and LPS signaling (27), and association of iNOS with CaM contributes to the oxidative burst associated with bacterial killing (27, 49). However, unchecked activation of these pathways leads to both necrosis and apoptosis through proteolytic activation of caspase cascades and loss of cellular Ca2+ balance (40, 61). In contrast, the proapoptotic effects of LPS and TNF are often counterbalanced by their cytoprotective functions, which have been associated with gene expression regulated by NF-
B and other signaling mediators (35, 40). In support of this concept, the inhibition of gene expression by cotreatment with inhibitors of transcription or protein translation can unmask the apoptotic effects of TNF (35). In addition to NF-
B, complementary pathways involving, for example, signal transducer and activator of transcription 3 (STAT3) have an important role in the protection of inflammation-induced damage (21). Likewise, the CaM-dependent expression of inhibitor of apoptosis-2 (IAP2) has been shown to prevent cellular apoptosis after monocyte activation (38), suggesting that coordinated signaling mechanisms control the time course of macrophage activation (30). Such observations suggest that cell fate in response to these agents depends on whether homeostatic mechanisms involving Ca2+-initiated signaling events and gene regulation remain in balance.
In the present study, we have examined how the abundance of CaM in response to bacterial endotoxin LPS affects the inflammatory response and cellular apoptosis in an effort to understand how Ca2+-dependent signaling and cytokine release coordinate macrophage activation. These measurements were obtained using RAW 264.7 cells, a well-established model system in systems biology approaches to the study of macrophage signaling (see the Alliance for Cellular Signaling's Signaling Gateway web site at http://www.signaling-gateway.org/). In response to LPS, a rapid increase in CaM abundance precedes nuclear localization of key transcription factors (TFs) (i.e., NF-
B p65 subunit, active c-Jun, and (Sp1), as well as subsequent increases in protein levels of TNF and iNOS. Cellular apoptosis is blocked after inhibition of iNOS activity, regardless of whether block is accomplished using the pharmacological inhibitor 1400W, through silencing of TNF induction, or by increasing the amount of available CaM through gene transfection. Furthermore, changes in CaM abundance result in dramatic reductions in the amounts of key inflammatory mediators (i.e., TNF, iNOS) and the nuclear localization of TFs that regulate the expression of these inflammatory mediators, indicating a previously unrecognized central role for CaM in modulating both macrophage activation and cell fate in response to endotoxin challenge.
| MATERIALS AND METHODS |
|---|
|
|
|---|
B subunit p65 (RelA; Rockland Immunochemicals, Gilbertsville, PA); and active caspase-3 (Promega, Madison, WI). Zenon antibody labeling kits were purchased from Molecular Probes (Eugene, OR). Cell culture. The RAW 264.7 murine macrophage cell line was obtained from the American Type Culture Collection (Manassas, VA). Cells were maintained in DMEM (no. 11960-044; GIBCO-BRL) supplemented with 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 100 U/ml penicillin, and 0.1 mg/ml streptomycin in a humidified atmosphere of 5% CO2-95% air at 37°C. Treatment with LPS occurred in DMEM with glucose levels comparable to those that occur under normal physiological conditions (no. 11885-084; GIBCO-BRL), supplemented as indicated above.
Western blot analysis. Total cellular extracts were obtained for Western blot analysis by lysing cells in ice-cold buffer containing 1% Nonidet P-40, 20 mM Tris (pH 8.0), 150 mM NaCl, 1 mM Na3VO4, 1 mM EGTA, and anti-protease cocktail (Roche Molecular Biochemicals, Indianapolis, IN), followed by centrifugation in a microfuge (10,000 rpm) for 1 min to pellet cellular debris. Nuclear protein lysate samples were prepared using procedures described previously (60). Protein concentrations were determined using a bicinchoninic acid assay kit (Pierce Biotechnology, Rockford, IL). Aliquots of equal amounts of protein (30 µg) were diluted in loading buffer [0.125 mM Tris·HCl (pH 7.4), 4% SDS, and 20% glycerol], and the samples were denatured by boiling them for 5 min and resolved by performing 12% SDS-PAGE. After being electroblotted onto nitrocellulose membranes (Bio-Rad Laboratories, Hercules, CA) and blocked with 5% Carnation nonfat milk (Nestlé, Wilkes-Barre, PA) in TBST (10 mM Tris, pH 8.0, 150 mM NaCl, and 0.05% Tween 20), the membranes were incubated with the indicated primary antibodies overnight at 4°C, followed by incubation with appropriate horseradish peroxidase (HRP)-conjugated secondary antibody for 1 h. The proteins were subsequently detected using LumiGLO (Cell Signaling Technology, Beverly, MA) and a chemiluminescence imager (LumiImager, Roche Molecular Biochemicals). In experiments with nuclear extracts, membranes were probed multiple times to determine target nuclear protein expression levels. Expression level measurement was accomplished by incubating membranes in 1.0 mM sodium azide solution in TBST for 2 h at room temperature to inhibit bound HRP activity, followed by reprobing of the membrane with the HRP-labeled primary antibody of interest as described above. Primary antibodies were labeled with HRP using the appropriate Zenon labeling kit. All assays were repeated three times, and representative blots are shown in the figures.
Cell transfection and siRNA. RAW 264.7 cells in which CaM levels were increased (RAWCs) were constructed by stably transfecting RAW 264.7 cells using a pcDNA3.1 vector (Invitrogen) encoding CaM. The CaM gene was placed under the control of the human cytomegalovirus immediate-early promoter for expression with a neomycin resistance gene for the selection of stable cell lines. The ligated vector-containing insert was transformed into E. coli. Transformants were selected on Luria-Bertani plates containing 100 µg/ml ampicillin, followed by DNA purification with Qiagen minikits (Qiagen, Valencia, CA) and restriction enzyme digestion to verify the correct insertion of CaM into the vector. The transformant with CaM was selected and sequenced to verify intact CaM within the pcDNA3.1 vector. FuGene transfection reagent (Roche, Indianapolis, IN) was used to transfect the CaM-pcDNA3.1 vector into RAW 264.7 cells. The control plasmid, pcDNA3.1-CAT (chloramphenicol acetyl transferase), was treated as indicated above for use as a positive control for transfection and expression. Stable transfectants were maintained in medium supplemented with geneticin (800 µg/ml) as a selection agent (GIBCO-BRL, Carlsbad, CA).
A stable small interfering RNA (siRNA) expression vector used to silence TNF mRNA induction was constructed with the pSuppressorNEO vector (Imgenex). Briefly, the vector was modified by adding linker regions containing SalI, XmnI, and XbaI restriction enzyme sites, and a synthetic duplex oligonucleotide (sense, 5'-TCGAGACAACCAACTAGTGGTGCGAGTACTGGCACCACTAGTTG GTTGTCTTTTT; antisense, 5'-AAAAAGACAACCAACTAGTGGTGCCAGTACTCGCACCACTAGTTGGTTGTC) was ligated into the SalI and XbaI restriction enzyme sites. The sequences for the oligonucleotides were derived from the mouse TNF sequences and included a spacer (underlined sequences above) to permit hairpin formation. Correct orientation of the final vector was verified by sequence analysis. Transfections were performed using FuGene transfection reagent, and stable transfectants were isolated on the basis of resistance to geneticin (800 µg/ml). For TNF siRNA, a direct correlation between the level of TNF silencing and inhibition of iNOS induction in response to LPS treatment was observed with multiple transfected clones (data not shown). Clone 8c-8 was used in the current study.
Apoptotic index and lysosomal integrity. Initially, control or LPS (101,000 ng/ml)-treated cells (24 h) were processed as follows. Cells were 1) harvested using a rubber blade scraper and pooled with the medium fraction to include floating cells in the measurement; 2) centrifuged at 1,800 g for 5 min and medium was aspirated; 3) resuspended in ice-cold methanol for 2 min, followed by centrifugation at 1,800 g for 5 min and aspiration of methanol; 4) resuspended in 100 µl of FBS, spread onto a microscope slide, and air dried; 5) cross linked onto the slide by incubation in formaldehyde for 10 min, followed by three washes in PBS (10 mM sodium phosphate, pH 7.4, and 150 mM NaCl); and 6) stained with 50 µg/ml 4,6'-diamidino-2-phenylindole in PBS for 5 min at room temperature, followed by three washes in PBS. Individual nuclei (total and apoptotic) were counted using epifluorescence microscopy to derive the apoptotic index (%apoptotic cells) from a minimum of 100 cells/sample. In subsequent experiments, we observed that comparable trends in the apoptotic index could be obtained using a simplified protocol whereby cells were maintained in Nunc chambers, fixed in ice-cold methanol for 2 min, and stained as described above to count total and apoptotic nuclei. Comparable measurements were made using a neutral red assay to measure lysosome integrity as a measure of cell viability as described previously (58, 59).
NO measurement. The activity of iNOS was determined by measuring the release of the stable nitrite end product using Griess reagent (Sigma Chemical) and monitoring absorbance at 540 nm using a microtiter plate reader at a 24-h time point. Nitrite concentrations in conditioned media were determined on the basis of standard curves calibrated using sodium nitrite as a standard.
ELISA analysis. For analysis of soluble (shed) TNF levels, conditioned media supernatants were collected after 4 h of LPS treatment, centrifuged at 10,000 rpm for 1 min to remove residual debris, and frozen promptly at 80°C until analysis. Shed TNF was quantitated by performing ELISA (R&D Systems, Minneapolis, MN) according to the supplier's instructions, and data were normalized to the number of viable cells.
Statistics. Individual comparisons were conducted using Student's t-test or ANOVA, together with a post hoc Student-Newman-Keuls test as appropriate. P < 0.05 was accepted as statistically significant.
| RESULTS |
|---|
|
|
|---|
10 min (12, 18, 34, 39). Furthermore, CaM functions as an activator of iNOS and is therefore required for the generation of reactive nitrogen species necessary for bacterial killing. Because total CaM abundance increases during macrophage activation in conjunction with CaM-dependent enzymes, which typically exceed the amount of available CaM (9, 44, 55), these results indicate a need to compare how the kinetics of increases in the abundance of key proteins involved in the inflammatory response correlate to changing CaM levels and whether this correlation modulates cell fate in response to LPS challenge.
|
30% of the cell population displayed apoptotic nuclei 24 h after exposure to LPS (10 ng/ml), a substantial reduction in cellular apoptosis was observed in RAWCs in which CaM levels were increased, such that only
12% of the cellular population contained apoptotic nuclei (Fig. 2B). The increase in apoptotic nuclei observed in LPS-stimulated cells was paralleled by an increase in active caspase-3 relative to untreated controls as determined using Western blot analysis and immunocytochemistry (Fig. 2C). Immunocytochemical analysis demonstrated that the appearance of active caspase-3 was restricted to cells exhibiting apoptotic nuclear morphology (Fig. 2C), consistent with classic apoptotic cell death under these conditions. In RAWCs, a substantial decrease in apoptosis across a broad range of LPS concentrations was observed on the basis of both the apoptotic index assessment of changes in nuclear morphology and complementary measurements of cell viability using a neutral red assay to evaluate lysosome integrity (Fig. 2D). These observed large reductions in the extent of LPS-mediated apoptosis suggest an important role for CaM in mediating cell survival.
|
B and the requirement that membrane-bound TNF be processed further proteolytically by TNF-
-converting enzyme to release the soluble (i.e., active) species associated with autocrine and paracrine signaling (10, 27). In cells in which CaM levels are constitutively elevated, the kinetics associated with LPS-dependent increases in iNOS and TNF protein abundance after LPS treatment were similar to those observed in control cells, but the magnitude of the increases was dramatically reduced. The latter results indicate that increases in the protein abundance of CaM (Fig. 1) function to downregulate the levels of expressed iNOS and TNF and correlate with the observed decreases in cellular apoptosis (Fig. 2), suggesting that CaM may function in the coordinated regulation of TNF release and iNOS activation.
|
|
|
B p65 subunit (RelA) and after phosphorylation of c-Jun to initiate oligomerization and transcriptional activation of the AP-1 complex (2, 15, 41, 64). In addition to mediating CaM gene expression, Sp1 has been reported to potentiate c-Jun-mediated gene regulation and play an important role in NF-
B-dependent transcriptional regulation in some cell types (2, 28, 37, 42, 51). Nuclear extracts were prepared from cells treated with LPS (10 ng/ml; 0.253 h) and subjected to Western blot analysis of the p65 subunit (RelA) of NF-
B, phospho-c-Jun, Sp1, or XPA. XPA protein was used as a control because nuclear levels of this protein are expressed constitutively and are not known to be highly inducible. Consistent with the expected roles of these TFs in modulating TNF and iNOS gene expression, we observed a time-dependent increase in the nuclear concentrations of p65 (RelA), phospho-c-Jun, and Sp1 in response to LPS exposure; significant increases in the nuclear concentration of these TFs were apparent within the first 30 min after LPS exposure in control cells (Fig. 6). Levels of XPA protein were unchanged by any treatment.
|
| DISCUSSION |
|---|
|
|
|---|
4 h after LPS activation (Figs. 3 and 5). There was a direct correlation between the activity or abundance of iNOS and the extent of cellular apoptosis observed for longer intervals. Specifically, apoptosis was blocked by the selective inhibition of iNOS by 1400W (Fig. 4B). Likewise, the amount of cellular apoptosis was significantly reduced after the downregulation of iNOS abundance resulting from the use of siRNA to downregulate TNF autocrine signaling or after the overexpression of CaM (Figs. 2, 3, and 5). These results indicate an important role for iNOS and the associated generation of reactive oxygen species in mediating apoptosis, which may occur through the oxidative modification of redox-sensitive proteins (6). The coordinated regulation of CaM protein levels involving the expression of three separate gene products remains poorly understood. Although the use of an inducible expression vector to manipulate cellular CaM levels is feasible, the rapid upregulation of CaM after LPS exposure (Fig. 1) relative to TNF and iNOS induction would be difficult to discern because of the complexity of competing kinetic processes associated with experimental manipulation vs. LPS-stimulated responses. Thus, by mimicking the moderate elevation of CaM levels observed during LPS stimulation through stable transfection, the relative order of signaling events initiated by LPS could be determined in addition to demonstrating that tight regulation of cellular CaM levels has important consequences for cell survival.
The ability of constitutive CaM expression to block apoptosis through the suppression of transcriptional activation of key proteins associated with the inflammatory response is consistent with earlier measurements demonstrating a role for CaM and CaMKII in mediating the expression of both the adhesion protein CD44 and IAP2 to modulate the inflammatory response in monocytes (38). Furthermore, CaM was previously shown to modulate NF-
B activation in other cell types (4, 19, 23). In the case of NF-
B family members p65 (RelA) and c-Rel, a direct association with CaM was demonstrated after the release of these TFs from the endogenous inhibitor I
B. In the case of c-Rel, nuclear localization after cellular activation has been shown to be inhibited by CaM (4). Our results demonstrating that increasing cellular CaM levels prevents LPS-dependent nuclear accumulation of p65 (RelA) and other TFs (i.e., phospho-c-Jun, Sp1) associated with the inflammatory response suggest that CaM plays an important role in mediating the coordinated regulation of multiple promoters and their transcriptional products (Fig. 6). Indeed, this regulation is consistent with earlier, well-studied, CaM-dependent regulatory mechanisms in which levels of CaM activation selectively modulated the relative activities of the CaM-dependent phosphatase calcineurin and CaM-dependent kinases to modulate the TF cAMP response element-binding protein, a critical component of the LPS-stimulated TNF enhancer complex (8, 13, 56). Likewise, Ca2+ activation modulates the nuclear localization of the TF NF-E2-related factor 2 through the modulation of CaM binding to a cytosolic protein complex that regulates the redox-dependent modulation of key antioxidant enzymes (60). Because CaM levels are normally substantially lower than the levels of CaM protein binding partners (9, 43, 44, 54), these measurements suggest that during the initial phases of LPS stimulation, increases in CaM abundance promote the activation of low-affinity CaM binding proteins (e.g., CaMKII, CaMKIV) that are necessary to modulate the induction of downstream inflammatory genes.
Prior results demonstrated that under normal conditions, calcineurin activity is required to induce NF-
B activation associated with iNOS expression in RAW 264.7 cells (27). After iNOS expression, CaM binding is also necessary for the stabilization and activation of the enzyme; in the absence of sufficient CaM, newly synthesized iNOS is rapidly degraded through the calpain and proteasome systems (16, 29, 57). Upon CaM association, the calpain cleavage site on iNOS is sterically blocked to stabilize the iNOS-CaM complex, whose activation is further modulated by high-affinity Ca2+ binding (17, 52). Thus transcriptional regulation and the associated inflammatory response depend on the stoichiometries and relative kinetics of CaM expression compared with those associated with iNOS and other CaM-binding proteins.
The repression of transcriptional regulation of inflammatory mediators by CaM has practical implications, including potential anti-inflammatory therapeutic applications through selective inhibition of CaM binding partners (53a). In addition, this CaM-dependent mechanism may be manifested physiologically differently at early and late times after bacterial endotoxin challenge. Our results indicate that under resting conditions or in association with low levels of antigen (i.e., LPS), CaM levels normally function to prevent the premature or prolonged activation of macrophages through the inhibition of the nuclear localization of TFs (Fig. 7). Under these conditions, there is a low level of TNF and iNOS synthesis and iNOS expression is minimized without sufficient TNF induction (Fig. 5). TNF is both controlled by NF-
B activation and is also a strong activator of NF-
B, the latter regulation is important in its ability to potentiate iNOS expression. However, iNOS binds CaM with high affinity (Kd < 0.1 nM), effectively competing with lower-affinity binding partners. Thus, at critical levels of iNOS accumulation, the amount of available CaM needed to suppress TF activation in response to LPS may be sequestered. The release of CaM-mediated NF-
B suppression, for example, is expected to further promote TNF autocrine signaling and iNOS expression, committing the cell to an apoptotic response. The tight regulation associated with CaM and apoptosis may provide a mechanism for minimizing the nonspecific collateral damage to surrounding tissues after pathogen clearance. Thus key to understanding the regulation of macrophage activation is an appreciation of the coordinated regulation of Ca2+-dependent signaling through changes in the levels of CaM activity and associated changes in TNF release and the associated upregulation of iNOS activity. We suggest that this cross talk between Ca2+ and cytokine-dependent signaling pathways provides the necessary stability to ensure the ability to initiate macrophage activation rapidly and correctly in response to pathogen exposure.
|
| GRANTS |
|---|
|
|
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Ainbinder E, Revach M, Wolstein O, Moshonov S, Diamant N, and Dikstein R. Mechanism of rapid transcriptional induction of tumor necrosis factor
-responsive genes by NF-
B. Mol Cell Biol 22: 63546362, 2002.
3. Angulo I, Rullas J, Campillo JA, Obregón E, Heath A, Howard M, Muñoz-Fernández MA, and Subiza JL. Early myeloid cells are high producers of nitric oxide upon CD40 plus IFN-
stimulation through a mechanism dependent on endogenous TNF-
and IL-1
. Eur J Immunol 30: 12631271, 2000.[CrossRef][Web of Science][Medline]
4. Antonsson Å, Hughes K, Edin S, and Grundström T. Regulation of c-Rel nuclear localization by binding of Ca2+/calmodulin. Mol Cell Biol 23: 14181427, 2003.
5. Baud V and Karin M. Signal transduction by tumor necrosis factor and its relatives. Trends Cell Biol 11: 372377, 2001.[CrossRef][Web of Science][Medline]
6. Bigelow DJ and Squier TC. Redox modulation of cellular signaling and metabolism through reversible oxidation of methionine sensors in calcium regulatory proteins. Biochim Biophys Acta 1703: 121134, 2005.[Medline]
7. Bilecki W, Okruszek A, and Przewlocki R. The effect of antisense oligodeoxynucleotides on nitric oxide secretion from macrophage-like cells. Antisense Nucleic Acid Drug Dev 7: 531537, 1997.[Web of Science][Medline]
8. Bito H, Deisseroth K, and Tsien RW. CREB phosphorylation and dephosphorylation: a Ca2+- and stimulus duration-dependent switch for hippocampal gene expression. Cell 87: 12031214, 1996.[CrossRef][Web of Science][Medline]
9. Black DJ, Tran QK, and Persechini A. Monitoring the total available calmodulin concentration in intact cells over the physiological range in free Ca2+. Cell Calcium 35: 415425, 2004.[CrossRef][Web of Science][Medline]
10. Black RA, Rauch CT, Kozlosky CJ, Peschon JJ, Slack JL, Wolfson MF, Castner BJ, Stocking KL, Reddy P, Srinivasan S, Nelson N, Boiani N, Schooley KA, Gerhart M, Davis R, Fitzner JN, Johnson RS, Paxton RJ, March CJ, and Cerretti DP. A metalloproteinase disintegrin that releases tumour-necrosis factor-
from cells. Nature 385: 729733, 1997.[CrossRef][Medline]
12. Chen KC, Blalock EM, Thibault O, Kaminker P, and Landfield PW. Expression of
1D subunit mRNA is correlated with L-type Ca2+ channel activity in single neurons of hippocampal "zipper" slices. Proc Natl Acad Sci USA 97: 43574362, 2000.
13. Deisseroth K, Heist EK, and Tsien RW. Translocation of calmodulin to the nucleus supports CREB phosphorylation in hippocampal neurons. Nature 392: 198202, 1998.[CrossRef][Medline]
14. Forman HJ and Torres M. Reactive oxygen species and cell signaling: respiratory burst in macrophage signaling. Am J Respir Crit Care Med 16, Suppl 6: S4S8, 2002.
15. Franklin CC, Sanchez V, Wagner F, Woodgett JR, and Kraft AS. Phorbol ester-induced amino-terminal phosphorylation of human JUN but not JUNB regulates transcriptional activation. Proc Natl Acad Sci USA 89: 72477251, 1992.
16. Gerber NC, Nishida CR, and Ortiz de Montellano PR. Characterization of human liver inducible nitric oxide synthase expressed in Escherichia coli. Arch Biochem Biophys 343: 249253, 1997.[CrossRef][Web of Science][Medline]
17. Gribovskaja I, Brownlow KC, Dennis SJ, Rosko AJ, Marletta MA, and Stevens-Truss R. Calcium-binding sites of calmodulin and electron transfer by inducible nitric oxide synthase. Biochemistry 44: 75937601, 2005.[CrossRef][Medline]
18. Hotchkiss RS, Bowling WM, Karl IE, Osborne DF, and Flye MW. Calcium antagonists inhibit oxidative burst and nitrite formation in lipopolysaccharide-stimulated rat peritoneal macrophages. Shock 8: 170178, 1997.[Web of Science][Medline]
19. Hughes K, Antonsson Å, and Grundström T. Calmodulin dependence of NF
B activation. FEBS Lett 441: 132136, 1998.[CrossRef][Web of Science][Medline]
20. Jacobs AT and Ignarro LJ. Cell density-enhanced expression of inducible nitric oxide synthase in murine macrophages mediated by interferon-
. Nitric Oxide 8: 222230, 2003.[CrossRef][Web of Science][Medline]
21. Jacoby JJ, Kalinowski A, Liu MG, Zhang SS, Gao Q, Chai GX, Ji L, Iwamoto Y, Li E, Schneider M, Russell KS, and Fu XY. Cardiomyocyte-restricted knockout of STAT3 results in higher sensitivity to inflammation, cardiac fibrosis, and heart failure with advanced age. Proc Natl Acad Sci USA 100: 1292912934, 2003.
22. Jafarian-Tehrani M, Louin G, Royo NC, Besson VC, Bohme GA, Plotkine M, and Marchand-Verrecchia C. 1400W, a potent selective inducible NOS inhibitor, improves histopathological outcome following traumatic brain injury in rats. Nitric Oxide 12: 6169, 2005.[CrossRef][Web of Science][Medline]
23. Jang MK, Goo YH, Sohn YC, Kim YS, Lee SK, Kang H, Cheong J, and Lee JW. Ca2+/calmodulin-dependent protein kinase IV stimulates nuclear factor-
B transactivation via phosphorylation of the p65 subunit. J Biol Chem 276: 2000520010, 2001.
24. Jun CD, Choi BM, Kim HM, and Chung HT. Involvement of protein kinase C during taxol-induced activation of murine peritoneal macrophages. J Immunol 154: 65416547, 1995.[Abstract]
25. Karupiah G, Hunt NH, King NJ, and Chaudhri G. NADPH oxidase, Nramp1 and nitric oxide synthase 2 in the host antimicrobial response. Rev Immunogenet 2: 387415, 2000.[Medline]
26. Kim HM, Rim HK, Shin T, Kim JJ, Park ST, Oh JM, Choi MK, Chung YT, Rhee HS, Jeung JY, Lee KN, Kim NS, and Kim CH. Human chorionic gonadotropin induces nitric oxide synthesis by murine microglia. Int J Immunopharmacol 22: 453461, 2000.[CrossRef][Web of Science][Medline]
27. Kim Y, Moon JS, Lee KS, Park SY, Cheong J, Kang HS, Lee HY, and Kim HD. Ca2+/calmodulin-dependent protein phosphatase calcineurin mediates the expression of iNOS through I
K and NF-
B activity in LPS-stimulated mouse peritoneal macrophages and RAW 264.7 cells. Biochem Biophys Res Commun 314: 695703, 2004.[CrossRef][Web of Science][Medline]
28. Koller M, Schnyder B, and Strehler EE. Structural organization of the human CaMIII calmodulin gene. Biochim Biophys Acta 1087: 180189, 1990.[Medline]
29. Kone BC, Kuncewicz T, Zhang W, and Yu ZY. Protein interactions with nitric oxide synthases: controlling the right time, the right place, and the right amount of nitric oxide. Am J Physiol Renal Physiol 285: F178F190, 2003.
30. Kwon SH, Pimentel DR, Remondino A, Sawyer DB, and Colucci WS. H2O2 regulates cardiac myocyte phenotype via concentration-dependent activation of distinct kinase pathways. J Mol Cell Cardiol 35: 615621, 2003.[CrossRef][Web of Science][Medline]
31. Lakics V and Vogel SN. Lipopolysaccharide and ceramide use divergent signaling pathways to induce cell death in murine macrophages. J Immunol 161: 24902500, 1998.
32. Laskin DL, Rodriguez del Valle M, Heck DE, Hwang SM, Tsuyoshi Ohnishi S, Durham SK, Goller NL, and Laskin JD. Hepatic nitric oxide production following acute endotoxemia in rats is mediated by increased inducible nitric oxide synthase gene expression. Hepatology 22: 223234, 1995.[CrossRef][Web of Science][Medline]
33. Lichtman SN, Wang J, and Lemasters JJ. Lipopolysaccharide-stimulated TNF-
release from cultured rat Kupffer cells: sequence of intracellular signaling pathways. J Leukoc Biol 64: 368372, 1998.[Abstract]
34. Liu H, Bowes RC III, van de Water B, Sillence C, Nagelkerke JF, and Stevens JL. Endoplasmic reticulum chaperones GRP78 and calreticulin prevent oxidative stress, Ca2+ disturbances, and cell death in renal epithelial cells. J Biol Chem 272: 2175121759, 1997.
35. Luster MI, Simeonova PP, Gallucci R, and Matheson J. Tumor necrosis factor
and toxicology. Crit Rev Toxicol 29: 491511, 1999.[CrossRef][Web of Science][Medline]
36. Malik ZA, Iyer SS, and Kusner DJ. Mycobacterium tuberculosis phagosomes exhibit altered calmodulin-dependent signal transduction: contribution to inhibition of phagosome-lysosome fusion and intracellular survival in human macrophages. J Immunol 166: 33923401, 2001.
37. McDonough PM, Hanford DS, Sprenkle AB, Mellon NR, and Glembotski CC. Collaborative roles for c-Jun N-terminal kinase, c-Jun, serum response factor, and Sp1 in calcium-regulated myocardial gene expression. J Biol Chem 272: 2404624053, 1997.
38. Mishra JP, Mishra S, Gee K, and Kumar A. Differential involvement of calmodulin-dependent protein kinase II-activated AP-1 and c-Jun N-terminal kinase-activated EGR-1 signaling pathways in tumor necrosis factor-
and lipopolysaccharide-induced CD44 expression in human monocytic cells. J Biol Chem 280: 2682526837, 2005.
39. Mustafa SB and Olson MS. Effects of calcium channel antagonists on LPS-induced hepatic iNOS expression. Am J Physiol Gastrointest Liver Physiol 277: G351G360, 1999.
40. Natoli G, Costanzo A, Guido F, Moretti F, and Levrero M. Apoptotic, non-apoptotic, and anti-apoptotic pathways of tumor necrosis factor signalling. Biochem Pharmacol 56: 915920, 1998.[CrossRef][Web of Science][Medline]
41. Okada S, Obata S, Hatano M, and Tokuhisa T. Dominant-negative effect of the c-fos family gene products on inducible NO synthase expression in macrophages. Int Immunol 15: 12751282, 2003.
42. Pan X, Solomon SS, Shah RJ, Palazzolo MR, and Raghow RS. Members of the Sp transcription factor family regulate rat calmodulin gene expression. J Lab Clin Med 136: 157163, 2000.[CrossRef][Web of Science][Medline]
43. Persechini A and Cronk B. The relationship between the free concentration of Ca2+-calmodulin in intact cells. J Biol Chem 274: 68276830, 1999.
44. Persechini A and Stemmer PM. Calmodulin is a limiting factor in the cell. Trends Cardiovasc Med 12: 3237, 2002.[CrossRef][Web of Science][Medline]
45. Pollock JS, Förstermann U, Mitchell JA, Warner TD, Schmidt HH, Nakane M, and Murad F. Purification and characterization of particulate endothelium-derived relaxing factor synthase from cultured and native bovine aortic endothelial cells. Proc Natl Acad Sci USA 88: 1048010484, 1991.
46. Ramos MG, Rabelo FL, Duarte T, Gazzinelli RT, and Alvarez-Leite JI. Butyrate induces apoptosis in murine macrophages via caspase-3, but independent of autocrine synthesis of tumor necrosis factor and nitric oxide. Braz J Med Biol Res 35: 161173, 2002.[Web of Science][Medline]
47. Rothstein EC, Byron KL, Reed RE, Fliegel L, and Lucchesi PA. H2O2-induced Ca2+ overload in NRVM involves ERK1/2 MAP kinases: role for an NHE-1-dependent pathway. Am J Physiol Heart Circ Physiol 283: H598H605, 2002.
48. Sawyer DB, Siwik DA, Xiao L, Pimentel DR, Singh K, and Colucci WS. Role of oxidative stress in myocardial hypertrophy and failure. J Mol Cell Cardiol 34: 379388, 2002.[CrossRef][Web of Science][Medline]
49. Shen X, Valencia CA, Szostak J, Dong B, and Liu R. Scanning the human proteome for calmodulin-binding proteins. Proc Natl Acad Sci USA 102: 59695974, 2005.
50. Siwik DA and Colucci WS. Regulation of matrix metalloproteinases by cytokines and reactive oxygen/nitrogen species in the myocardium. Heart Fail Rev 9: 4351, 2004.[CrossRef][Web of Science][Medline]
51. Solomon SS, Palazzolo MR, Takahashi T, and Raghow R. Transcription factor Sp1 is necessary for basal calmodulin gene transcription and for its selective stimulation by insulin. Endocrinology 138: 50525054, 1997.
52. Stevens-Truss R and Marletta MA. Interaction of calmodulin with the inducible murine macrophage nitric oxide synthase. Biochemistry 34: 1563815645, 1995.[CrossRef][Medline]
53. Taylor LS, Cox GW, Melillo G, Bosco MC, and Espinoza-Delgado I. Bryostatin-1 and IFN-
synergize for the expression of the inducible nitric oxide synthase gene and for nitric oxide production in murine macrophages. Cancer Res 57: 24682473, 1997.
53a. Ten Broeke R, Leusink-Muis T, Hilberdink R, Van Ark I, van den Worm E, Villain M, De Clerck F, Blalock JE, Nijkamp FP, and Folkerts G. Specific modulation of calmodulin activity induces a dramatic production of superoxide by alveolar macrophages. Lab Invest 84: 2940, 2004.[CrossRef][Web of Science][Medline]
54. Tran QK, Black DJ, and Persechini A. Dominant affectors in the calmodulin network shape the time courses of target responses in the cell. Cell Calcium 37: 541553, 2005.[CrossRef][Web of Science][Medline]
55. Tran QK, Black DJ, and Persechini A. Intracellular coupling via limiting calmodulin. J Biol Chem 278: 2424724250, 2003.
56. Tsai EY, Falvo JV, Tsytsykova AV, Barczak AK, Reimold AM, Glimcher LH, Fenton MJ, Gordon DC, Dunn IF, and Goldfeld AE. A lipopolysaccharide-specific enhancer complex involving Ets, Elk-1, Sp1, and CREB binding protein and p300 is recruited to the tumor necrosis factor
promoter in vivo. Mol Cell Biol 20: 60846094, 2000.
57. Walker G, Pfeilschifter J, Otten U, and Kunz D. Proteolytic cleavage of inducible nitric oxide synthase (iNOS) by calpain I. Biochim Biophys Acta 1568: 216224, 2001.[Medline]
58. Weber TJ, Monks TJ, and Lau SS. DDM-PGE2-mediated cytoprotection in renal epithelial cells by a thromboxane A2 receptor coupled to NF-
B. Am J Physiol Renal Physiol 278: F270F278, 2000.
59. Weber TJ, Monks TJ, and Lau SS. PGE2-mediated cytoprotection in renal epithelial cells: evidence for a pharmacologically distinct receptor. Am J Physiol Renal Physiol 273: F507F515, 1997.
60. Weber TJ, Negash S, Smallwood HS, Ramos KS, Thrall BD, and Squier TC. Calmodulin involvement in stress-activated nuclear localization of albumin in JB6 epithelial cells. Biochemistry 43: 74437450, 2004.[CrossRef][Medline]
61. Xaus J, Comalada M, Valledor AF, Cardó M, Herrero C, Soler C, Lloberas J, and Celada A. Molecular mechanisms involved in macrophage survival, proliferation, activation or apoptosis. Immunobiology 204: 543550, 2001.[CrossRef][Web of Science][Medline]
62. Xaus J, Comalada M, Valledor AF, Lloberas J, López-Soriano F, Argilés JM, Bogdan C, and Celada A. LPS induces apoptosis in macrophages mostly through the autocrine production of TNF-
. Blood 95: 38233831, 2000.
63. Yap KL, Kim J, Truong K, Sherman M, Yuan T, and Ikura M. Calmodulin target database. J Struct Funct Genomics 1: 814, 2000.[CrossRef][Medline]
64. Zou W, Amcheslavsky A, Takeshita S, Drissi H, and Bar-Shavit Z. TNF-
expression is transcriptionally regulated by RANK ligand. J Cell Physiol 202: 371378, 2005.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
K. M. Waters, L. M. Masiello, R. C. Zangar, B. J. Tarasevich, N. J. Karin, R. D. Quesenberry, S. Bandyopadhyay, J. G. Teeguarden, J. G. Pounds, and B. D. Thrall Macrophage Responses to Silica Nanoparticles are Highly Conserved Across Particle Sizes Toxicol. Sci., February 1, 2009; 107(2): 553 - 569. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Markel, P. R. Crisostomo, M. Wang, Y. Wang, T. Lahm, N. M. Novotny, J. Tan, and D. R. Meldrum TNFR1 signaling resistance associated with female stem cell cytokine production is independent of TNFR2-mediated pathways Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2008; 295(4): R1124 - R1130. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Dutta, S. K. Sundaram, J. G. Teeguarden, B. J. Riley, L. S. Fifield, J. M. Jacobs, S. R. Addleman, G. A. Kaysen, B. M. Moudgil, and T. J. Weber Adsorbed Proteins Influence the Biological Activity and Molecular Targeting of Nanomaterials Toxicol. Sci., November 1, 2007; 100(1): 303 - 315. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Markel, P. R. Crisostomo, M. Wang, C. M. Herring, and D. R. Meldrum Activation of individual tumor necrosis factor receptors differentially affects stem cell growth factor and cytokine production Am J Physiol Gastrointest Liver Physiol, October 1, 2007; 293(4): G657 - G662. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |