Am J Physiol Cell Physiol AJP: Advances in Physiology Education
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 290: C1477-C1486, 2006. First published December 28, 2005; doi:10.1152/ajpcell.00374.2005
0363-6143/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/6/C1477    most recent
00374.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lu, M.
Right arrow Articles by Shyy, J. Y.-J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lu, M.
Right arrow Articles by Shyy, J. Y.-J.

CELLULAR METABOLISM

Sterol regulatory element-binding protein 1 is negatively modulated by PKA phosphorylation

Min Lu and John Y.-J. Shyy

Division of Biomedical Sciences, University of California, Riverside, Riverside, California

Submitted 22 July 2005 ; accepted in final form 21 December 2005


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Sterol regulatory element-binding protein (SREBP)-1a and -1c are key transcription factors that regulate lipid biosynthesis in cells. We identified that Ser338 located at the NH2 terminus of SREBP-1a is a PKA phosphorylation site in vitro and in HepG2 cells. PKA phosphorylation of this site attenuated DNA occupancy, as revealed by chromatin immunoprecipitation assay, and the ensuing transactivation. In contrast, replacing Ser with Ala [SREBP-1a(N)-S338A] increased transactivation. Although it forms heterodimers with the wild-type SREBP-1a(N) or S338A but not a homodimer with itself, SREBP-1a(N)-S338D (replacing Ser with Asp) decreased DNA binding. Ser314 of SREBP-1c, the counterpart of SREBP-1a Ser338, was also phosphorylated by PKA. Accordingly, the adenovirus-mediated expression of SREBP-1c(N)-S314D in HepG2 cells retarded lipogenesis. Our results indicate that the cAMP-PKA pathway, by phosphorylating SREBP-1, may modulate lipid metabolism in liver cell lines.

metabolism; glucagon; insulin; lipogenesis


UNDER PHYSIOLOGICAL CONDITIONS, glucose and fatty acid metabolism are tightly controlled by the pancreatic hormones insulin and glucagon (24). The biosynthesis of lipids in the liver is negatively regulated during fasting or acute stress response, at least in part, by the elevated level of cAMP (2, 8, 40). Glucagon, adrenalines, and other reagents that raise the cellular cAMP concentration level reduce the activity or level of lipogenic enzymes in hepatocytes (19, 25). These enzymes include fatty acid synthase (FAS), stearoyl-CoA desaturase (SCD), and glycerol-3-phosphate acyltransferase (GPAT), which are critical for the synthesis of fatty acids and triglycerides. The cAMP-dependent kinase, PKA, which is a major protein kinase activated by cAMP, has been shown to be involved in lipid metabolism as well. Increased PKA activity in response to adrenergic stimulation results in a lean phenotype and improved insulin sensitivity in mice in which the PKA-regulatory type II beta-subunit is ablated (12, 34). In contrast, mice deficient in three known beta-adrenergic receptors become obese (3).

Sterol regulatory element-binding protein 1 (SREBP-1) plays a central role in fatty acid metabolism through the transcriptional regulation of target genes such as FAS and SCD (18). SREBP-1a and -1c, which belong to the basic helix-loop-helix (bHLH) leucine zipper (or bHLH-Zip) family of transcription factors, are encoded by the srebp1 gene with an alternative exon 1 (5). When the cellular sterol level is high, SREBPs form a complex with SREBP cleavage-activating protein (SCAP) and insulin-induced genes (INSIGs) on the endoplasmic reticulum (ER) membrane, which prevents SREBPs from entering the nucleus to activate target genes (42). When sterols are depleted in the cell, SCAP undergoes a conformational change to dissociate the SCAP-SREBP complex from INSIGs (1). As a result, SCAP escorts SREBPs to the Golgi, where SREBPs undergo two-step proteolytic cleavage resulting in the translocation of their NH2 termini into the nucleus and their functioning as transcription factors (6). Treatment of primary rat hepatocytes with insulin increased the level of SREBP-1c mRNA (16). In contrast, overexpression of a dominant-negative mutant of SREBP-1c in hepatocytes significantly reduced insulin-enhanced lipogenesis (17). In vivo insulin deprivation causes a reduction in the level of hepatic SREBP-1c, which is reversed by insulin administration (36). Thus the lipogenic effect of insulin in hepatocytes occurs largely through SREBP-1c (22).

Glucagon or dibutyryl cAMP inhibits insulin-increased SREBP-1c mRNA and expression of the SREBP-1c-regulated genes involved in lipogenesis (17). However, the molecular mechanism underlying this inhibition is still unclear. Although allosteric regulation and posttranslational modification have been suggested to play roles in glucagon regulation of acetyl-CoA carboxylase (ACC), most of the SREBP-1-targeted genes (e.g., FAS, GPAT) are modulated at the transcriptional level. Hence, the activity of SREBP-1 appears to be crucial to integrating hormonal regulation upon lipogenesis.

The phosphorylation of transcription factors has a profound effect on their function. Compelling evidence suggests that phosphorylation on the bHLH domain regulates translocation, dimerization, protein-protein interaction, and DNA binding of bHLH factors (15, 45). In light of the potential roles of PKA in attenuating lipogenesis and affecting bHLH-mediated transcription, we investigated the molecular mechanism by which the cAMP-PKA pathway regulates SREBP-1. Although SREBP-1c is the major isoform of SREBP-1 in tissues, SREBP-1a is predominant in most cell lines, including the human hepatoma cell line HepG2 (35). In the current study, we used HepG2 as a model system with which to demonstrate novel PKA phosphorylation sites in the NH2 termini of SREBP-1a and SREBP-1c. PKA phosphorylation at these sites greatly suppressed SREBP-1 transactivation, revealing an inhibitory effect on SREBP-mediated lipogenesis.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Materials and cell culture. The PKA catalytic subunit (PKA-C), anti-hemagglutinin (HA) MAb, and Oil Red O stain were purchased from Sigma-Aldrich (St. Louis, MO). Forskolin, 8-bromoadenosine 3',5'-cyclic monophosphate (8-Br-cAMP), okadaic acid, N-acetyl-Leu-Leu-Nle-CHO (ALLN), and cytochalasin D were obtained from Calbiochem (La Jolla, CA). PKA peptide inhibitor (PKI 5-24) was purchased from Promega (Madison, WI). Anti-SREBP-1 MAb 2A4 was purchased from BD Pharmingen (La Jolla, CA). The human hepatoma cell line HepG2 and human embryonic kidney (HEK)-293 cells, obtained from the American Type Culture Collection (ATCC; Manassas, VA), were cultured in DMEM supplemented with 100 U/ml penicillin-streptomycin, 1 mM sodium pyruvate, and 10% FBS. The cellular proteins and nuclear extracts were isolated from cells according to previously published protocols (14).

DNA plasmid and transient transfection. Reporter constructs driven by the low-density lipoprotein receptor (LDLR) and ACC gene promoters were described previously (27, 33). Expression plasmids pCMV-HA-SREBP-1a(N) and pCMV-HA-SREBP-1c(N), driven by cytomegalovirus (CMV) promoter, were constructed by inserting the coding sequence of amino acids (aa) 2–460 of SREBP-1a or aa 2–436 of SREBP-1c into a pCMV-HA vector on the basis of pSREBP-1a (no. 79810; ATCC) and pCMV-SREBP-1c-436 (no. 99636; ATCC). The respective SREBP-1a and SREBP-1c mutant plasmids (S337A, S337D, S338A, and S338D for SREBP-1a; S314A and S314D for SREBP-1c) were constructed using a site-directed mutagenesis kit (Stratagene, La Jolla, CA). The PCR fragments of wild-type (WT)-SREBP-1a(N), WT-SREBP-1c(N), and various mutants were subcloned into a pGEX-4T1 plasmid to produce vectors encoding the glutathione-S-transferase (GST) fusion proteins. HepG2 cells were transfected at 60% confluence in six-well plates with plasmids expressing SREBP-1a(N), SREBP-1c(N), or their mutants at 300 ng/well, together with various luciferase (Luc) reporters (400 ng/well) and CMV-beta-galactosidase (CMV-beta-gal; 100 ng/well) using Lipofectamine reagent (Invitrogen, La Jolla, CA). Twenty-four hours after transfection, the cells were treated with various reagents for another 10 h. The cells were then lysed for Luc and beta-gal activity assays.

In vitro kinase activity assay. All GST fusion proteins were produced in a transformed BL21 Escherichia coli strain. Five micrograms of GST fusion proteins were mixed with 10 µg of HepG2 cell lysates in kinase buffer containing 50 mM Tris·HCl, pH 7.5, 10 mM MgCl2, 2 µM cAMP, 5 µM ATP, and 10 mCi/ml [{gamma}-32P]ATP in the presence or absence of PKI (5 U) in a final volume of 25 µl to initiate kinase reactions at 30°C. After 20 min, reactions were terminated by adding stop solution (0.1 M ATP and 0.1 M EDTA, pH 8.0). The radiolabeled proteins were separated by 10% SDS-PAGE and visualized using autoradiography. In separate sets of experiments, 5 U of purified PKA instead of cell lysates were added to the reaction mixture as the enzyme source.

Immunoprecipitation and Western blot analysis. The rabbit anti-phospho-SREBP-1 antibody was raised against a synthetic peptide, E-K-R-Y-R-S-S(PO3)-I-N-D-K-I-I-E, by Covance Research Products (Denver, PA). The phosphorylated Ser corresponded to Ser338 of human SREBP-1a or Ser314 of human SREBP-1c. The raised antibody was passed through an affinity column conjugated with unphosphorylated peptide and then affinity purified on a column containing the phosphorylated peptide. In vitro phosphorylated GST-SREBP-1a(N), phosphorylated GST-SREBP-1c(N), or HepG2 cell lysates were incubated with a buffer containing anti-phospho-SREBP-1, 20 mM Tris·HCl, pH 7.5, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 0.1% Nonidet P (NP)-40, 1 mM EDTA, 1 mM PMSF, 25 µg/ml ALLN, and protease inhibitor cocktail (Roche, Indianapolis, IN). After incubation at 4°C for 3 h, protein A Sepharose 4B (Zymed Laboratories, San Francisco, CA) was added to the immunoprecipitates and incubated for 1 h. The Sepharose beads were then washed extensively three times before being subjected to Western blot analysis. The anti-phospho-SREBP-1 immunoprecipitates, cytosol, or nuclear extracts from HepG2 cells were separated by performing 10% SDS-PAGE. The blots were incubated first with a blocking buffer (PBS containing 0.05% Tween 20 and 5.5% nonfat milk), followed by blocking buffer containing various primary antibodies (1:600 dilution; vol/vol). The bound antibodies were detected using horseradish peroxidase-conjugated secondary antibodies (1:4,000 dilution; vol/vol) in blocking buffer and visualized using ECL.

GST pull-down assay. Recombinant GST, GST-SREBP-1a(N), and GST-SREBP-1a(N)-S338D were immobilized and purified on glutathione-Sepharose 4B beads. Nuclear extracts (150 µg) isolated from HEK-293 cells transfected with plasmids encoding HA-SREBP-1a(N) or its mutants were incubated with the beads (10 µg protein) at 4°C for 2 h in a buffer containing 20 mM Tris·HCl, pH 7.4, 0.5% NP-40, 1 mM EDTA, and 200 mM NaCl. The beads were then washed three times and boiled in the sample buffer. The pull-down proteins were analyzed using SDS-PAGE and immunoblot analysis.

EMSA and chromatin immunoprecipitation assay. Nuclear extracts prepared using standard protocols were incubated with the 32P-labeled sterol-regulatory element (SRE) oligonucleotide (GCGATCAAAATCACCCCACTGCAC) in a binding buffer containing 10 mM HEPES, pH 7.9, 10% glycerol, 1 mM DTT, 1 mM EDTA, 50 mM KCl, 2.5 mM MgCl2, 1 mg/ml nonfat milk, and 1 µg of poly(dI-dC) at room temperature for 20 min. Protein-DNA complexes were separated by 5% PAGE, and the bands were visualized using autoradiography. For EMSA involving recombinant proteins, 2 ng of GST-SREBP-1a(N) were mixed with different amounts of S338D or S338A in EMSA binding buffer at 37°C for 45 min. The 32P-labeled SRE oligonucleotide was then added, and the solution was incubated at room temperature for 20 min before we performed SDS-PAGE.

Chromatin immunoprecipitation (ChIP) assays were performed as described by the manufacturer (Upstate Biotechnology, Lake Placid, NY) with minor modifications. In brief, HepG2 cells cultured in Complete medium were stimulated with forskolin (40 µM) for the time indicated and then fixed by addition of formaldehyde (final concentration, 1%) for 15 min at room temperature. Chromatin solutions were sonicated, diluted, and incubated with 4 µg of anti-SREBP-1 MAb 2A4, anti-HA, or mouse IgG antibody at 4°C. Immunocomplexes were collected with salmon sperm DNA/protein A agarose. Immunoprecipitates were pelleted by centrifugation, and 1% of the supernatant was used as an input control. After being washed, chromatin DNA was eluted, purified, and subjected to PCR analysis. The human SCD gene promoter containing SRE was amplified using the following primer set: 5'-TGAGAAGGAGAAACAGAGGGGAGGGGGAGC-3' and 5'-GCGCCGGGGATGCTGCCGACACCGACACCA-3'. Primer sets for the FAS gene promoter were 5'-GGCGGCCACGCCACATGGGCTGACAGC-3' and 5'-CCCCGGCGCTCCTCAGTCCCAGCCCCA-3'. The primers used for the ATP-citrate lyase (ACL) gene promoter are available upon request. PCR analysis was performed using the following thermal cycles: 95°C for 5 min, 28 times (95°C for 1 min, 68°C for 1 min, and 72°C for 1 min), and 72°C for 10 min. In some PCR experiments, cosolvents such as glycerol and DMSO were used. PCR products were resolved on a 2% agarose gel and visualized using ethidium bromide staining.

Adenovirus preparation, HepG2 infection, and Oil Red O staining. Recombinant adenoviruses expressing the SREBP-1c(N)-WT and its S314A and S314D mutants were created using the Adeno-X Tet-Off system (Clontech, Palo Alto, CA). Briefly, cDNA encoding aa 2–436 of SREBP-1c tagged with HA was inserted into the SacII/XbaI restriction enzyme sites of the pTRE-Shuttle2 shuttle vector. The I-CeuI/PI-SceI-digested shuttle vector was then ligated into Adeno-X viral DNA. The PacI-digested viral DNA was transfected into HEK-293 cells for virus amplification. HepG2 cells cultured in collagen-coated plates were incubated with various adenoviruses at 10 multiplicities of infection for 4 h. The medium was then replaced with fresh medium containing 10% FBS for 48 h. The infected cells were fixed with 4% paraformaldehyde and stained with Oil Red O for lipid staining. In some experiments, stained dye was extracted by isopropanol, which was quantified at 510 nm using a spectrophotometer.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
cAMP and PKA downregulate the SREBP-1a-mediated transcription. Using transient transfection assays, we first investigated the effect of 8-Br-cAMP, a membrane-permeable cAMP analog, and forskolin, a potent activator of adenylate cyclase, on SREBP-1a(N)-mediated transcription. HepG2 cells were cotransfected with a Luc reporter driven by four copies of SRE (i.e., 4xSRE-Luc), together with an expression plasmid encoding the nuclear form of SREBP-1a [pCMV-HA-SREBP-1a(N)]. Constitutive expression of SREBP-1a(N) induced 4xSRE-Luc drastically compared with pcDNA3 mock controls (Fig. 1). This SREBP-1a(N)-mediated Luc induction was attenuated significantly in cells treated with 8-Br-cAMP or forskolin, whereas the level of expressed HA-SREBP-1a(N) was not affected (data not shown). Cotransfection of HepG2 cells with PKA-C produced a similar inhibitory effect. Furthermore, okadaic acid, a protein phosphatase (PP) inhibitor that causes hyperphosphorylation, suppressed the transcription activity of SREBP-1a(N). PKA negatively regulates the actin-based cytoskeletal structure (21), which contributes to SREBP cleavage and transport (26). Disruption of actin with cytochalasin D treatment did not change SREBP transactivation, which suggests that downregulation of SREBP-1a-mediated transcription by PKA occurs through a mechanism independent of the cytoskeleton. Notably, the basal level of 4xSRE-Luc was inhibited by the PKA activator as well. This phenomenon is probably attributable to the inhibition of endogenous SREBP-1 by PKA, because other reporter systems (e.g., 5xATF6-Luc) were not affected by the various PKA activators (data not shown).


Figure 1
View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1. cAMP and PKA inhibit the transcriptional activity of sterol regulatory element-binding protein (SREBP)-1a(N) in HepG2 cells. HepG2 cells were transfected with the 4xSRE-luciferase (Luc) reporter and cytomegalovirus (CMV)-beta-galactosidase (CMV-beta-gal), together with either a pcDNA3 empty vector or pCMV-hemagglutinin (HA)-SREBP-1a(N). Twenty-four hours after transfection cells were subjected to various treatments for another 10 h and then lysed for Luc and beta-gal activity assays. The Luc activity in the various samples was normalized to that of beta-gal for transfection efficiency and compared with untreated controls transfected with pcDNA3 set as 1. Treatments in this study were 8-bromoadenosine 3',5'-cyclic monophosphate (8-BrcAMP; 1 mM), forskolin (10 µM), okadaic acid (25 nM), and cytochalasin D (100 nM). PKA-C indicates that cells were cotransfected with plasmids encoding the catalytic subunit of PKA (300 ng).

 
To test whether cAMP or PKA changes the proteolytic cleavage and/or nuclear transportation of endogenous SREBP-1, we prepared cytosol and nuclear fractions of cell lysates from HepG2 cells treated with forskolin. Levels of the SREBP-1 precursor in the cytosol and the mature form of SREBP-1 in the nucleus changed only marginally up to 10 h after forskolin treatment (data not shown). The results shown in Fig. 1 suggest that the downregulation of SREBP-targeted genes via the PKA pathway was a result of attenuated SREBP transactivation, which in turn was due to a process other than cleavage or nuclear translocation of SREBPs.

Ser338 of SREBP-1a and Ser314 of SREBP-1c are PKA phosphorylation sites. Because cAMP and PKA downregulated the CMV-driven SREBP-1a(N), we hypothesized that this downregulation occurs through PKA phosphorylation of SREBP-1a. To identify the putative PKA phosphorylation site in SREBP-1a, we searched the GenBank database and aligned the protein sequences of SREBPs from different species (Fig. 2). A short motif distinct from other common bHLH transcription factors was found within the bHLH DNA binding domain of all SREBP-1 and SREBP-2 subtypes. This short motif, for example, aa residues 334–339 (R-Y-R-S-S-I) of human SREBP-1a, encodes two putative PKA sites, namely, Ser337 and Ser338 (23, 30). We then performed kinase activity assays using the GST-SREBP-1a(N)-WT fusion protein and its mutant to investigate whether Ser337 and/or Ser338 of SREBP-1a could be phosphorylated by PKA. With the addition of cAMP, cell lysates isolated from HepG2 cells caused the phosphorylation of the fusion protein (Fig. 3A). GST-SREBP-1a(N)-WT was also phosphorylated by purified PKA-C. This phosphorylation was blocked by PKI, a PKA-specific inhibitor (Fig. 3B). GST-SREBP-1a(N) mutants in which Ser337 was replaced by either Ala or Asp (i.e., S337A or S337D) were phosphorylated by PKA-C, as was the WT (Fig. 3B). In contrast, GST, GST-SREBP-1a(N)-S338A, and GST-SREBP-1a(N)-S338D were not phosphorylated. These results suggest that Ser338, but not Ser337, is a PKA-specific phosphorylation site.


Figure 2
View larger version (52K):
[in this window]
[in a new window]
 
Fig. 2. The sequences of human, mouse, rat, chicken, rabbit, pig, dog, hamster, Drosophila, and Caenorhabditis elegans SREBPs were aligned with the classic basic helix-loop-helix (bHLH) DNA binding domain represented by a scheme shown above the protein sequences. Numbers indicate amino acid (aa) sequences in human SREBP-1a. Light gray columns indicate conserved residues in SREBPs and the basic region of the classic bHLH domain. Yellow-shaded column highlights the conserved Ser in SREBPs but not in the classic bHLH domain. The open and dark gray columns indicate conserved residues in the helix and loop regions, respectively.

 

Figure 3
View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3. SREBP-1 is phosphorylated by PKA in vitro and in vivo. A: glutathione-S-transferase (GST)-SREBP-1a(N) fusion protein was incubated with HepG2 cell lysates in the presence of cAMP and [{gamma}-32P]ATP for the times indicated. The reaction mixture was then separated by SDS-PAGE, and phosphorylated SREBP-1a(N) was visualized using autoradiography. B: GST-SREBP-1a(N), the wild-type (WT)-GST-SREBP-1a(N), or the GST-SREBP-1a(N)-S337A, GST-SREBP-1a(N)-S337D, GST-SREBP-1a(N)-S338A, or GST-SREBP-1a(N)-S338D mutant fusion proteins were incubated with purified PKA-C and [{gamma}-32P]ATP in the presence or absence of PKA peptide inhibitor (PKI 5-24) for 20 min. The phosphorylation of various fusion proteins was revealed using autoradiography. C and D: GST-SREBP-1a(N), GST-SREBP-1a(N)-S338A, GST-SREBP-1c(N), and GST-SREBP-1c(N)-S314A were incubated with PKA-C for different times in the presence (i.e., +) or absence of PKI as indicated. The reaction mixture was subjected to immunoprecipitation (IP) using an anti-phospho-SREBP-1 antibody (i.e., {alpha}-SREBP1-{circ}P) that specifically recognizes phosphorylated Ser338. The immunoprecipitates were subjected to SDS-PAGE and immunoblot (IB) analysis with anti-SREBP-1 antibody. One hundred percent input was included to reveal the amount of GST-SREBP fusion protein before immunoprecipitation. E: HepG2 cells were pretreated with okadaic acid (0.5 µM) for 10 min before forskolin treatment for various times to induce PKA activation, and the cell lysates were subjected to immunoprecipitation with anti-phospho-SREBP-1 antibody. The precipitates were separated by SDS-PAGE and blotted with anti-SREBP-1 antibody. Five percent input was loaded to show the equal amount of SREBP-1 in all groups before immunoprecipitation.

 
To address whether SREBP-1 is phosphorylated by the cAMP-PKA pathway in vivo, an antiserum was raised against a synthetic peptide that was chemically phosphorylated on the residue corresponding to Ser338 of SREBP-1a or to Ser314 of SREBP-1c (E-K-R-Y-R-S-S-I-N-D-K-I-I-E). Although the affinity-purified antiserum did not recognize denatured proteins when we performed Western blot analysis (data not shown), we found that it could immunoprecipitate the phosphorylated but not the unphosphorylated SREBP-1a (Fig. 3C). Because Ser338 of SREBP-1a and Ser314 of SREBP-1c share an identical flanking sequence, we examined whether SREBP-1c could be phosphorylated as well. As shown in Fig. 3D, this antiserum immunoprecipitated the PKA-phosphorylated SREBP-1c(N) but not its S314A mutant. Thus PKA can phosphorylate both SREBP-1 isoforms in the same motif in vitro. To further investigate the phosphorylation of SREBP-1 by PKA in cells, phosphorylated SREBP-1 was immunoprecipitated using anti-phospho-SREBP-1 from the forskolin-treated HepG2 cells that were pretreated with okadaic acid, a PP1 and PP2A inhibitor. Western blot analysis using anti-SREBP-1 showed that both the precursor and mature forms of SREBP-1 were phosphorylated after forskolin treatment (Fig. 3E).

Phosphorylated SREBP-1 decreases transactivation and cannot form a homodimer. We created expression plasmids encoding a mutant SREBP-1a(N) with Ala or Asp replacing Ser337 or Ser338 that mimicked the respective dephosphorylated and phosphorylated forms. The results of transient transfection assays showed that S337A and S337D have induction effects similar to those of their parental WT forms on SRE-Luc, LDLR-Luc, and ACC-Luc (Fig. 4A). However, the induction of these SRE-driven constructs by S338A was significantly higher than that of WT and ameliorated the inhibitory effect of forskolin (Fig. 4A). Furthermore, the Asp mutation of Ser338 (i.e., S338D) abolished the induction of these reporter systems. These results suggest that the phosphorylation and dephosphorylation of Ser338 are linked functionally to SREBP-1a(N)-mediated transcription. Mutations of S314 of SREBP-1c with either Ala or Asp (i.e., S314A and S314D) resulted in a comparable increase or decrease of transactivation on 4xSRE-Luc (Fig. 4B). To further confirm that phosphorylation of SREBP-1 would not affect its nuclear translocation, we compared the distribution of the expressed SREBP-1a(N)-WT, S338A, and S338D in the cytosol with that in the nucleus in HEK-293 cells, because this cell line can achieve higher ectopic expression to override endogenous SREBP. As shown in Fig. 4C, the levels of SREBP-1a(N) in the nucleus were not affected by the replacement of Ser338 with either Ala or Asp, indicating that SREBP-1 nuclear translocation was not changed by PKA phosphorylation. Similar results were obtained in experiments involving HepG2 cells (data not shown).


Figure 4
View larger version (22K):
[in this window]
[in a new window]
 
Fig. 4. Phosphorylation of SREBP-1(N) attenuates transactivation but not nuclear translocation. A: HepG2 cells were cotransfected with a 4xSRE-Luc reporter together with expression plasmids encoding SREBP-1a(N)-WT, SREBP-1a(N)-S337A, SREBP-1a(N)-S337D, SREBP-1a(N)-S338A, or SREBP-1a(N)-S338D mutants. In a parallel experiment, LDL receptor (LDLR)- or acetyl-CoA carboxylase (ACC)-Luc reporter systems were used instead of 4xSRE-Luc. Twenty-four hours after transfection cells were lysed for Luc and beta-gal activity assays. B: HepG2 cells were transfected with 4xSRE-Luc together with SREBP-1c(N)-WT, SREBP-1c(N)-S314A, or SREBP-1c(N)-S314D mutants for Luc induction assays. C: human embryonic kidney (HEK)-293 cells were transfected in 100-mm-diameter dishes with 5 µg of SREBP-1a(N)-WT, SREBP-1a(N)-S338A, or SREBP-1a(N)-S338D. Thirty-six hours after transfection the isolated cytosolic (70 µg) and nuclear proteins (30 µg) were subjected to SDS-PAGE followed by immunoblot analysis with anti-HA antibody.

 
Because the phosphorylation and dephosphorylation of the bHLH domain can modify the dimerization of transcription factors and hence change their transactivation (15), we next investigated whether SREBP-1a(N)-S338D and -S338A can form a heterodimer with the WT or a homodimer with themselves. The results of the pull-down assays shown in Fig. 5A revealed that GST-SREBP-1a(N)-WT associated with S338D or S338A mutants expressed in HEK-293 cells. Although GST-SREBP-1a(N)-S338D bound to SREBP-1a(N)-WT and S338A, it could not associate with S338D. These results suggest that phosphorylated SREBP-1a(N) cannot form a homodimer.


Figure 5
View larger version (28K):
[in this window]
[in a new window]
 
Fig. 5. Phosphorylation of Ser338 changes dimerization and DNA binding of SREBP-1a(N). A: HEK-293 cells were transfected with an equal amount of pCMV-HA-SREBP-1a(N)-WT, -S338A, or -S338D. Thirty-six hours after transfection nuclear proteins were extracted and incubated with GST, GST-SREBP-1a(N)-WT, SREBP-1a(N)-S338A, and SREBP-1a(N)-S338D fusion proteins for pull-down assays. The GST-associated proteins were subjected to SDS-PAGE and immunoblot analysis using anti-HA antibody. B: HEK-293 cells were transfected with pCMV-HA-SREBP-1a(N)-WT, -S338A, or -S338D. Nuclear extracts were isolated and incubated with 32P-labeled oligonucleotides containing sterol-regulatory element (SRE). The DNA-protein complexes were then subjected to EMSA. SC and NC denote competition by unlabeled specific and nonspecific probes, respectively. C: HepG2 cells were transfected with 4xSRE-Luc, CMV-beta-gal, and pcDNA3 or pCMV-HA-SREBP-1a(N)-WT in the presence of varying amounts of S338D mutant plasmid, with the S338D-to-WT ratio ranging from 1:1 to 1:3. Thirty-six hours after transfection cells were lysed and Luc and beta-gal activities were measured. The normalized Luc activity in the various samples was compared with controls transfected with 4xSRE-Luc, pcDNA3, and CMV-beta-gal. D: recombinant SREBP-1a(N)-WT was mixed with S338D or S338A in ratios ranging from 1:1 to 1:3. After dimerization, the mixtures were incubated with 32P-labeled oligonucleotides containing SRE. DNA-protein complexes were then subjected to EMSA. S338D alone (middle lane) was used as a negative control. E: GST-SREBP-1a(N) and GST-SREBP-1a(N)-S338A (20 ng) were incubated with PKA-C in the presence or absence of PKI as indicated. After being subjected to kinase reaction, GST fusion proteins (2 ng) were incubated with 32P-labeled oligonucleotides containing SRE for EMSA. F: HepG2 cells were treated with forskolin (20 µM) for the indicated times. Nuclear extracts were isolated and subjected to EMSA.

 
Phosphorylated SREBP-1 impairs its binding to SRE. To investigate whether Ser338 phosphorylation affects DNA binding, we used EMSA to compare the binding of SREBP-1a(N)-WT, -S338A, and -S338D to SRE. Compared with SREBP-1a(N)-WT, SREBP-1a(N)-S338A exhibited higher binding to SRE. Importantly, SREBP-1a(N)-S338D did not bind to SRE (Fig. 5B). Provided that the levels of ectopic expression of SREBP-1a(N)-WT and its mutants in the nucleus are similar (Fig. 4C), the PKA-attenuated SREBP-1 transactivation will occur mostly through impaired DNA binding.

The association of S338D with S338A suggests that phosphorylated SREBP-1a(N) forms a heterodimer with the dephosphorylated counterpart. Thus we further examined whether S338D can function as an interfering mutant to attenuate SREBP-1a-mediated transcription. As shown in Fig. 5C, the attenuation of SREBP-1a(N)-induced Luc activity by cotransfected S338D was dose dependent. Given the interfering effect of S338D, we studied the binding of various SREBP-1a(N) heterodimers to SRE. As shown in Fig. 5D, the binding of the WT-S338D heterodimer to SRE was significantly weaker than that of WT-S338A, which suggests that the attenuated transactivation was a result of hindered DNA binding by phosphorylated SREBP-1a(N). The decreased SRE binding of S338D in cells (Fig. 5B) was similar to that of the PKA-phosphorylated SREBP-1a(N) in vitro (Fig. 5E) and in HepG2 cells treated with forskolin (Fig. 5F). Mutation of the Ser338 phosphorylation site to Ala seemed to prevent the suppression caused by PKA in vitro (Fig. 5E).

By performing ChIP assays, we investigated further the binding of SREBP-1 to the SCD gene promoter that contains well-conserved SRE in intact cells. As shown in Fig. 6A, the binding of SREBP-1 to the SCD gene promoter was decreased in forskolin-treated HepG2 cells. The reduced SREBP-1-DNA interactions also were found in FAS and ACL promoters (data not shown). As shown in Fig. 6B, forskolin attenuated the binding of ectopically expressed SREBP-1c(N)-WT, but not S314A, to the FAS gene promoter in HEK-293 cells (Fig. 6B, lane 4 vs. lane 3 and lane 6 vs. lane 5). However, S314D demonstrated little if any DNA binding activity (Fig. 6B, lanes 7 and 8).


Figure 6
View larger version (24K):
[in this window]
[in a new window]
 
Fig. 6. Chromatin immunoprecipitation (ChIP) assays revealed that SREBP-1 phosphorylation changes its binding to SRE-containing promoters. A: HepG2 cells were treated with forskolin for 1 or 2 h, followed by immunoprecipitation with anti-SREBP-1 or mouse IgG. PCR amplification was performed with primers specific for the stearoyl-CoA desaturase (SCD) gene promoter. The amplified DNA products were separated by agarose gel electrophoresis. B: HEK-293 cells transfected with pCMV5-HA-SREBP-1c(N) or its mutants were subjected to ChIP assay with anti-HA or anti-rabbit IgG antibody. A representative result of PCR-amplified fatty acid synthase (FAS) gene promoter is shown.

 
SREBP-1c(N)-S314A enhances lipogenesis. Although SREBP-1a has a great effect in the cell culture system, genes involved in the biosynthesis of fatty acids in vivo are preferentially regulated by SREBP-1c (16). We thus compared the lipogenic effect of the WT-SREBP-1c(N) with its mutants that had mutations at Ser314. To deliver SREBP-1c(N) and its mutant proteins into cells, we used the Tet-Off adenoviral (Ad) system. HepG2 cells were infected with Ad-SREBP-1c(N)-WT, Ad-SREBP-1c(N)-S314A, and Ad-SREBP-1c(N)-S314D, and the expression of SREBP-1c(N)-WT or mutant proteins was controlled using coinfected tetracycline-responsive transcriptional activator virus. The expression of WT-SREBP-1c(N) enhanced lipogenesis in these cells compared with cells infected with Ad-beta-gal as shown by increased Oil Red O staining in Fig. 7A. Cells infected with the same titer of Ad-SREBP-1c(N)-S314A showed greatly increased lipid deposits. In contrast, Ad-SREBP-1c(N)-S314D-infected HepG2 cells revealed little lipid accumulation. Quantification of the stained dye revealed that forskolin treatment for as short as 10 h could significantly affect lipid accumulation resulting from overexpression of SREBP-1c(N)-WT (Fig. 7B). The same treatment had little effect on either the S314A or S314D mutant. Hence, the results shown in Fig. 7 suggest that the lipogenic effect of SREBP-1c is greatly affected by the phosphorylation and dephosphorylation of Ser314.


Figure 7
View larger version (48K):
[in this window]
[in a new window]
 
Fig. 7. The lipogenic effect of SREBP-1c in liver cells is enhanced or impaired by dephosphorylation or phosphorylation at Ser314. A: HepG2 cells were infected with different viruses (10 multiplicities of infection) as indicated in the presence of tetracycline-responsive transcriptional activator (tTA) virus. Forty-eight hours after infection, lipid accumulation in cells was revealed using Oil Red O staining. Lysates from infected HepG2 cells were separated by SDS-PAGE and subjected to immunoblot analysis with anti-HA, anti-SREBP-1, and anti-actin antibodies to confirm the expression of exogenous SREBP-1c-WT and its mutant proteins induced by the tTA virus. B: HepG2 cells were infected with different viruses as described above. Twenty-six hours after infection, cells were incubated with forskolin (20 µM) for another 10 h. Cells were stained with Oil Red O, and the dye was extracted with isopropanol and quantified. *P < 0.05.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
As the key regulatory factor in lipogenesis, SREBPs are targets of hormones such as insulin, glucagon, and growth factors (17, 28, 36). The abundance of the nuclear form of SREBPs is controlled by transcriptional upregulation followed by proteolytic cleavage. However, an increasing body of evidence supports the hypothesis that posttranslational modifications of SREBPs modulate their transactivity and stability (22, 32, 39). In this study, we found that PKA phosphorylated SREBP-1 in cultured hepatoma cells and led to decreased binding and transactivation of SREBP-1. As a result, the expression of SREBP-1-mediated genes was decreased. Because the heterodimer of phosphorylated and unphosphorylated SREBP-1 retained some DNA binding capacity, neither cAMP nor forskolin suppressed the activity of nuclear SREBP-1a fully in our reporter assays. In addition to phosphorylation, cAMP also may inhibit SREBP cleavage, as suggested in a recent report (43). However, our present results have shown that levels of SREBP-1 mRNA and protein did not decrease significantly in cells treated with a cAMP analog for up to 6 h. Given that all SREBP-1c-targeted genes are quickly inhibited by cAMP (31, 38), we suggest that a rapid change in SREBP-1 transactivity induced by PKA phosphorylation is important for the inhibition of the SREBP-mediated transcription.

Our results show that Ser338 of SREBP-1a and Ser314 of SREBP-1c are phosphorylated in response to cAMP and PKA in vitro. Because both proteins have identical flanking sequences and their target genes are downregulated by cAMP in the same manner, it is probable that both SREBP-1a and -1c could be phosphorylated by PKA in vivo. If the ratio of SREBP-1a to SREBP-1c in human and rodent livers is ~1 to 9 (35) in further experiments involving rodents subjected to conditions that increase the cAMP level (e.g., fasting or "fight-or-flight" state), the physiological role of SREBP-1c phosphorylation will be validated. This notion is supported by the results shown in Fig. 7, which demonstrates that overexpressing SREBP-1c(N)-S314D did not enhance lipogenesis in HepG2 cells.

Results reported by other investigators have shown that cAMP, glucagon, and fasting negatively regulate SREBP-1c and SREBP-2 but not SREBP-1a mRNA (17, 37). In SCAP- or S1P-null mice, the level of nuclear SREBPs declined because of the interruption of ER-to-Golgi transportation and proteolytic cleavage (29). The level of SREBP-1c and SREBP-2 mRNA in these animals was reduced further in response to the decline in nuclear SREBPs, owing to the decreased autoregulation of SREBPs on SREs present in the enhancer and promoter regions of the SREBP-1c and SREBP-2 genes (29). Recent publications also showed that SRE, in concert with liver X receptor response element in the SREBP-1c promoter, is essential for SREBP-1c transcription (7, 13). However, other researchers have suggested that SRE may play a permissive role in SREBP-1c expression (11). These previous studies that revealed the importance of SRE in regulating the SREBP-1 mRNA, together with our present study, suggest that at least two mechanisms are involved in the negative regulation of SREBPs. First, the acute phosphorylation of SREBPs in both the cytosol and the nucleus decreases their dimerization and DNA binding. Second, the attenuated activity of SREBPs confers the decreased level of SREBP-1c and SREBP-2 mRNA through SRE in the promoters of SREBP-1c and SREBP-2 but not of SREBP-1a.

In normal animals, the levels of hepatic SREBP and the expression of their target gene are decreased during fasting, presumably as a result of elevated concentrations of glucagon and cAMP (17, 37). However, in the livers of transgenic (Tg) mice carrying nuclear SREBP-1c (Tg-SREBP-1cN), fasting did not cause the downregulation of SREBP-targeted mRNA (20). This previous finding seems to contradict the regulation of mature SREBP-1 via the cAMP-PKA pathway. One explanation for this contradiction is the use of the phosphoenolpyruvate carboxykinase (PEPCK) gene promoter in creating SREBP-1c-transgenic animals in the previous study (20). PEPCK, a key gluconeogenic enzyme in the liver, is strongly induced when animals are in a fasted state (44). Therefore, Tg-SREBP-1c under the control of PEPCK gene promoter would be activated in the Tg-SREBP-1cN mice after a long period of fasting. Instead of being downregulated, the expression of Tg-SREBP-1c and its target genes were elevated after starvation, as shown by Horton et al. (20). Such increases could override the inhibitory effect of PKA observed in our present study. Future studies with the use of Tg animals harboring the mutation of the SREBP-1 phosphorylation site may provide insights into the regulation of SREBP-1 in vivo.

Several publications (4, 9, 10, 41) have demonstrated that SREBP-1 not only functions as a crucial activator of lipogenic enzymes but also can transrepress the expression of genes involved in gluconeogenesis as well. We propose that hepatic glucose production is inhibited by insulin, at least in part, through the activation of SREBP-1c. To the contrary, it has been established that the cAMP-PKA pathway promotes gluconeogenesis by inducing the phosphorylation of cAMP response element-binding protein and its target genes. Because the experiments we have performed in the present study suggest that PKA may phosphorylate SREBP-1c and ameliorate its DNA binding, it is conceivable that PKA could eliminate the blocking effect of SREBP-1c on gluconeogenic enzymes. This may serve as an alternative mechanism by which PKA activates gluconeogenesis.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported in part by National Heart, Lung, and Blood Institute Grant HL-77448.


    ACKNOWLEDGMENTS
 
We thank Dr. Qiang Zhou for technical support and Dr. Timothy Osborne for the 3-hydroxy-3-methylglutaryl CoA synthase, LDLR, and ACC promoter constructs.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J. Y.-J. Shyy, Division of Biomedical Sciences, Univ. of California, Riverside, Riverside, CA 92521-0121 (e-mail: john.shyy{at}ucr.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Adams CM, Goldstein JL, and Brown MS. Cholesterol-induced conformational change in SCAP enhanced by Insig proteins and mimicked by cationic amphiphiles. Proc Natl Acad Sci USA 100: 10647–10652, 2003.[Abstract/Free Full Text]

2. Allred JB and Roehrig KL. Inhibition of hepatic lipogenesis by cyclic-3',5'-nucleotide monophosphates. Biochem Biophys Res Commun 46: 1135–1139, 1972.[CrossRef][Web of Science][Medline]

3. Bachman ES, Dhillon H, Zhang CY, Cinti S, Bianco AC, Kobilka BK, and Lowell BB. betaAR signaling required for diet-induced thermogenesis and obesity resistance. Science 297: 843–845, 2002.[Abstract/Free Full Text]

4. Bécard D, Hainault I, Azzout-Marniche D, Bertry-Coussot L, Ferré P, and Foufelle F. Adenovirus-mediated overexpression of sterol regulatory element binding protein-1c mimics insulin effects on hepatic gene expression and glucose homeostasis in diabetic mice. Diabetes 50: 2425–2430, 2001.[Abstract/Free Full Text]

5. Brown MS and Goldstein JL. The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 89: 331–340, 1997.[CrossRef][Web of Science][Medline]

6. Brown MS and Goldstein JL. A proteolytic pathway that controls the cholesterol content of membranes, cells, and blood. Proc Natl Acad Sci USA 96: 11041–11048, 1999.[Abstract/Free Full Text]

7. Cagen LM, Deng X, Wilcox HG, Park EA, Raghow R, and Elam MB. Insulin activates the rat sterol-regulatory-element-binding protein 1c (SREBP-1c) promoter through the combinatorial actions of SREBP, LXR, Sp-1 and NF-Y cis-acting elements. Biochem J 385: 207–216, 2005.[CrossRef][Web of Science][Medline]

8. Capuzzi DM, Rothman V, and Margolis S. The regulation of lipogenesis by cyclic nucleotides in intact hepatocytes prepared by a simplified technique. J Biol Chem 249: 1286–1294, 1974.[Abstract/Free Full Text]

9. Chakravarty K, Leahy P, Bécard D, Hakimi P, Foretz M, Ferré P, Foufelle F, and Hanson RW. Sterol regulatory element-binding protein-1c mimics the negative effect of insulin on phosphoenolpyruvate carboxykinase (GTP) gene transcription. J Biol Chem 276: 34816–34823, 2001.[Abstract/Free Full Text]

10. Chakravarty K, Wu SY, Chiang CM, Samols D, and Hanson RW. SREBP-1c and Sp1 interact to regulate transcription of the gene for phosphoenolpyruvate carboxykinase (GTP) in the liver. J Biol Chem 279: 15385–15395, 2004.[Abstract/Free Full Text]

11. Chen G, Liang G, Ou J, Goldstein JL, and Brown MS. Central role for liver X receptor in insulin-mediated activation of Srebp-1c transcription and stimulation of fatty acid synthesis in liver. Proc Natl Acad Sci USA 101: 11245–11250, 2004.[Abstract/Free Full Text]

12. Cummings DE, Brandon EP, Planas JV, Motamed K, Idzerda RL, and McKnight GS. Genetically lean mice result from targeted disruption of the RIIbeta subunit of protein kinase A. Nature 382: 622–626, 1996.[CrossRef][Medline]

13. Deng X, Cagen LM, Wilcox HG, Park EA, Raghow R, and Elam MB. Regulation of the rat SREBP-1c promoter in primary rat hepatocytes. Biochem Biophys Res Commun 290: 256–262, 2002.[CrossRef][Web of Science][Medline]

14. Dignam JD, Lebovitz RM, and Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 1475–1489, 1983.[Abstract/Free Full Text]

15. Firulli BA, Howard MJ, McDaid JR, McIlreavey L, Dionne KM, Centonze VE, Cserjesi P, Virshup DM, and Firulli AB. PKA, PKC, and the protein phosphatase 2A influence HAND factor function: a mechanism for tissue-specific transcriptional regulation. Mol Cell 12: 1225–1237, 2003.[CrossRef][Web of Science][Medline]

16. Foretz M, Guichard C, Ferré P, and Foufelle F. Sterol regulatory element binding protein-1c is a major mediator of insulin action on the hepatic expression of glucokinase and lipogenesis-related genes. Proc Natl Acad Sci USA 96: 12737–12742, 1999.[Abstract/Free Full Text]

17. Foretz M, Pacot C, Dugail I, Lemarchand P, Guichard C, le Lièpvre X, Berthelier-Lubrano C, Spiegelman B, Kim JB, Ferré P, and Foufelle F. ADD1/SREBP-1c is required in the activation of hepatic lipogenic gene expression by glucose. Mol Cell Biol 19: 3760–3768, 1999.[Abstract/Free Full Text]

18. Foufelle F and Ferré P. New perspectives in the regulation of hepatic glycolytic and lipogenic genes by insulin and glucose: a role for the transcription factor sterol regulatory element binding protein-1c. Biochem J 366: 377–391, 2002.[CrossRef][Web of Science][Medline]

19. Girard J, Perdereau D, Foufelle F, Prip-Buus C, and Ferré P. Regulation of lipogenic enzyme gene expression by nutrients and hormones. FASEB J 8: 36–42, 1994.[Abstract]

20. Horton JD, Bashmakov Y, Shimomura I, and Shimano H. Regulation of sterol regulatory element binding proteins in livers of fasted and refed mice. Proc Natl Acad Sci USA 95: 5987–5992, 1998.[Abstract/Free Full Text]

21. Howe AK and Juliano RL. Regulation of anchorage-dependent signal transduction by protein kinase A and p21-activated kinase. Nat Cell Biol 2: 593–600, 2000.[CrossRef][Web of Science][Medline]

22. Kim JB, Sarraf P, Wright M, Yao KM, Mueller E, Solanes G, Lowell BB, and Spiegelman BM. Nutritional and insulin regulation of fatty acid synthetase and leptin gene expression through ADD1/SREBP1. J Clin Invest 101: 1–9, 1998.[Web of Science][Medline]

23. Kreegipuu A, Blom N, and Brunak S. PhosphoBase, a database of phosphorylation sites: release 2.0. Nucleic Acids Res 27: 237–239, 1999.[Abstract/Free Full Text]

24. Larsen PR, Kronenberg HM, Melmed S, and Polonsky KS. Section VIII: Disorders of carbohydrate and lipid metabolism. Williams Textbook of Endocrinology (10th ed.), edited by Larsen PR, Kronenberg HM, Melmed S, and Polonsky KS. Philadelphia, PA: Saunders, 2003, chapt. 32, p. 1587–1589.

25. Lefevre P, Diot C, Legrand P, and Douaire M. Hormonal regulation of stearoyl coenzyme-A desaturase 1 activity and gene expression in primary cultures of chicken hepatocytes. Arch Biochem Biophys 368: 329–337, 1999.[CrossRef][Web of Science][Medline]

26. Lin T, Zeng L, Liu Y, DeFea K, Schwartz MA, Chien S, and Shyy JY. Rho-ROCK-LIMK-cofilin pathway regulates shear stress activation of sterol regulatory element binding proteins. Circ Res 92: 1296–1304, 2003.[Abstract/Free Full Text]

27. Lopez JM, Bennett MK, Sanchez HB, Rosenfeld JM, and Osborne TE. Sterol regulation of acetyl coenzyme A carboxylase: a mechanism for coordinate control of cellular lipid. Proc Natl Acad Sci USA 93: 1049–1053, 1996.[Abstract/Free Full Text]

28. Mason RJ, Pan T, Edeen KE, Nielsen LD, Zhang F, Longphre M, Eckart MR, and Neben S. Keratinocyte growth factor and the transcription factors C/EBP{alpha}, C/EBP{delta}, and SREBP-1c regulate fatty acid synthesis in alveolar type II cells. J Clin Invest 112: 244–255, 2003.[CrossRef][Web of Science][Medline]

29. Matsuda M, Korn BS, Hammer RE, Moon YA, Komuro R, Horton JD, Goldstein JL, Brown MS, and Shimomura I. SREBP cleavage-activating protein (SCAP) is required for increased lipid synthesis in liver induced by cholesterol deprivation and insulin elevation. Genes Dev 15: 1206–1216, 2001.[Abstract/Free Full Text]

30. Obenauer JC, Cantley LC, and Yaffe MB. Scansite 2.0: Proteome-wide prediction of cell signaling interactions using short sequence motifs. Nucleic Acids Res 31: 3635–3641, 2003.[Abstract/Free Full Text]

31. Paulauskis JD and Sul HS. Hormonal regulation of mouse fatty acid synthase gene transcription in liver. J Biol Chem 264: 574–577, 1989.[Abstract/Free Full Text]

32. Roth G, Kotzka J, Kremer L, Lehr S, Lohaus C, Meyer HE, Krone W, and Müller-Wieland D. MAP kinases Erk1/2 phosphorylate sterol regulatory element-binding protein (SREBP)-1a at serine 117 in vitro. J Biol Chem 275: 33302–33307, 2000.[Abstract/Free Full Text]

33. Sanchez HB, Yieh L, and Osborne TF. Cooperation by sterol regulatory element-binding protein and Sp1 in sterol regulation of low density lipoprotein receptor gene. J Biol Chem 270: 1161–1169, 1995.[Abstract/Free Full Text]

34. Schreyer SA, Cummings DE, McKnight GS, and LeBoeuf RC. Mutation of the RIIbeta subunit of protein kinase A prevents diet-induced insulin resistance and dyslipidemia in mice. Diabetes 50: 2555–2562, 2001.[Abstract/Free Full Text]

35. Shimomura I, Shimano H, Horton JD, Goldstein JL, and Brown MS. Differential expression of exons 1a and 1c in mRNAs for sterol regulatory element binding protein-1 in human and mouse organs and cultured cells. J Clin Invest 99: 838–845, 1997.[Web of Science][Medline]

36. Shimomura I, Bashmakov Y, Ikemoto S, Horton JD, Brown MS, and Goldstein JL. Insulin selectively increases SREBP-1c mRNA in the livers of rats with streptozotocin-induced diabetes. Proc Natl Acad Sci USA 96: 13656–13661, 1999.[Abstract/Free Full Text]

37. Shimomura I, Matsuda M, Hammer RE, Bashmakov Y, Brown MS, and Goldstein JL. Decreased IRS-2 and increased SREBP-1c lead to mixed insulin resistance and sensitivity in livers of lipodystrophic and ob/ob mice. Mol Cell 6: 77–86, 2000.[CrossRef][Web of Science][Medline]

38. Sul HS and Wang D. Nutritional and hormonal regulation of enzymes in fat synthesis: studies of fatty acid synthase and mitochondrial glycerol-3-phosphate acyltransferase gene transcription. Annu Rev Nutr 18: 331–351, 1998.[CrossRef][Web of Science][Medline]

39. Sundqvist A, Bengoechea-Alonso MT, Ye X, Lukiyanchuk V, Jin J, Harper JW, and Ericsson J. Control of lipid metabolism by phosphorylation-dependent degradation of the SREBP family of transcription factors by SCFFbw7. Cell Metabolism 1: 379–391, 2005.

40. Tarlow DM, Watkins PA, Reed RE, Miller RS, Zwergel EE, and Lane MD. Lipogenesis and the synthesis and secretion of very low density lipoprotein by avian liver cells in nonproliferating monolayer culture: hormonal effects. J Cell Biol 73: 332–353, 1977.[Abstract/Free Full Text]

41. Yamamoto T, Shimano H, Nakagawa Y, Ide T, Yahagi N, Matsuzaka T, Nakakuki M, Takahashi A, Suzuki H, Sone H, Toyoshima H, Sato R, and Yamada N. SREBP-1 interacts with hepatocyte nuclear factor-4{alpha} and interferes with PGC-1 recruitment to suppress hepatic gluconeogenic genes. J Biol Chem 279: 12027–12035, 2004.[Abstract/Free Full Text]

42. Yang T, Espenshade PJ, Wright ME, Yabe D, Gong Y, Aebersold R, Goldstein JL, and Brown MS. Crucial step in cholesterol homeostasis: sterols promote binding of SCAP to Insig-1, a membrane protein that facilitates retention of SREBPs in ER. Cell 110: 489–500, 2002.[CrossRef][Web of Science][Medline]

43. Yellaturu CR, Deng X, Cagen LM, Wilcox HG, Park EA, Raghow R, and Elam MB. Posttranslational processing of SREBP-1 in rat hepatocytes is regulated by insulin and cAMP. Biochem Biophys Res Commun 332: 174–180, 2005.[CrossRef][Web of Science][Medline]

44. Yoon JC, Puigserver P, Chen G, Donovan J, Wu Z, Rhee J, Adelmant G, Stafford J, Kahn CR, Granner DK, Newgard CB, and Spiegelman BM. Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature 413: 131–138, 2001.[CrossRef][Medline]

45. Zhou J and Olson EN. Dimerization through the helix-loop-helix motif enhances phosphorylation of the transcription activation domains of myogenin. Mol Cell Biol 14: 6232–6243, 1994.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
J.-K. Oem, C. Jackel-Cram, Y.-P. Li, Y. Zhou, J. Zhong, H. Shimano, L. A. Babiuk, and Q. Liu
Activation of sterol regulatory element-binding protein 1c and fatty acid synthase transcription by hepatitis C virus non-structural protein 2
J. Gen. Virol., May 1, 2008; 89(5): 1225 - 1230.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/6/C1477    most recent
00374.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lu, M.
Right arrow Articles by Shyy, J. Y.-J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lu, M.
Right arrow Articles by Shyy, J. Y.-J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.