|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CELLULAR METABOLISM
Division of Biomedical Sciences, University of California, Riverside, Riverside, California
Submitted 22 July 2005 ; accepted in final form 21 December 2005
| ABSTRACT |
|---|
|
|
|---|
metabolism; glucagon; insulin; lipogenesis
-subunit is ablated (12, 34). In contrast, mice deficient in three known
-adrenergic receptors become obese (3). Sterol regulatory element-binding protein 1 (SREBP-1) plays a central role in fatty acid metabolism through the transcriptional regulation of target genes such as FAS and SCD (18). SREBP-1a and -1c, which belong to the basic helix-loop-helix (bHLH) leucine zipper (or bHLH-Zip) family of transcription factors, are encoded by the srebp1 gene with an alternative exon 1 (5). When the cellular sterol level is high, SREBPs form a complex with SREBP cleavage-activating protein (SCAP) and insulin-induced genes (INSIGs) on the endoplasmic reticulum (ER) membrane, which prevents SREBPs from entering the nucleus to activate target genes (42). When sterols are depleted in the cell, SCAP undergoes a conformational change to dissociate the SCAP-SREBP complex from INSIGs (1). As a result, SCAP escorts SREBPs to the Golgi, where SREBPs undergo two-step proteolytic cleavage resulting in the translocation of their NH2 termini into the nucleus and their functioning as transcription factors (6). Treatment of primary rat hepatocytes with insulin increased the level of SREBP-1c mRNA (16). In contrast, overexpression of a dominant-negative mutant of SREBP-1c in hepatocytes significantly reduced insulin-enhanced lipogenesis (17). In vivo insulin deprivation causes a reduction in the level of hepatic SREBP-1c, which is reversed by insulin administration (36). Thus the lipogenic effect of insulin in hepatocytes occurs largely through SREBP-1c (22).
Glucagon or dibutyryl cAMP inhibits insulin-increased SREBP-1c mRNA and expression of the SREBP-1c-regulated genes involved in lipogenesis (17). However, the molecular mechanism underlying this inhibition is still unclear. Although allosteric regulation and posttranslational modification have been suggested to play roles in glucagon regulation of acetyl-CoA carboxylase (ACC), most of the SREBP-1-targeted genes (e.g., FAS, GPAT) are modulated at the transcriptional level. Hence, the activity of SREBP-1 appears to be crucial to integrating hormonal regulation upon lipogenesis.
The phosphorylation of transcription factors has a profound effect on their function. Compelling evidence suggests that phosphorylation on the bHLH domain regulates translocation, dimerization, protein-protein interaction, and DNA binding of bHLH factors (15, 45). In light of the potential roles of PKA in attenuating lipogenesis and affecting bHLH-mediated transcription, we investigated the molecular mechanism by which the cAMP-PKA pathway regulates SREBP-1. Although SREBP-1c is the major isoform of SREBP-1 in tissues, SREBP-1a is predominant in most cell lines, including the human hepatoma cell line HepG2 (35). In the current study, we used HepG2 as a model system with which to demonstrate novel PKA phosphorylation sites in the NH2 termini of SREBP-1a and SREBP-1c. PKA phosphorylation at these sites greatly suppressed SREBP-1 transactivation, revealing an inhibitory effect on SREBP-mediated lipogenesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DNA plasmid and transient transfection.
Reporter constructs driven by the low-density lipoprotein receptor (LDLR) and ACC gene promoters were described previously (27, 33). Expression plasmids pCMV-HA-SREBP-1a(N) and pCMV-HA-SREBP-1c(N), driven by cytomegalovirus (CMV) promoter, were constructed by inserting the coding sequence of amino acids (aa) 2460 of SREBP-1a or aa 2436 of SREBP-1c into a pCMV-HA vector on the basis of pSREBP-1a (no. 79810; ATCC) and pCMV-SREBP-1c-436 (no. 99636; ATCC). The respective SREBP-1a and SREBP-1c mutant plasmids (S337A, S337D, S338A, and S338D for SREBP-1a; S314A and S314D for SREBP-1c) were constructed using a site-directed mutagenesis kit (Stratagene, La Jolla, CA). The PCR fragments of wild-type (WT)-SREBP-1a(N), WT-SREBP-1c(N), and various mutants were subcloned into a pGEX-4T1 plasmid to produce vectors encoding the glutathione-S-transferase (GST) fusion proteins. HepG2 cells were transfected at 60% confluence in six-well plates with plasmids expressing SREBP-1a(N), SREBP-1c(N), or their mutants at 300 ng/well, together with various luciferase (Luc) reporters (400 ng/well) and CMV-
-galactosidase (CMV-
-gal; 100 ng/well) using Lipofectamine reagent (Invitrogen, La Jolla, CA). Twenty-four hours after transfection, the cells were treated with various reagents for another 10 h. The cells were then lysed for Luc and
-gal activity assays.
In vitro kinase activity assay.
All GST fusion proteins were produced in a transformed BL21 Escherichia coli strain. Five micrograms of GST fusion proteins were mixed with 10 µg of HepG2 cell lysates in kinase buffer containing 50 mM Tris·HCl, pH 7.5, 10 mM MgCl2, 2 µM cAMP, 5 µM ATP, and 10 mCi/ml [
-32P]ATP in the presence or absence of PKI (5 U) in a final volume of 25 µl to initiate kinase reactions at 30°C. After 20 min, reactions were terminated by adding stop solution (0.1 M ATP and 0.1 M EDTA, pH 8.0). The radiolabeled proteins were separated by 10% SDS-PAGE and visualized using autoradiography. In separate sets of experiments, 5 U of purified PKA instead of cell lysates were added to the reaction mixture as the enzyme source.
Immunoprecipitation and Western blot analysis. The rabbit anti-phospho-SREBP-1 antibody was raised against a synthetic peptide, E-K-R-Y-R-S-S(PO3)-I-N-D-K-I-I-E, by Covance Research Products (Denver, PA). The phosphorylated Ser corresponded to Ser338 of human SREBP-1a or Ser314 of human SREBP-1c. The raised antibody was passed through an affinity column conjugated with unphosphorylated peptide and then affinity purified on a column containing the phosphorylated peptide. In vitro phosphorylated GST-SREBP-1a(N), phosphorylated GST-SREBP-1c(N), or HepG2 cell lysates were incubated with a buffer containing anti-phospho-SREBP-1, 20 mM Tris·HCl, pH 7.5, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 0.1% Nonidet P (NP)-40, 1 mM EDTA, 1 mM PMSF, 25 µg/ml ALLN, and protease inhibitor cocktail (Roche, Indianapolis, IN). After incubation at 4°C for 3 h, protein A Sepharose 4B (Zymed Laboratories, San Francisco, CA) was added to the immunoprecipitates and incubated for 1 h. The Sepharose beads were then washed extensively three times before being subjected to Western blot analysis. The anti-phospho-SREBP-1 immunoprecipitates, cytosol, or nuclear extracts from HepG2 cells were separated by performing 10% SDS-PAGE. The blots were incubated first with a blocking buffer (PBS containing 0.05% Tween 20 and 5.5% nonfat milk), followed by blocking buffer containing various primary antibodies (1:600 dilution; vol/vol). The bound antibodies were detected using horseradish peroxidase-conjugated secondary antibodies (1:4,000 dilution; vol/vol) in blocking buffer and visualized using ECL.
GST pull-down assay. Recombinant GST, GST-SREBP-1a(N), and GST-SREBP-1a(N)-S338D were immobilized and purified on glutathione-Sepharose 4B beads. Nuclear extracts (150 µg) isolated from HEK-293 cells transfected with plasmids encoding HA-SREBP-1a(N) or its mutants were incubated with the beads (10 µg protein) at 4°C for 2 h in a buffer containing 20 mM Tris·HCl, pH 7.4, 0.5% NP-40, 1 mM EDTA, and 200 mM NaCl. The beads were then washed three times and boiled in the sample buffer. The pull-down proteins were analyzed using SDS-PAGE and immunoblot analysis.
EMSA and chromatin immunoprecipitation assay. Nuclear extracts prepared using standard protocols were incubated with the 32P-labeled sterol-regulatory element (SRE) oligonucleotide (GCGATCAAAATCACCCCACTGCAC) in a binding buffer containing 10 mM HEPES, pH 7.9, 10% glycerol, 1 mM DTT, 1 mM EDTA, 50 mM KCl, 2.5 mM MgCl2, 1 mg/ml nonfat milk, and 1 µg of poly(dI-dC) at room temperature for 20 min. Protein-DNA complexes were separated by 5% PAGE, and the bands were visualized using autoradiography. For EMSA involving recombinant proteins, 2 ng of GST-SREBP-1a(N) were mixed with different amounts of S338D or S338A in EMSA binding buffer at 37°C for 45 min. The 32P-labeled SRE oligonucleotide was then added, and the solution was incubated at room temperature for 20 min before we performed SDS-PAGE.
Chromatin immunoprecipitation (ChIP) assays were performed as described by the manufacturer (Upstate Biotechnology, Lake Placid, NY) with minor modifications. In brief, HepG2 cells cultured in Complete medium were stimulated with forskolin (40 µM) for the time indicated and then fixed by addition of formaldehyde (final concentration, 1%) for 15 min at room temperature. Chromatin solutions were sonicated, diluted, and incubated with 4 µg of anti-SREBP-1 MAb 2A4, anti-HA, or mouse IgG antibody at 4°C. Immunocomplexes were collected with salmon sperm DNA/protein A agarose. Immunoprecipitates were pelleted by centrifugation, and 1% of the supernatant was used as an input control. After being washed, chromatin DNA was eluted, purified, and subjected to PCR analysis. The human SCD gene promoter containing SRE was amplified using the following primer set: 5'-TGAGAAGGAGAAACAGAGGGGAGGGGGAGC-3' and 5'-GCGCCGGGGATGCTGCCGACACCGACACCA-3'. Primer sets for the FAS gene promoter were 5'-GGCGGCCACGCCACATGGGCTGACAGC-3' and 5'-CCCCGGCGCTCCTCAGTCCCAGCCCCA-3'. The primers used for the ATP-citrate lyase (ACL) gene promoter are available upon request. PCR analysis was performed using the following thermal cycles: 95°C for 5 min, 28 times (95°C for 1 min, 68°C for 1 min, and 72°C for 1 min), and 72°C for 10 min. In some PCR experiments, cosolvents such as glycerol and DMSO were used. PCR products were resolved on a 2% agarose gel and visualized using ethidium bromide staining.
Adenovirus preparation, HepG2 infection, and Oil Red O staining. Recombinant adenoviruses expressing the SREBP-1c(N)-WT and its S314A and S314D mutants were created using the Adeno-X Tet-Off system (Clontech, Palo Alto, CA). Briefly, cDNA encoding aa 2436 of SREBP-1c tagged with HA was inserted into the SacII/XbaI restriction enzyme sites of the pTRE-Shuttle2 shuttle vector. The I-CeuI/PI-SceI-digested shuttle vector was then ligated into Adeno-X viral DNA. The PacI-digested viral DNA was transfected into HEK-293 cells for virus amplification. HepG2 cells cultured in collagen-coated plates were incubated with various adenoviruses at 10 multiplicities of infection for 4 h. The medium was then replaced with fresh medium containing 10% FBS for 48 h. The infected cells were fixed with 4% paraformaldehyde and stained with Oil Red O for lipid staining. In some experiments, stained dye was extracted by isopropanol, which was quantified at 510 nm using a spectrophotometer.
| RESULTS |
|---|
|
|
|---|
|
Ser338 of SREBP-1a and Ser314 of SREBP-1c are PKA phosphorylation sites. Because cAMP and PKA downregulated the CMV-driven SREBP-1a(N), we hypothesized that this downregulation occurs through PKA phosphorylation of SREBP-1a. To identify the putative PKA phosphorylation site in SREBP-1a, we searched the GenBank database and aligned the protein sequences of SREBPs from different species (Fig. 2). A short motif distinct from other common bHLH transcription factors was found within the bHLH DNA binding domain of all SREBP-1 and SREBP-2 subtypes. This short motif, for example, aa residues 334339 (R-Y-R-S-S-I) of human SREBP-1a, encodes two putative PKA sites, namely, Ser337 and Ser338 (23, 30). We then performed kinase activity assays using the GST-SREBP-1a(N)-WT fusion protein and its mutant to investigate whether Ser337 and/or Ser338 of SREBP-1a could be phosphorylated by PKA. With the addition of cAMP, cell lysates isolated from HepG2 cells caused the phosphorylation of the fusion protein (Fig. 3A). GST-SREBP-1a(N)-WT was also phosphorylated by purified PKA-C. This phosphorylation was blocked by PKI, a PKA-specific inhibitor (Fig. 3B). GST-SREBP-1a(N) mutants in which Ser337 was replaced by either Ala or Asp (i.e., S337A or S337D) were phosphorylated by PKA-C, as was the WT (Fig. 3B). In contrast, GST, GST-SREBP-1a(N)-S338A, and GST-SREBP-1a(N)-S338D were not phosphorylated. These results suggest that Ser338, but not Ser337, is a PKA-specific phosphorylation site.
|
|
Phosphorylated SREBP-1 decreases transactivation and cannot form a homodimer. We created expression plasmids encoding a mutant SREBP-1a(N) with Ala or Asp replacing Ser337 or Ser338 that mimicked the respective dephosphorylated and phosphorylated forms. The results of transient transfection assays showed that S337A and S337D have induction effects similar to those of their parental WT forms on SRE-Luc, LDLR-Luc, and ACC-Luc (Fig. 4A). However, the induction of these SRE-driven constructs by S338A was significantly higher than that of WT and ameliorated the inhibitory effect of forskolin (Fig. 4A). Furthermore, the Asp mutation of Ser338 (i.e., S338D) abolished the induction of these reporter systems. These results suggest that the phosphorylation and dephosphorylation of Ser338 are linked functionally to SREBP-1a(N)-mediated transcription. Mutations of S314 of SREBP-1c with either Ala or Asp (i.e., S314A and S314D) resulted in a comparable increase or decrease of transactivation on 4xSRE-Luc (Fig. 4B). To further confirm that phosphorylation of SREBP-1 would not affect its nuclear translocation, we compared the distribution of the expressed SREBP-1a(N)-WT, S338A, and S338D in the cytosol with that in the nucleus in HEK-293 cells, because this cell line can achieve higher ectopic expression to override endogenous SREBP. As shown in Fig. 4C, the levels of SREBP-1a(N) in the nucleus were not affected by the replacement of Ser338 with either Ala or Asp, indicating that SREBP-1 nuclear translocation was not changed by PKA phosphorylation. Similar results were obtained in experiments involving HepG2 cells (data not shown).
|
|
The association of S338D with S338A suggests that phosphorylated SREBP-1a(N) forms a heterodimer with the dephosphorylated counterpart. Thus we further examined whether S338D can function as an interfering mutant to attenuate SREBP-1a-mediated transcription. As shown in Fig. 5C, the attenuation of SREBP-1a(N)-induced Luc activity by cotransfected S338D was dose dependent. Given the interfering effect of S338D, we studied the binding of various SREBP-1a(N) heterodimers to SRE. As shown in Fig. 5D, the binding of the WT-S338D heterodimer to SRE was significantly weaker than that of WT-S338A, which suggests that the attenuated transactivation was a result of hindered DNA binding by phosphorylated SREBP-1a(N). The decreased SRE binding of S338D in cells (Fig. 5B) was similar to that of the PKA-phosphorylated SREBP-1a(N) in vitro (Fig. 5E) and in HepG2 cells treated with forskolin (Fig. 5F). Mutation of the Ser338 phosphorylation site to Ala seemed to prevent the suppression caused by PKA in vitro (Fig. 5E).
By performing ChIP assays, we investigated further the binding of SREBP-1 to the SCD gene promoter that contains well-conserved SRE in intact cells. As shown in Fig. 6A, the binding of SREBP-1 to the SCD gene promoter was decreased in forskolin-treated HepG2 cells. The reduced SREBP-1-DNA interactions also were found in FAS and ACL promoters (data not shown). As shown in Fig. 6B, forskolin attenuated the binding of ectopically expressed SREBP-1c(N)-WT, but not S314A, to the FAS gene promoter in HEK-293 cells (Fig. 6B, lane 4 vs. lane 3 and lane 6 vs. lane 5). However, S314D demonstrated little if any DNA binding activity (Fig. 6B, lanes 7 and 8).
|
-gal as shown by increased Oil Red O staining in Fig. 7A. Cells infected with the same titer of Ad-SREBP-1c(N)-S314A showed greatly increased lipid deposits. In contrast, Ad-SREBP-1c(N)-S314D-infected HepG2 cells revealed little lipid accumulation. Quantification of the stained dye revealed that forskolin treatment for as short as 10 h could significantly affect lipid accumulation resulting from overexpression of SREBP-1c(N)-WT (Fig. 7B). The same treatment had little effect on either the S314A or S314D mutant. Hence, the results shown in Fig. 7 suggest that the lipogenic effect of SREBP-1c is greatly affected by the phosphorylation and dephosphorylation of Ser314.
|
| DISCUSSION |
|---|
|
|
|---|
Our results show that Ser338 of SREBP-1a and Ser314 of SREBP-1c are phosphorylated in response to cAMP and PKA in vitro. Because both proteins have identical flanking sequences and their target genes are downregulated by cAMP in the same manner, it is probable that both SREBP-1a and -1c could be phosphorylated by PKA in vivo. If the ratio of SREBP-1a to SREBP-1c in human and rodent livers is
1 to 9 (35) in further experiments involving rodents subjected to conditions that increase the cAMP level (e.g., fasting or "fight-or-flight" state), the physiological role of SREBP-1c phosphorylation will be validated. This notion is supported by the results shown in Fig. 7, which demonstrates that overexpressing SREBP-1c(N)-S314D did not enhance lipogenesis in HepG2 cells.
Results reported by other investigators have shown that cAMP, glucagon, and fasting negatively regulate SREBP-1c and SREBP-2 but not SREBP-1a mRNA (17, 37). In SCAP- or S1P-null mice, the level of nuclear SREBPs declined because of the interruption of ER-to-Golgi transportation and proteolytic cleavage (29). The level of SREBP-1c and SREBP-2 mRNA in these animals was reduced further in response to the decline in nuclear SREBPs, owing to the decreased autoregulation of SREBPs on SREs present in the enhancer and promoter regions of the SREBP-1c and SREBP-2 genes (29). Recent publications also showed that SRE, in concert with liver X receptor response element in the SREBP-1c promoter, is essential for SREBP-1c transcription (7, 13). However, other researchers have suggested that SRE may play a permissive role in SREBP-1c expression (11). These previous studies that revealed the importance of SRE in regulating the SREBP-1 mRNA, together with our present study, suggest that at least two mechanisms are involved in the negative regulation of SREBPs. First, the acute phosphorylation of SREBPs in both the cytosol and the nucleus decreases their dimerization and DNA binding. Second, the attenuated activity of SREBPs confers the decreased level of SREBP-1c and SREBP-2 mRNA through SRE in the promoters of SREBP-1c and SREBP-2 but not of SREBP-1a.
In normal animals, the levels of hepatic SREBP and the expression of their target gene are decreased during fasting, presumably as a result of elevated concentrations of glucagon and cAMP (17, 37). However, in the livers of transgenic (Tg) mice carrying nuclear SREBP-1c (Tg-SREBP-1cN), fasting did not cause the downregulation of SREBP-targeted mRNA (20). This previous finding seems to contradict the regulation of mature SREBP-1 via the cAMP-PKA pathway. One explanation for this contradiction is the use of the phosphoenolpyruvate carboxykinase (PEPCK) gene promoter in creating SREBP-1c-transgenic animals in the previous study (20). PEPCK, a key gluconeogenic enzyme in the liver, is strongly induced when animals are in a fasted state (44). Therefore, Tg-SREBP-1c under the control of PEPCK gene promoter would be activated in the Tg-SREBP-1cN mice after a long period of fasting. Instead of being downregulated, the expression of Tg-SREBP-1c and its target genes were elevated after starvation, as shown by Horton et al. (20). Such increases could override the inhibitory effect of PKA observed in our present study. Future studies with the use of Tg animals harboring the mutation of the SREBP-1 phosphorylation site may provide insights into the regulation of SREBP-1 in vivo.
Several publications (4, 9, 10, 41) have demonstrated that SREBP-1 not only functions as a crucial activator of lipogenic enzymes but also can transrepress the expression of genes involved in gluconeogenesis as well. We propose that hepatic glucose production is inhibited by insulin, at least in part, through the activation of SREBP-1c. To the contrary, it has been established that the cAMP-PKA pathway promotes gluconeogenesis by inducing the phosphorylation of cAMP response element-binding protein and its target genes. Because the experiments we have performed in the present study suggest that PKA may phosphorylate SREBP-1c and ameliorate its DNA binding, it is conceivable that PKA could eliminate the blocking effect of SREBP-1c on gluconeogenic enzymes. This may serve as an alternative mechanism by which PKA activates gluconeogenesis.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Allred JB and Roehrig KL. Inhibition of hepatic lipogenesis by cyclic-3',5'-nucleotide monophosphates. Biochem Biophys Res Commun 46: 11351139, 1972.[CrossRef][Web of Science][Medline]
3. Bachman ES, Dhillon H, Zhang CY, Cinti S, Bianco AC, Kobilka BK, and Lowell BB.
AR signaling required for diet-induced thermogenesis and obesity resistance. Science 297: 843845, 2002.
4. Bécard D, Hainault I, Azzout-Marniche D, Bertry-Coussot L, Ferré P, and Foufelle F. Adenovirus-mediated overexpression of sterol regulatory element binding protein-1c mimics insulin effects on hepatic gene expression and glucose homeostasis in diabetic mice. Diabetes 50: 24252430, 2001.
5. Brown MS and Goldstein JL. The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 89: 331340, 1997.[CrossRef][Web of Science][Medline]
6. Brown MS and Goldstein JL. A proteolytic pathway that controls the cholesterol content of membranes, cells, and blood. Proc Natl Acad Sci USA 96: 1104111048, 1999.
7. Cagen LM, Deng X, Wilcox HG, Park EA, Raghow R, and Elam MB. Insulin activates the rat sterol-regulatory-element-binding protein 1c (SREBP-1c) promoter through the combinatorial actions of SREBP, LXR, Sp-1 and NF-Y cis-acting elements. Biochem J 385: 207216, 2005.[CrossRef][Web of Science][Medline]
8. Capuzzi DM, Rothman V, and Margolis S. The regulation of lipogenesis by cyclic nucleotides in intact hepatocytes prepared by a simplified technique. J Biol Chem 249: 12861294, 1974.
9. Chakravarty K, Leahy P, Bécard D, Hakimi P, Foretz M, Ferré P, Foufelle F, and Hanson RW. Sterol regulatory element-binding protein-1c mimics the negative effect of insulin on phosphoenolpyruvate carboxykinase (GTP) gene transcription. J Biol Chem 276: 3481634823, 2001.
10. Chakravarty K, Wu SY, Chiang CM, Samols D, and Hanson RW. SREBP-1c and Sp1 interact to regulate transcription of the gene for phosphoenolpyruvate carboxykinase (GTP) in the liver. J Biol Chem 279: 1538515395, 2004.
11. Chen G, Liang G, Ou J, Goldstein JL, and Brown MS. Central role for liver X receptor in insulin-mediated activation of Srebp-1c transcription and stimulation of fatty acid synthesis in liver. Proc Natl Acad Sci USA 101: 1124511250, 2004.
12. Cummings DE, Brandon EP, Planas JV, Motamed K, Idzerda RL, and McKnight GS. Genetically lean mice result from targeted disruption of the RII
subunit of protein kinase A. Nature 382: 622626, 1996.[CrossRef][Medline]
13. Deng X, Cagen LM, Wilcox HG, Park EA, Raghow R, and Elam MB. Regulation of the rat SREBP-1c promoter in primary rat hepatocytes. Biochem Biophys Res Commun 290: 256262, 2002.[CrossRef][Web of Science][Medline]
14. Dignam JD, Lebovitz RM, and Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 14751489, 1983.
15. Firulli BA, Howard MJ, McDaid JR, McIlreavey L, Dionne KM, Centonze VE, Cserjesi P, Virshup DM, and Firulli AB. PKA, PKC, and the protein phosphatase 2A influence HAND factor function: a mechanism for tissue-specific transcriptional regulation. Mol Cell 12: 12251237, 2003.[CrossRef][Web of Science][Medline]
16. Foretz M, Guichard C, Ferré P, and Foufelle F. Sterol regulatory element binding protein-1c is a major mediator of insulin action on the hepatic expression of glucokinase and lipogenesis-related genes. Proc Natl Acad Sci USA 96: 1273712742, 1999.
17. Foretz M, Pacot C, Dugail I, Lemarchand P, Guichard C, le Lièpvre X, Berthelier-Lubrano C, Spiegelman B, Kim JB, Ferré P, and Foufelle F. ADD1/SREBP-1c is required in the activation of hepatic lipogenic gene expression by glucose. Mol Cell Biol 19: 37603768, 1999.
18. Foufelle F and Ferré P. New perspectives in the regulation of hepatic glycolytic and lipogenic genes by insulin and glucose: a role for the transcription factor sterol regulatory element binding protein-1c. Biochem J 366: 377391, 2002.[CrossRef][Web of Science][Medline]
19. Girard J, Perdereau D, Foufelle F, Prip-Buus C, and Ferré P. Regulation of lipogenic enzyme gene expression by nutrients and hormones. FASEB J 8: 3642, 1994.[Abstract]
20. Horton JD, Bashmakov Y, Shimomura I, and Shimano H. Regulation of sterol regulatory element binding proteins in livers of fasted and refed mice. Proc Natl Acad Sci USA 95: 59875992, 1998.
21. Howe AK and Juliano RL. Regulation of anchorage-dependent signal transduction by protein kinase A and p21-activated kinase. Nat Cell Biol 2: 593600, 2000.[CrossRef][Web of Science][Medline]
22. Kim JB, Sarraf P, Wright M, Yao KM, Mueller E, Solanes G, Lowell BB, and Spiegelman BM. Nutritional and insulin regulation of fatty acid synthetase and leptin gene expression through ADD1/SREBP1. J Clin Invest 101: 19, 1998.[Web of Science][Medline]
23. Kreegipuu A, Blom N, and Brunak S. PhosphoBase, a database of phosphorylation sites: release 2.0. Nucleic Acids Res 27: 237239, 1999.
24. Larsen PR, Kronenberg HM, Melmed S, and Polonsky KS. Section VIII: Disorders of carbohydrate and lipid metabolism. Williams Textbook of Endocrinology (10th ed.), edited by Larsen PR, Kronenberg HM, Melmed S, and Polonsky KS. Philadelphia, PA: Saunders, 2003, chapt. 32, p. 15871589.
25. Lefevre P, Diot C, Legrand P, and Douaire M. Hormonal regulation of stearoyl coenzyme-A desaturase 1 activity and gene expression in primary cultures of chicken hepatocytes. Arch Biochem Biophys 368: 329337, 1999.[CrossRef][Web of Science][Medline]
26. Lin T, Zeng L, Liu Y, DeFea K, Schwartz MA, Chien S, and Shyy JY. Rho-ROCK-LIMK-cofilin pathway regulates shear stress activation of sterol regulatory element binding proteins. Circ Res 92: 12961304, 2003.
27. Lopez JM, Bennett MK, Sanchez HB, Rosenfeld JM, and Osborne TE. Sterol regulation of acetyl coenzyme A carboxylase: a mechanism for coordinate control of cellular lipid. Proc Natl Acad Sci USA 93: 10491053, 1996.
28. Mason RJ, Pan T, Edeen KE, Nielsen LD, Zhang F, Longphre M, Eckart MR, and Neben S. Keratinocyte growth factor and the transcription factors C/EBP
, C/EBP
, and SREBP-1c regulate fatty acid synthesis in alveolar type II cells. J Clin Invest 112: 244255, 2003.[CrossRef][Web of Science][Medline]
29. Matsuda M, Korn BS, Hammer RE, Moon YA, Komuro R, Horton JD, Goldstein JL, Brown MS, and Shimomura I. SREBP cleavage-activating protein (SCAP) is required for increased lipid synthesis in liver induced by cholesterol deprivation and insulin elevation. Genes Dev 15: 12061216, 2001.
30. Obenauer JC, Cantley LC, and Yaffe MB. Scansite 2.0: Proteome-wide prediction of cell signaling interactions using short sequence motifs. Nucleic Acids Res 31: 36353641, 2003.
31. Paulauskis JD and Sul HS. Hormonal regulation of mouse fatty acid synthase gene transcription in liver. J Biol Chem 264: 574577, 1989.
32. Roth G, Kotzka J, Kremer L, Lehr S, Lohaus C, Meyer HE, Krone W, and Müller-Wieland D. MAP kinases Erk1/2 phosphorylate sterol regulatory element-binding protein (SREBP)-1a at serine 117 in vitro. J Biol Chem 275: 3330233307, 2000.
33. Sanchez HB, Yieh L, and Osborne TF. Cooperation by sterol regulatory element-binding protein and Sp1 in sterol regulation of low density lipoprotein receptor gene. J Biol Chem 270: 11611169, 1995.
34. Schreyer SA, Cummings DE, McKnight GS, and LeBoeuf RC. Mutation of the RII
subunit of protein kinase A prevents diet-induced insulin resistance and dyslipidemia in mice. Diabetes 50: 25552562, 2001.
35. Shimomura I, Shimano H, Horton JD, Goldstein JL, and Brown MS. Differential expression of exons 1a and 1c in mRNAs for sterol regulatory element binding protein-1 in human and mouse organs and cultured cells. J Clin Invest 99: 838845, 1997.[Web of Science][Medline]
36. Shimomura I, Bashmakov Y, Ikemoto S, Horton JD, Brown MS, and Goldstein JL. Insulin selectively increases SREBP-1c mRNA in the livers of rats with streptozotocin-induced diabetes. Proc Natl Acad Sci USA 96: 1365613661, 1999.
37. Shimomura I, Matsuda M, Hammer RE, Bashmakov Y, Brown MS, and Goldstein JL. Decreased IRS-2 and increased SREBP-1c lead to mixed insulin resistance and sensitivity in livers of lipodystrophic and ob/ob mice. Mol Cell 6: 7786, 2000.[CrossRef][Web of Science][Medline]
38. Sul HS and Wang D. Nutritional and hormonal regulation of enzymes in fat synthesis: studies of fatty acid synthase and mitochondrial glycerol-3-phosphate acyltransferase gene transcription. Annu Rev Nutr 18: 331351, 1998.[CrossRef][Web of Science][Medline]
39. Sundqvist A, Bengoechea-Alonso MT, Ye X, Lukiyanchuk V, Jin J, Harper JW, and Ericsson J. Control of lipid metabolism by phosphorylation-dependent degradation of the SREBP family of transcription factors by SCFFbw7. Cell Metabolism 1: 379391, 2005.
40. Tarlow DM, Watkins PA, Reed RE, Miller RS, Zwergel EE, and Lane MD. Lipogenesis and the synthesis and secretion of very low density lipoprotein by avian liver cells in nonproliferating monolayer culture: hormonal effects. J Cell Biol 73: 332353, 1977.
41. Yamamoto T, Shimano H, Nakagawa Y, Ide T, Yahagi N, Matsuzaka T, Nakakuki M, Takahashi A, Suzuki H, Sone H, Toyoshima H, Sato R, and Yamada N. SREBP-1 interacts with hepatocyte nuclear factor-4
and interferes with PGC-1 recruitment to suppress hepatic gluconeogenic genes. J Biol Chem 279: 1202712035, 2004.
42. Yang T, Espenshade PJ, Wright ME, Yabe D, Gong Y, Aebersold R, Goldstein JL, and Brown MS. Crucial step in cholesterol homeostasis: sterols promote binding of SCAP to Insig-1, a membrane protein that facilitates retention of SREBPs in ER. Cell 110: 489500, 2002.[CrossRef][Web of Science][Medline]
43. Yellaturu CR, Deng X, Cagen LM, Wilcox HG, Park EA, Raghow R, and Elam MB. Posttranslational processing of SREBP-1 in rat hepatocytes is regulated by insulin and cAMP. Biochem Biophys Res Commun 332: 174180, 2005.[CrossRef][Web of Science][Medline]
44. Yoon JC, Puigserver P, Chen G, Donovan J, Wu Z, Rhee J, Adelmant G, Stafford J, Kahn CR, Granner DK, Newgard CB, and Spiegelman BM. Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature 413: 131138, 2001.[CrossRef][Medline]
45. Zhou J and Olson EN. Dimerization through the helix-loop-helix motif enhances phosphorylation of the transcription activation domains of myogenin. Mol Cell Biol 14: 62326243, 1994.
This article has been cited by other articles:
![]() |
J.-K. Oem, C. Jackel-Cram, Y.-P. Li, Y. Zhou, J. Zhong, H. Shimano, L. A. Babiuk, and Q. Liu Activation of sterol regulatory element-binding protein 1c and fatty acid synthase transcription by hepatitis C virus non-structural protein 2 J. Gen. Virol., May 1, 2008; 89(5): 1225 - 1230. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |