|
|
||||||||
GROWTH, DIFFERENTIATION, AND APOPTOSIS
1Musculoskeletal Disease Center, Jerry L. Pettis Veterans Administration Medical Center, Loma Linda; and 2Department of Medicine, 3Department of Biochemistry, and 4Department of Physiology, Loma Linda University, Loma Linda, California
Submitted 19 November 2004 ; accepted in final form 26 October 2005
| ABSTRACT |
|---|
|
|
|---|
alternate splicing; yeast two-hybrid screen; small interfering RNA
IGFBP5 stimulates both osteoblast cell proliferation and activity in vitro (4, 4a, 18, 25) and recent findings demonstrate that IGFBP5 itself is a growth factor with cellular effects that are IGF independent (22). In support of this, it has been shown that IGFBP5 treatment increased bone formation parameters in vitro and in vivo in osteoblasts derived from IGF-I knockout mice (18). The IGF-independent effects of IGFBP5 have also been confirmed using transgenic mouse models overexpressing IGFBP5 (26a). Evidence suggests that IGFBP5 binds to a putative receptor on the osteoblast cell surface and stimulates downstream signaling pathways (3, 21, 28). In addition, IGFBP5 contains a nuclear localization sequence that mediates the transport of IGFBP5 to the cell nucleus (28, 29) where it may affect gene transcription. IGFBP5 has also demonstrated IGF-receptor-independent effects in normal human intestinal smooth muscle cells via the activation of the P38 MAP kinase and Erk1/2, leading to a stimulation of cell proliferation and secretion of IGF-I (13).
To understand the molecular mechanism through which IGFBP5 regulates bone formation via an IGF-independent pathway, it is essential to identify the cellular proteins that interact with IGFBP5. These proteins could be IGFBP5 receptors, nuclear proteins, as well as signaling proteins that mediate IGFBP5-dependent actions. We therefore utilized the yeast two-hybrid assay (8) screen to identify those proteins that bind to IGFBP5 using human IGFBP5 as bait for screening a human osteosarcoma U2 cDNA library. We (2) recently reported on IGFBP5 interaction with the four and a half LIM domain protein 2 (FHL2) and demonstrated that FHL2 binds IGFBP5, but not IGFBP-4 or IGFBP-6. In this article, we report on the identification of a novel IGBP5 interacting protein (IGFBP5-IP) with the use of the yeast two-hybrid assay. We show that IGFBP5-IP is expressed in various bone cell lines and it shared some sequence identity with a RIKEN cDNA clone (Genebank accession no. NM_172788.1). To define the function of this novel IGFBP5-IP in vitro, we used the small interfering RNA (siRNA) technique (6, 10, 15, 32) to study the consequence of blockage of IGFBP5-IP expression on cell proliferation. We found that reduction in IGFBP5-IP expression reduced cell growth in multiple osteoblast cell lines, demonstrating that IGFBP5-IP could function to promote cell proliferation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Osteoblast cell culture. Normal human osteoblasts were isolated as described (2, 16) from calvaria and rib bone specimens obtained from the Cooperative Human Tissue Network, which is supported by the National Cancer Institute. Cell culture was carried out as previously described (2, 16).
RNA isolation and Northern blot analysis. Total RNA from human osteosarcoma U2 cell lines was isolated using the TriZOL reagent (Invitrogen, Carlsbad, CA) or using the RNAeasy kit (Qiagen, Valancia, CA). Northern blot analysis was carried out as previously described (2).
Expression analysis of IGFBP5-IP gene in bone cells. To determine the expression of the clone A gene in different bone cell lines, the following clone A-specific primers were used: forward, 5'-GCGCACTCAGACTTCTCCAT-3', and reverse, 5'-TGCTAGAGCTCTGCTAC-3'. One microgram of total RNA was used for reverse transcription reaction using the Omniscript kit (Qiagen). One microliter of the RT reaction was used for PCR using the HotStart master mix (Qiagen). The PCR reactions were run at following conditions: 95°C for 15 min, 95°C for 1 min, 60°C for 30 s, and 72°C for 30 s for 35 cycles.
Construction of IGFBP5-IP silencer plasmid. On the basis of the coding sequence alignment of IGFBP5-IP with the RIKEN cDNA clone sequence (Genebank accession no. NM_172788.1), we designed siRNA duplexes specific to IGFBP5-IP and the RIKEN cDNA clone with the use of Qiagen software (available at www.Qiagen.com). We designed a siRNA-1323 duplex with a perfect match to both IGFBP5-IP and the RIKEN cDNA clone and designed a siRNA-207 duplex that is specific to RIKEN cDNA clone. The sequence of the siRNA-1323 insert is the following: 5'-TCGAGCCAGATGACAAGAAAAACgagtactgGTTTTTCTTGTCATCTGGCTTTTT-3', 3'-CG-GTCTACTGTTCTTTTTGctcatgacCAAAAAGAACAGTAGACCGAAAAAGATC-5'. The sequence for siRNA-207 insert is the following: 5'-TCGACTATGATGCCCTCTTGTCCgagtactgGGACAAGAGGGCATCATAGTTTTT-3' and 3'-GATACTACGGGAGAACAGGctcatgacCCTGTTCTCCCGTAGTATCAAAAAGATC-5'.
The sequence of random siRNA insert is 5'-TCGAGTACAACT-TCGATTCGACGttcaagagACGTCGAARCGAAGTTGTACAAAAA-3' and 3'-CTAGTTTTTGTACAACTTCGATTCGACGtctcttgaaCGTCGAATCGAAGTTGTAC-5'. The primers were annealed and cloned into the pSuppressorNeo vector, as recommended by the supplier (Imgenex, San Diego, CA). The purified vectors containing inserts were identified by digestion with ScaI and DNA sequencing.
Treatment of cells with siRNA molecules. Cells were seeded at 5,000 per well in 96-well plates or 35,000 cells per well in 6-well plates in DMEM, supplemented with 10% calf serum 24 h before treatment with siRNA vectors (siRNA-207 and siRNA-1323) and vector alone. MC3T3-E1 (mouse osteoblast), MG63, HSaOs, and LSaOS cells (human osteosarcoma) were transfected with 1 µg of siRNA vector or vector alone with the use of Effectine transfection reagent, as recommended by the supplier (Qiagen). The transfection medium was replaced with a fresh DMEM containing 10% calf serum medium and cells were incubated for additional 48 h before performing the AlamarBlue Assay and RNA extractions.
AlamarBlue assay. The biological effect on cells treated with siRNA molecules was measured by the AlamarBlue assay. AlamarBlue is reduced by reactions innate to cellular metabolism and therefore provides an indirect measure of viable cell number (AccuMed International, Westlake, OH). Seventy-two hours after transfection, cells treated in 96-well plates were rinsed with PBS, and the medium was replaced with 100 µl of 1x AlamarBlue diluted in phenol red-free DMEM. Direct light was avoided while the dye was used, and the plates were incubated for 4 h at 37°C. Fluorescence was determined with the use of a fluorescent plate reader (Fluorolite 1000; Dynex Technologies, Chantilly, VA).
3H-Thymidine incorporation.
MC3T3-E1 mouse osteoblasts and LSaOS human osteosarcoma cells were plated in
MEM containing 1% calf serum at a density of 2,000 cells per well in 96-well culture plate. Twenty-four hours later, cells were treated with siRNA 1323, siRNA 207, or random siRNA control, as described above. Fresh serum-free DMEM containing 0.1% BSA was added 24 h later and cultures were treated with or without 100 ng/ml IGFBP5. Eighteen hours later, 0.25 µci 3H-thymidine was added and incubated for 6 h before termination. The amount of 3H-thymidine incorporated into DNA was evaluated as previously described (22).
RNA isolation and RT-PCR analysis. MC3T3-E1 cells were transfected with 1 µg/ml of siRNA-207 vector, siRNA1323 vector, and vector alone using Effectine (Qiagen). Seventy-two hours posttransfection, cells were collected and total RNA was extracted using a RNA Microprep kit (Stratagene, La Jolla, CA). Five hundred nanograms of total RNA were used to prepare cDNA with Omniscript kit (Qiagen). Five microliters of the RT reaction were used for PCR using the HotStart master mix (Qiagen). The PCR reactions were run at the following conditions: 95°C for 15 min, 95°C for 1 min, 60°C for 30 s, and 72°C for 30 s for 35 cycles. We used three sets of primers: the primer set CAF2/CAR285 (gives 390-bp PCR product: this sets of primers used to detect IGFBP5-IP expression in human bone cells), the primers set CAF2/CAR1 (gives a product of 610 bp: this set of primers used to detect IGFBP5-IP expression in MC3T3 cells), and the primer set RIKEN-pf596F/pR618 (gives 350-bp product: this set of primers is used to detect the RIKEN expression in MC3T3 cells). The sequences of the primer sets used were the following: pCAF2:5'GCGCACTCAGACTTCTCCAT3'; pCAR285: 5'AGAGGTGGCTCGGCAGTGAA 3'; pCAR1: 5' GGCATTGAACAGAGGCAGAA 3; RIKEN-pF596F: 5' TCGATCAACGTGTACCTGGCTCTC3'; and RIKEN-pR618: 5' GGTGCTGCATGTGATCCT 3'.
Overexpression of pFlag-IGFBP5-IP and murine leukemia virus-IGFBP5 constructs in U2 cells and coimmunoprecipitation. U2 cells were first transfected with murine leukemia virus-IGFBP5 construct, as previously described (2), and cells were checked for overexpression of IGFBP5 protein using Western blot analysis. U2 cells overexpressing IGFBP5 were subsequently transfected with pFlag-IGFBP5-IP construct using 10 cm tissue culture plates. Forty-eight hours after transfection, the cells were collected and cell lysates were prepared as previously described (2). Coimmunoprecipitation was carried out using Pflag and IGFBP5 antibodies, as previously described (2).
| RESULTS |
|---|
|
|
|---|
50 positive clones during the first screening, out of which approximately one-half of the clones were found to be positive in subsequent reconfirmation experiments. For subsequent characterization of positive clones, we focused on those clones, which grew vigorously in the reconfirmation test. In this study, we identified a 0.8-kb cDNA clone (clone A) (Table 1) that exhibited a strong interaction with IGFBP5 under high-stringency conditions. The clone A cDNA sequence did not completely match with any known sequence, but it showed some sequence identity with a mouse RIKEN cDNA clone sequence (GeneBank Accession no. NM_172788.1). Because clone A cDNA did not match any known gene sequence, we have named it IGFBP5-interacting protein (IGFBP5-IP). The IGFBP5-IP cDNA encodes an open reading frame of 257 amino acids, and it contains a stop codon and a poly A tail at the 3'-end (Fig. 1). The mouse RIKEN cDNA clone showed an 82% sequence homology (1,086/1,316 bp) with a human mRNA for FLJ00204 protein.
|
|
|
|
IGFBP5/IGFBP5-IP interaction determined by coimmunoprecipitation. To further confirm interaction between IGFBP5-IP and IGFBP5 observed in the yeast two-hybrid assay, cell lysates from U2 cells overexpressing IGFBP5 and pFlag-IGFBP5-IP were immunoprecipitated with pFlag antibody and then probed with IGFBP5 antiserum with the use of Western immunoblot analysis (Fig. 4). IGFBP5 was immunoprecipitated by pFlag antibody in the presence of IGFBP5 and pFlag-IGFBP5-IP. The weak IGFBP5 band that was seen in the presence of normal mouse IgG is likely due to nonspecific interactions between IGFBP5 and normal mouse IgG or between IGFBP5 and protein A sepharose beads. The immunoprecipitation data together with the yeast two-hybrid data provide evidence that IGFBP5 and IGFBP5-IP do interact. However, the physiological significance of their interaction in bone cells remains to be determined.
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
The interaction between IGFBP5 and IGFBP5-IP observed in yeast was confirmed by immunoprecipitation studies using U2 cell lysate overexpressing IGFBP5 and pFlag-IGFBP5-IP proteins, and antibodies directed against the pFlag-IGFBP5-IP and IGFBP5. Although the yeast two-hybrid assay and the in vitro coimmunoprecipitation experiments provide evidence that the interaction between IGFBP5 and IGFBP-IP occurs, further studies are needed to prove that these two proteins bind under normal physiological conditions.
IGFBP5 has been shown to be a multifunctional protein that acts through IGF-dependent and IGF-independent mechanisms. In fact, other IGFBPs such as IGFBP-1 and -3 have also been shown to mediate their effects on a variety of cell types in part through IGF-independent mechanism (7, 11, 16, 23, 24, 31). Several IGFBP-3 interacting proteins have also been discovered using the yeast two-hybrid assay (14, 17, 30), and we (2) have previously reported on the identification of FHL2 as a binding partner of IGFBP5. On the basis of our discovery that IGFBP5-IP interacts with IGFBP5, we hypothesized that IGFBP5-IP may mediate, in part, the stimulatory effect of IGFBP5 on osteoblast cell proliferation. Accordingly, we predicted that silencing of IGFBP5-IP expression in IGFBP5 producing cells should decrease proliferation. To test this prediction, we evaluated the consequence of silencing the expression of IGFBP5-IP by using siRNA on proliferation of osteoblast cell lines. Our findings in this study demonstrate that plasmid encoding a siRNA duplex (Si-1323) that is sequence specific to IGFBP5-IP caused a significant (P < 0.05) decrease in both basal and IGFBP5-induced cell proliferation. The relative contribution of IGFBP5-IP in mediating the biological effects of IGFBP5 in other cell types still needs to be determined.
In previous studies, we (1, 2) have found that IGFBP5 interacted with FHL2, a potential transcription modulator and RASSF1C, a potential Ras effector. The significance of why IGFBP5 interacts with multiple signaling molecules can only be speculated on at this time. It has been shown that intermittent administration of IGFBP5 increased bone formation while it sustained transgenic overexpression of IGFBP5 decreased bone formation (25, 26a), suggesting that IGFBP5's effects on bone formation are complex. IGFBP5 also has multitude of effects on osteoblasts influencing cell proliferation, differentiation, and apoptosis (4, 18, 22, 25). Although we have not characterized the nature of IGFBP5 interactions with its newly identified intracellular partners at the physiological level, it is tempting to speculate that IGFBP5 interactions with each of these proteins may involve a unique pathway and thus could contribute to a distinct biological effect.
In conclusion, 1) IGFBP5-IP is a novel gene and it is located on mouse chromosome 10; 2) IGFBP5-IP is expressed in human and mouse osteoblasts; and 3) silencing of IGFBP5-IP gene expression decreases cell proliferation. Our finding that inhibition of IGFBP5-IP expression decreased IGFBP5-induced osteoblast cell proliferation is consistent with the possibility that IGFBP5-IP could act as an intracellular mediator of IGFBP5's mitogenic effects. The potential pathway(s) through which IGFBP5-IP might mediate IGFBP5's mitogenic effects will be investigated in future studies in our laboratory.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Amaar YG, Thompson GR, Linkhart TA, Chen ST, Baylink DJ, and Mohan S. Insulin-like growth factor-binding protein 5 (IGFBP-5) interacts with a four and a half LIM protein 2 (FHL2). J Biol Chem 277: 1205312060, 2002.
3. Andress DL. Insulin-like growth factor-binding protein-5 (IGFBP-5) stimulates phosphorylation of the IGFBP-5 receptor. Am J Physiol Endocrinol Metab 274: E744E750, 1998.
4. Andress DL, Loop SM, Zapf J, and Kiefer MC. Carboxy-truncated insulin-like growth factor binding protein-5 stimulates mitogenesis in osteoblast-like cells. Biochem Biophys Res Commun 195: 2530, 1993.[CrossRef][ISI][Medline]
4a. Bauss F, Lang K, Dony C, and Kling G. The complex of recombinant human insulin-like growth factor-I (rhIGF-I) and its binding protein-5 (IGFBP-5) induces local bone formation in murine calvariae and in rat cortical bone after local or systemic administration. Growth Horm IGF Res 11: 19, 2001.[CrossRef][ISI][Medline]
5. Brett D, Pospisil H, Valcarcel J, Reich J, and Bork P. Alternative splicing and genome complexity. Nat Genet 30: 2930, 2002.[CrossRef][ISI][Medline]
6. Elbashir S, Harborth J, Lendeckel W, Yalcin A, Webber K, and Tuschul T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411: 494498, 2001.[CrossRef][Medline]
7. Fanayan S, Firth SM, Butt AJ, and Baxter RC. Growth inhibition by insulin-like growth factor-binding protein-3 in T47D breast cancer cells requires transforming growth factor-
(TGF-
) and the type II TGF-
receptor. J Biol Chem 275: 3914639151, 2000.
8. Fields S and Song O. A novel genetic system to detect protein-protein interactions. Nature 340: 245246, 1989.[CrossRef][Medline]
10. Harborth J, Elbashir SM, Bechert K, Tuschl T, and Weber K. Identification of essential genes in cultured mammalian cells using small interfering RNAs. J Cell Sci 114: 45574565, 2001.
11. Jones JI, Gockerman A, Busby WH, Wright G, and Clemmons DR. Insulin-like growth factor binding protein 1 stimulates cell migration and binds to the
5
1 integrin by means of its Arg-Gly-Asp sequence. Proc Natl Acad Sci USA 90: 1055310557, 1993.
13. Kuemmerle JF and Zhou H. Insulin-like growth factor-binding protein-5 (IGFBP-5) stimulates growth and IGF-I secretion in human intestinal smooth muscle by Ras-dependent activation of p38 MAP kinase and Erk1/2 pathways. J Biol Chem 277: 2056320571, 2002.
14. Lee KW, Liu B, Ma L, Li H, Bang P, Koeffler HP, and Cohen P. Cellular internalization of insulin-like growth factor binding protein-3: distinct endocytic pathways facilitate re-uptake and nuclear localization. J Biol Chem 279: 469476, 2004.
15. Leirdal M and Sioud M. Gene silencing in mammalian cells by preformed small RNA duplexes. Biochem Biophys Res Commun 295: 744748, 2002.[CrossRef][ISI][Medline]
16. Linkhart TA, Linkhart SG, MacCharles DC, Long DL, and Strong DD. Interleukin-6 messenger RNA expression and interleukin-6 protein secretion in cells isolated from normal human bone: regulation by interleukin-1. J Bone Miner Res 6: 12851294, 1991.[ISI][Medline]
17. Liu B, Lee HY, Weinzimer SA, Powell DR, Clifford JL, Kurie JM, and Cohen P. Direct functional interactions between insulin-like growth factor-binding protein-3 and retinoid X receptor-
regulate transcriptional signaling and apoptosis. J Biol Chem 275: 3360733613, 2000.
18. Miyakoshi N, Richman C, Kasukawa Y, Linkhart TA, Baylink DJ, and Mohan S. Evidence that IGF-binding protein-5 functions as a growth factor. J Clin Invest 107: 7381, 2001.[CrossRef][ISI][Medline]
19. Modrek B and Lee C. A genomic view of alternative splicing. Nat Genet 30: 139, 2002.[CrossRef][ISI][Medline]
20. Mohan S and Baylink DJ. Insulin-like growth factor system components and the coupling of bone formation to resorption. Horm Res 45, Suppl 1: 5962, 1996.
21. Mohan S and Baylink DJ. The IGF System, Molecular Biology, Physiology and Clinical Applications, edited by Rosenfeld RG and Roberts CT. Totowa, NJ: Humana, 1999, p. 457496.
22. Mohan S, Nakao Y, Honda Y, Landale E, Leser U, Dony C, Lang K, and Baylink DJ. Studies on the mechanisms by which insulin-like growth factor (IGF) binding protein-4 (IGFBP-4) and IGFBP-5 modulate IGF actions in bone cells. J Biol Chem 270: 2042420431, 1995.
23. Oh Y, Muller HL, Lamson G, and Rosenfeld RG. Insulin-like growth factor (IGF)-independent action of IGF-binding protein-3 in Hs578T human breast cancer cells. J Biol Chem 268: 1496414971, 1993.
24. Rajah R, Valentinis B, and Cohen P. Insulin-like growth factor (IGF)-binding protein-3 induces apoptosis and mediates the effects of transforming growth factor-
1 on programmed cell death through a p53 and IGF-independent mechanism. J Biol Chem 272: 1218112188, 1997.
25. Richman C, Baylink DJ, Lang K, Dony C, and Mohan S. Recombinant human insulin-like growth factor-binding protein-5 stimulates bone formation parameters in vitro and in vivo. Endocrinology 140: 46994705, 1999.
26. Rosen CJ and Donahue LR. Insulin-like growth factors and bone: the osteoporosis connection revisited. Proc Soc Exp Biol Med 219: 17, 1998.[Abstract]
26a. Salih DAM, Mohan S, Kasukawa Y, Tripathi G, Lovett FA, Anderson Carter NF, EJ, Wergedal JE, Baylink DJ, and Pell JM. Insulin-like growth factor-binding protein-5 induces a gender-related decrease in bone mineral density in transgenic mice. Endocrinology 146: 931940, 2005.
27. Sambrook J, Fritsch EF, and Maniatis T. Molecular Cloning: A Laboratory Manual (2nd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.
28. Schedlich LJ, Le Page SL, Firth SM, Briggs LJ, Jans DA, and Baxter RC. Nuclear import of insulin-like growth factor-binding protein-3 and -5 is mediated by the import in beta subunit. J Biol Chem 275: 2346223470, 2000.
29. Schedlich LJ, Young TF, Firth SM, and Baxter RC. Insulin-like growth factor binding protein (IGFBP)-3 and IGFBP-5 share a common nuclear transport pathway in T47D uman breast carcinoma cells. J Biol Chem 273: 1834718352, 1998.
30. Shi Z, Xu W, Loechel F, Wewer UM, and Murphy LJ. ADAM 12, a disintegrin metalloproteinase, interacts with insulin-like growth factor-binding protein-3. J Biol Chem 275: 1857418580, 2000.
31. Spagnoli A, Hwa V, Horton WA, Lunstrum GP, Roberts CT Jr, Chiarelli F, Torello M, and Rosenfeld RG. Antiproliferative effects of insulin-like growth factor-binding protein-3 in mesenchymal chondrogenic cell line RCJ31C518 Relationship to differentiation stage. J Biol Chem 276: 55335540, 2001.
32. Xia H, Mao Q, Paulson HL, and Davidson BL. siRNA-mediated gene silencing in vitro and in vivo. Nat Biotechnol 20: 10061010, 2002.[CrossRef][ISI][Medline]
This article has been cited by other articles:
![]() |
Y. G. Amaar, M. G. Minera, L. K. Hatran, D. D. Strong, S. Mohan, and M. E. Reeves Ras association domain family 1C protein stimulates human lung cancer cell proliferation Am J Physiol Lung Cell Mol Physiol, December 1, 2006; 291(6): L1185 - L1190. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |