|
|
||||||||
MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS
1Nephrology Division, Department of Internal Medicine, Yale University School of Medicine, New Haven, Connecticut; 2Department of Physiology and Pharmacology, Oregon Health and Science University, Portland, Oregon; and 3The Mount Desert Island Biological Laboratory, Salisbury Cove, Maine
Submitted 28 April 2005 ; accepted in final form 14 October 2005
| ABSTRACT |
|---|
|
|
|---|
chloride transport; Xenopus laevis oocytes; dithiothreitol; glutathione; p-chloromercuriphenylsulfonic acid; cystic fibrosis transmembrane regulator
The heavy metal mercury is a potent inhibitor of secretion in the perfused rectal gland (58). With the use of in vitro assays and heterologous expression, several proteins expressed on the basolateral membrane, including the Na+-K+-2Cl cotransporter, Na+-K+-ATPase, and membrane adenylate cyclase, all of which mediate specific steps of the secretory pathway, were proposed as targets of mercury in the rectal gland (5, 32, 34, 59, 62).
Mercurials have broad cellular toxicity, especially in neurons and renal tubular cells (11, 25, 26, 43, 45, 47, 54, 64). Their capability to impair epithelial ion transport was exploited in mercurial diuretics acting on the loop of Henle of the human kidney (9, 10, 18, 25, 30). At a molecular level, the effects of mercuric substances are thought to be mediated by their high affinity for the thiolate anion (23, 43). Eventually, these reactions induce conformational changes or disrupt protein structure, leading to malfunction (32, 41, 43, 62).
Recent work from our laboratory demonstrated that the inhibition of Cl secretion in the shark rectal gland by HgCl2 occurs in a highly polarized fashion. When applied to the apical membrane of rectal gland cell monolayers in primary culture, HgCl2 (110 µM) effected a profound inhibition of Cl transport. In contrast, when HgCl2 was applied on the basolateral side, inhibition of Cl transport was five fold lower (50). The apically expressed protein that likely accounts for this differential effect is the shark orthologue of CFTR (sCFTR), the predominant conductive pathway for chloride exit in the shark rectal gland cell (17, 22, 40).
We sought to examine two hypotheses: 1) that sCFTR is a primary target of mercury toxicity in the rectal gland, and 2) that there are significant differences in the response to thiol-reactive agents between shark and human CFTR, likely mediated by differences in cysteine residues. We used the Xenopus laevis oocyte heterologous expression system to assay the effects of thiol reactants, HgCl2, ZnAc, and pCMBS on sCFTR and hCFTR. Our data provide strong evidence that sCFTR chloride channels are inhibited by HgCl2, ZnAc, and pCMBS, whereas the hCFTR orthologue is relatively insensitive to these three agents. Our data also suggest that the sensitivity of sCFTR to HgCl2 is mediated by the amino acid residue C102 in the first membrane-spanning segment.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-globin UTRs (kindly provided by Dr. Carol Semrad, New York) was purified by affinity columns (Qiagen) and linearized with KpnI. Capped hCFTR cRNA was synthesized using T7 RNA polymerase and in vitro transcription.
Oocyte preparation and expression of sCFTR and hCFTR.
Mature female Xenopus laevis were anesthetized in a 0.15% cold solution of tricaine for 20 min, and several ovarian lobules were removed under sterile conditions through an abdominal incision per a protocol approved by the Yale University Institutional Animal Care and Use Committee. Oocytes were incubated in a 2.5 mg/ml solution of type I collagenase for 2.5 h and subsequently manually defolliculated. Mature stage V and VI oocytes were selected and stored. After 1224 h, the oocytes were injected with 1020 ng sCFTR cRNA/50 nl, 410 ng of hCFTR, or an equivalent volume of water and then stored for 13 days in MBSH at 18°C. The amount of RNA was adjusted to achieve a level of expression that resulted in stimulated conductances
100 µS. Oocytes were stored in modified Barth solution holding (MBSH) medium containing (in mM) 88 NaCl, 1 KCl, 2.4 NaHCO3, 0.82 MgSO4, 0.33 Ca(NO3)2·4H2O, and 10 HEPES (5 Na+ salt, 5 acid), buffered to pH 7.4, and 150 mg/l gentamicin sulfate.
Creation of chimeric and mutant CFTR constructs. The human-shark chimeric protein (h-s MSD1) was prepared using PCR and restriction enzyme digestion. Membrane spanning domain 1 (MSD1) of shark was amplified using a sense primer with an overlapping sequence homologous to the NH2 terminal of hCFTR and an antisense primer with an introduced restriction site for BsiWI (sense, AAAATCCTAAACTCATTAATGCACTTCGCCGATG; antisense, CACGTTCGTACGGCAGATGGAAATTGTCTG). The NH2 terminal end of hCFTR was then amplified in a separate PCR (sense, ATACGACTCACTATAGG; antisense, GCATTAATGAGTTTAGG), and both fragments were combined in a third reaction. This product was joined to the rest of hCFTR using NotI and BsiWI restriction sites, and cloned into the pBlueskript KS() vector (Invitrogen). Mutant hCFTRs were constructed using the nested PCR method. For each mutant, both fragments carrying the desired mutation were amplified in the first PCR step using flanking and mutation-carrying primers (mutation-carrying primer: L101C-sense AGTACAGCCTCTCTGCCTGGGAAGAA; L101C-antisense TTCTTCCCAGGCAGAGAGGCTGTACT; V302C-sense GCCTATTGCAGATACTTCAATAGC; V302C-antisense AAGTATCTGCAATAGGCTGCCTTCCG; flanking primer: SacII TGTAAAACGACGGCCAGTGAG; BstZ17 I GTATACTGCTCTTGCTAAAGA). In the second PCR step, the two fragments were combined using only the flanking primers, and subcloned into the vector containing hCFTR from which the native fragment had been removed with SacII and BstZ17I.
Two-electrode voltage clamping.
Electrophysiological recordings were performed 24 days after injection. Electrodes were pulled on a micropipette puller (Sutter Instruments, Novato, CA) and had input resistances between 0.6 and 0.9 M
. For electrophysiological measurements, electrodes were filled with 3 M KCl. Membrane potential was recorded continuously on a chart recorder (model SR6253, Datamark). During two-electrode voltage-clamping recording, current-voltage (I-V) curves were obtained by clamping the voltage over a ramp from 120 to +60 mV at a rate of 100 mV/s with the use of a two-electrode voltage clamp (TEV-200, Dagan Instruments, Foster City, CA). After being corrected for capacity currents, reversal potentials were determined and conductances were calculated over a range of the corrected reversal potential ± 10 mV.
During a typical experiment, oocytes were perifused with frog Ringer solution containing (in mM) 98 NaCl, 2 KCl, 1.8 CaCl2, 1 MgCl2, 10 HEPES (5 Na+ salt, 5 acid), buffered to pH 7.4 (reagents from Sigma, St. Louis, MO). I-V ramps were taken under basal conditions, during steady-state stimulation by forskolin (10 µM) and IBMX (1 mM) and after addition of HgCl2, pCMBS, or ZnAc to the forskolin-IBMX solution. In all experiments inhibition was determined by the ratio of conductances measured immediately before and 30 min after addition of the sulfhydryl reactants. Data were analyzed with pCLAMP software (Axon Instruments). All data are means ± SE.
| RESULTS |
|---|
|
|
|---|
sCFTR- and hCFTR-injected oocytes had basal conductances of 16.1 ± 1.4 and 7.5 ± 1.5 µS, respectively. Water-injected control oocytes had a significantly lower baseline conductance of 3.4 ± 1.5 µS (P < 0.02 compared with both sCFTR and hCFTR) (Fig. 1, top). Baseline reversal potentials were 35.0 ± 1.1 mV, 38.0 ± 2.6 mV, and 40.2 ± 6.0 mV for sCFTR-, hCFTR-, and water-injected oocytes, respectively (Fig. 1, bottom).
|
Effects of mercuric chloride on sCFTR- and hCFTR-injected oocytes in representative experiments: time-course and I-V plots. The time-course and I-V relationships in representative experiments with our protocol are shown in Fig. 2. In both sCFTR- and hCFTR-injected oocytes, stimulation with FOR + IBMX resulted in a prompt increase in conductance, which reached a steady state after 3050 min (Fig. 2, A and B). Addition of 1µM HgCl2 to the perifusate rapidly decreased conductance in the sCFTR-injected oocyte (75.8% inhibition after 30 min of HgCl2) (Fig. 2A). In contrast, in an hCFTR- injected oocyte, the effect of HgCl2 on conductance was substantially less: addition of 1 µM HgCl2 decreased conductance by only 26.8% in this representative experiment (Fig. 2B). I-V relationships for these oocytes are shown in Fig. 2, C and D. Throughout the experiments, both sCFTR- and hCFTR- injected oocytes exhibited nearly linear I-V relationships. After the addition of HgCl2, the reversal potential repolarized toward basal values in the sCFTR-injected oocyte (43.0, 35.2, and 41.2 mV under basal, stimulated and HgCl2 conditions, respectively) (Fig. 2C). In the hCFTR-injected oocyte, mercury had an insignificant effect on the reversal potential (Fig. 2D).
|
|
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
In the present study, we provide direct support for the hypothesis that CFTR chloride channels are a primary site of mercury toxicity in the shark rectal gland and provide the first evidence that shark and human orthologues of CFTR Cl channels have markedly different sensitivity to inhibition by mercuric chloride, pCMBS, and other thiol reactive substances.
Speculation on the site of action of mercury must take into account the mercury species that are most abundant in a physiological salt solution (14). Mercury, like many metals, exists in solution in anionic complexes and the nature of the anionic ligand is a primary determinant of reactivity. In the presence of 126 mM chloride, divalent mercury is present in small amounts and is unlikely to be the species involved in reactions with protein thiols (63). Under these conditions the majority of mercury exists in three forms, in roughly equal proportions, HgCl2, HgCl
and HgCl
. Reaction with thiols occurs via a ligand substitution whereby one or more of the chloride ligands is exchanged for the thiolate anion. In view of the negative charge of the reactive thiolate, electrostatic considerations render the neutral species, HgCl2, most likely to participate in a ligand substitution reaction, i.e., protein-S + HgCl2
protein-S-HgCl.
The inhibition of sCFTR by mercury was irreversible upon washout. One explanation is that mercury caused irreversible conformational change or disruption of the protein that prevented restoration of conductance. However, our findings show that mercury inhibition could be immediately and completely restored by applying DTT to the bath solution. The failure of GSH, a larger molecule, to reverse the reaction of mercury with sCFTR, even at concentrations 20-fold higher than DTT, likely reflects the relative impermeability of the tripeptide (19). Our data suggest a model in which DTT competes for the thiolate-liganded mercury. This mechanism is supported by the Zn2+ inhibition, which mimics the inhibition by HgCl2 and pCMBS, but is readily reversed on washout. Wang et al. (61) recently reported that hCFTR with substituted cysteines was inhibited by zinc and that this effect depended on interactions with the engineered cysteines. Therefore, we suggest ligand substitution of mercurials and Zn2+ on specific thiolate groups in sCFTR, with the structural integrity of the protein remaining intact, to be the underlying mechanism of inhibition.
Nondestructive binding with reversibility has been proposed as the mechanism for mercury toxicity in other epithelial proteins, including the Na+-K+-2Cl-cotransporter, the Na+-K+-ATPase and aquaporins, in which mercury binds to specific cysteine residues (13, 32, 37, 38, 41, 44, 62). In the shark Na+-K+-2Cl-cotransporter, for example, Hg2+ interacts with cysteine residue C697 in the transmembrane domain 11, causing inhibition of the cotransporter activity that is restored upon addition of DTT (32).
Once we established a high sensitivity of sCFTR to thiol reactive agents, we investigated the effect of these compounds on hCFTR. We found a pronounced difference in the sensitivity to mercurials between sCFTR and hCFTR: the human protein was inhibited to a much lesser extent than the shark homologue (15.0 ± 2.1% vs. 77.7 ± 4.3% inhibition at 5 µM HgCl2 of hCFTR vs. sCFTR). Furthermore, not only HgCl2 but also the thiol reactive agents pCMBS and Zn2+ had similar patterns of inhibition: both compounds inhibited hCFTR either weakly (pCMBS), or insignificantly (ZnAc). In other membrane protein systems, pCMBS sensitivity has correlated with the presence of exofacial cysteine residues (31, 65). Cysteine residues in the R-domain, sensitive to 10- to 100-fold higher concentrations of mercury, were recently suggested as sites influencing channel gating in human CFTR Cl channels (33). In agreement with our findings was the lack of significant inhibition of hCFTR by pCMBS (33). The striking differences in sensitivity to HgCl2, zinc, and pCMBS in oocytes expressing sCFTR and hCFTR, and the presence of unique cysteines not found in the human protein, reinforce the idea that cysteine thiolates are the site(s) of action of mercury as well as pCMBS and zinc.
Comparison of the amino acid sequences of the two proteins reveals that sCFTR shares 72% of its amino acid sequence with the human protein (42, 52). Of the 18 cysteine residues in sCFTR, six are unique to the shark orthologue. Two of these cysteines (C102 and C303) are located in the MSD1, including one (C102) present on an exofacial site. Both cysteines are not present in other species, where CFTR sequence is known, including zebrafish, pufferfish, and salmon (GenBank). Because MSD1 has been proposed to be involved in the pore region of CFTR (1, 16, 57), we focused our chimeric and mutational experiments on this segment. Replacing MSD1 of human with the corresponding segment of sCFTR created a chimeric protein that, like sCFTR, was highly sensitive to HgCl2. The single mutation to cysteine (hL101C) (corresponding to wild-type C102 in shark) resulted in complete sensitivity to mercury, whereas the single mutation to cysteine (hV302C) (corresponding to wild-type C303 in shark) showed minimal sensitivity to HgCl2, and was not different from hCFTR (Fig. 8). This finding suggests that L101 contributes either directly or indirectly to the formation of the channel pore.
Taken together with our previous work in cultured monolayers, the present experiments establish that CFTR is a major target of mercury in epithelial cells of the shark rectal gland. Furthermore, we describe marked differences to three thiol reactive agents between human and shark CFTR chloride channels and identify the cysteine residue likely responsible for these effects. These findings establish a novel property of the sCFTR protein that advances our understanding of the structure and function of CFTR.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Albrecht J, Talbot M, Kimelberg HK, and Aschner M. The role of sulfhydryl groups and calcium in the mercuric chloride-induced inhibition of glutamate uptake in rat primary astrocyte cultures. Brain Res 607: 249254, 1993.[CrossRef][ISI][Medline]
3. Aller SG, Lombardo ID, Bhanot S, and Forrest JN Jr. Cloning, characterization, and functional expression of a CNP receptor regulating CFTR in the shark rectal gland. Am J Physiol Cell Physiol 276: C442C449, 1999.
4. Anderson MP, Gregory RJ, Thompson S, Souza DW, Paul S, Mulligan RC, Smith AE, and Welsh MJ. Demonstration that CFTR is a chloride channel by alteration of its anion selectivity. Science 253: 202205, 1991.
5. Askari A, Huang W, and Henderson GR. Na,K-ATPase: functional and structural modifications induced by mercurials. In: Structure and Kinetics. New York: Academic, 1979, p. 205215.
6. Ballatori N and Boyer JL. Disruption of cell volume regulation by mercuric chloride is mediated by an increase in sodium permeability and inhibition of an osmolyte channel in skate hepatocytes. Toxicol Appl Pharmacol 140: 404410, 1996.[CrossRef][ISI][Medline]
7. Barrett KE and Keely SJ. Chloride secretion by the intestinal epithelium: molecular basis and regulatory aspects. Annu Rev Physiol 62: 535572, 2000.[CrossRef][ISI][Medline]
8. Benison GC, Di Lello P, Shokes JE, Cosper NJ, Scott RA, Legault P, and Omichinski JG. A stable mercury-containing complex of the organomercurial lyase MerB: catalysis, product release, and direct transfer to MerA. Biochemistry 43: 83338345, 2004.[CrossRef][Medline]
9. Burg M and Green N. Effect of mersalyl on the thick ascending limb of Henle's loop. Kidney Int 4: 245251, 1973.[ISI][Medline]
10. Burg MB and Green N. Function of the thick ascending limb of Henle's loop. Am J Physiol 224: 659668, 1973.
11. Campbell BG. Mercury, cadmium and arsenic: toxicology and laboratory investigation. Pathology 31: 1722, 1999.[CrossRef][ISI][Medline]
12. Christianson DW. Structural biology of zinc. Adv Protein Chem 42: 281355, 1991.[Medline]
13. Daniels MJ, Chaumont F, Mirkov TE, and Chrispeels MJ. Characterization of a new vacuolar membrane aquaporin sensitive to mercury at a unique site. Plant Cell 8: 587599, 1996.[Abstract]
14. Dawson DC and Ballatori N. Membrane transporters as sites of action and routes of entry for toxic metals. In Handbook of Experimental Pharmacology. Toxicity of Metals, edited by Goyer RA and Cherian MG. Berlin: Springer-Verlag, 1995, vol. 115, p. 5376.
15. Dawson DC, Liu X, Zhang Z, and McCarthy N. Anion conduction by CFTR: mechanisms and models. In: The Cystic Fibrosis Transmembrane Conductance Regulator, edited by Kirk KL and Dawson DC. Austin, TX: Landes Bioscience, Kluwer Academic Plenum, 2003, p. 134.
16. Dawson DC, Smith SS, and Mansoura MK. CFTR: mechanism of anion conduction. Physiol Rev 79: S47S75, 1999.[Medline]
17. Devor DC, Forrest JN Jr, Suggs WK, and Frizzell RA. cAMP-activated Cl channels in primary cultures of spiny dogfish (Squalus acanthias) rectal gland. Am J Physiol Cell Physiol 268: C70C79, 1995.
18. Diamond GL and Zalups RK. Understanding renal toxicity of heavy metals. Toxicol Pathol 26: 92103, 1998.[ISI][Medline]
19. DiPaola M, Czajkowski C, and Karlin A. The sidedness of the COOH terminus of the acetylcholine receptor delta subunit. J Biol Chem 264: 1545715463, 1989.
20. Forbush B 3rd, Haas M, and Lytle C. Na-K-Cl cotransport in the shark rectal gland. I. Regulation in the intact perfused gland. Am J Physiol Cell Physiol 262: C1000C1008, 1992.
21. Forbush B 3rd, Lytle C, Xu JC, Payne JA, and Biemesderfer D. The Na, K, Cl cotransporter of shark rectal gland. Renal Physiol Biochem 17: 201204, 1994.[ISI][Medline]
22. Forrest JN Jr. Cellular and molecular biology of chloride secretion in the shark rectal gland: regulation by adenosine receptors. Kidney Int 49: 15571562, 1996.[ISI][Medline]
23. Freeman HC. Crystal structures of metal-peptide complexes. Adv Protein Chem 22: 257424, 1967.[Medline]
24. Fu HW, Moomaw JF, Moomaw CR, and Casey PJ. Identification of a cysteine residue essential for activity of protein farnesyltransferase. Cys299 is exposed only upon removal of zinc from the enzyme. J Biol Chem 271: 2854128548, 1996.
25. Ganote CE, Reimer KA, and Jennings RB. Acute mercuric chloride nephrotoxicity. An electron microscopic and metabolic study. Lab Invest 31: 633647, 1974.[ISI][Medline]
26. Goyer RA. Toxic effects of metals. In: Caserett and Doull's ToxicologyThe Basic Science of Poisons. New York: McGraw-Hill, 1993.
27. Greger R, Gogelein H, and Schlatter E. Potassium channels in the basolateral membrane of the rectal gland of the dogfish (Squalus acanthias). Pflügers Arch 409: 100106, 1987.[CrossRef][ISI][Medline]
28. Hainaut P and Mann K. Zinc binding and redox control of p53 structure and function. Antioxid Redox Signal 3: 611623, 2001.[CrossRef][ISI][Medline]
29. Henkin RI. Metal-albumin-amino acid interactions: chemical and physiological interrelationships. Adv Exp Med Biol 48: 299328, 1974.[Medline]
30. Hirsch GH. Differential effects of nephrotoxic agents on renal transport and metabolism by use of in vitro techniques. Environ Health Perspect 15: 8999, 1976.[ISI][Medline]
31. Hruz PW and Mueckler MM. Cysteine-scanning mutagenesis of transmembrane segment 7 of the GLUT1 glucose transporter. J Biol Chem 274: 3617636180, 1999.
32. Jacoby SC, Gagnon E, Caron L, Chang J, and Isenring P. Inhibition of Na+-K+-2Cl cotransport by mercury. Am J Physiol Cell Physiol 277: C684C692, 1999.
33. Ketchum CJ, Yue H, Alessi KA, Devidas S, Guggino WB, and Maloney PC. Intracellular cysteines of the cystic fibrosis transmembrane conductance regulator (CFTR) modulate channel gating. Cell Physiol Biochem 12: 18, 2002.[ISI][Medline]
34. Kinne-Saffran E and Kinne RK. Inhibition by mercuric chloride of Na-K-2Cl cotransport activity in rectal gland plasma membrane vesicles isolated from Squalus acanthias. Biochim Biophys Acta 1510: 442451, 2001.[Medline]
35. Koivisto A, Siemen D, and Nedergaard J. Reversible blockade of the calcium-activated nonselective cation channel in brown fat cells by the sulfhydryl reagents mercury and thimerosal. Pflügers Arch 425: 549551, 1993.[CrossRef][ISI][Medline]
36. Krezel A, Lesniak W, Jezowska-Bojczuk M, Mlynarz P, Brasun J, Kozlowski H, and Bal W. Coordination of heavy metals by dithiothreitol, a commonly used thiol group protectant. J Inorg Biochem 84: 7788, 2001.[CrossRef][ISI][Medline]
37. Kuang K, Haller JF, Shi G, Kang F, Cheung M, Iserovich P, and Fischbarg J. Mercurial sensitivity of aquaporin 1 endofacial loop B residues. Protein Sci 10: 16271634, 2001.
38. Kuwahara M, Gu Y, Ishibashi K, Marumo F, and Sasaki S. Mercury-sensitive residues and pore site in AQP3 water channel. Biochemistry 36: 1397313978, 1997.[CrossRef][Medline]
39. Lauriault VV and O'Brien PJ. Molecular mechanism for prevention of N-acetyl-p-benzoquinoneimine cytotoxicity by the permeable thiol drugs diethyldithiocarbamate and dithiothreitol. Mol Pharmacol 40: 125134, 1991.[Abstract]
40. Lehrich RW, Aller SG, Webster P, Marino CR, and Forrest JN Jr. Vasoactive intestinal peptide, forskolin, and genistein increase apical CFTR trafficking in the rectal gland of the spiny dogfish, Squalus acanthias. Acute regulation of CFTR trafficking in an intact epithelium. J Clin Invest 101: 737745, 1998.[ISI][Medline]
41. Loghman-Adham M. Inhibition of renal Na+-Pi cotransporter by mercuric chloride: role of sulfhydryl groups. J Cell Biochem 49: 199207, 1992.[CrossRef][ISI][Medline]
42. Marshall J, Martin KA, Picciotto M, Hockfield S, Nairn AC, and Kaczmarek LK. Identification and localization of a dogfish homolog of human cystic fibrosis transmembrane conductance regulator. J Biol Chem 266: 2274922754, 1991.
43. Matts RL, Schatz JR, Hurst R, and Kagen R. Toxic heavy metal ions activate the heme-regulated eukaryotic initiation factor-2
kinase by inhibiting the capacity of hemin-supplemented reticulocyte lysates to reduce disulfide bonds. J Biol Chem 266: 1269512702, 1991.
44. Mulders SM, Rijss JP, Hartog A, Bindels RJ, van Os CH, and Deen PM. Importance of the mercury-sensitive cysteine on function and routing of AQP1 and AQP2 in oocytes. Am J Physiol Renal Physiol 273: F451F456, 1997.
45. Nath KA, Croatt AJ, Likely S, Behrens TW, and Warden D. Renal oxidant injury and oxidant response induced by mercury. Kidney Int 50: 10321043, 1996.[ISI][Medline]
46. Navaratnam N and Stinson RA. Modulation of activity of human alkaline phosphatases by Mg2+ and thiol compounds. Biochim Biophys Acta 869: 99105, 1986.[CrossRef][Medline]
47. Oehme FW. Mechanisms of heavy metal toxicities. Clin Toxicol 5: 151167, 1972.[ISI][Medline]
48. Oram PD, Fang X, Fernando Q, Letkeman P, and Letkeman D. The formation of constants of mercury(II)glutathione complexes. Chem Res Toxicol 9: 709712, 1996.[CrossRef][ISI][Medline]
49. Pruett P, Kinne RKH, and Kinne-Saffran E. Mercury binding and inhibition of transport systems in plasma membranes isolated from rectal gland of Squalus acanthias. Bull MDIBL 36: 1718, 1997.
50. Ratner M, Weber G, Smith C, Aller SG, Rizor K, Dawson DC, and Forrest JN Jr. Polarity of mercury toxicity in the shark (Squalus acanthias) rectal gland: apical chloride transport and shark CFTR channels expressed in Xenopus oocytes are highly sensitive to inorganic mercury. Bull MDIBL 37: 2021, 1998.
51. Riordan JR, Forbush B 3rd, and Hanrahan JW. The molecular basis of chloride transport in shark rectal gland. J Exp Biol 196: 405418, 1994.
52. Riordan JR, Rommens JM, Kerem B, Alon N, Rozmahel R, Grzelczak Z, Zielenski J, Lok S, Plavsic N, and Chou JL. Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA. Science 245: 10661073, 1989.
53. Seebungkert B and Lynch JW. A common inhibitory binding site for zinc and odorants at the voltage-gated K+ channel of rat olfactory receptor neurons. Eur J Neurosci 14: 353362, 2001.[CrossRef][ISI][Medline]
54. Sharma RP and Obersteiner EJ. Metals and neurotoxic effects: cytotoxicity of selected metallic compounds on chick ganglia cultures. J Comp Pathol 91: 235244, 1981.[CrossRef][ISI][Medline]
55. Sheppard DN, Ostedgaard LS, Rich DP, and Welsh MJ. The amino-terminal portion of CFTR forms a regulated Cl channel. Cell 76: 10911098, 1994.[CrossRef][ISI][Medline]
56. Sheppard DN, Travis SM, Ishihara H, and Welsh MJ. Contribution of proline residues in the membrane-spanning domains of cystic fibrosis transmembrane conductance regulator to chloride channel function. J Biol Chem 271: 1499515001, 1996.
57. Sheppard DN and Welsh MJ. Structure and function of the CFTR chloride channel. Physiol Rev 79: S23S45, 1999.[Medline]
58. Silva P, Epstein FH, and Solomon RJ. The effect of mercury on chloride secretion in the shark (Squalus acanthias) rectal gland. Comp Biochem Physiol C 103: 569575, 1992.[Medline]
59. Solomon R, Epstein FH, and Silva P. The effect of mercury on chloride secretion in the rectal gland of Squalus acanthias. Bull MDIBL 32: 8486, 1993.
60. Tabcharani JA, Rommens JM, Hou YX, Chang XB, Tsui LC, Riordan JR, and Hanrahan JW. Multi-ion pore behaviour in the CFTR chloride channel. Nature 366: 7982, 1993.[CrossRef][Medline]
61. Wang G, Liu X, Billingsley J, and Dawson DC. Zn2+ inhibition of cysteine- and histidine-substituted CFTR constructs: monomeric or multimeric channel? Biophys J 82: 59, 2003.
62. Wang X and Horisberger JD. Mercury binding site on Na+/K+-ATPase: a cysteine in the first transmembrane segment. Mol Pharmacol 50: 687691, 1996.[Abstract]
63. Webb JL. Mercurials. In: Enzyme and Metabolic Inhibitors. New York: Academic, 1966.
64. Wood M. Mechanisms for the neurotoxicity of mercury. In: Organotransitional Metal Chemistry. New York: Plenum, 1987.
65. Yao SY, Sundaram M, Chomey EG, Cass CE, Baldwin SA, and Young JD. Identification of Cys140 in helix 4 as an exofacial cysteine residue within the substrate-translocation channel of rat equilibrative nitrobenzylthioinosine (NBMPR)-insensitive nucleoside transporter rENT2. Biochem J 353: 387393, 2001.[CrossRef][ISI][Medline]
This article has been cited by other articles:
![]() |
M. S. Bewley, J. T. G. Pena, F. N. Plesch, S. E. Decker, G. J. Weber, and J. N. Forrest Jr. Shark rectal gland vasoactive intestinal peptide receptor: cloning, functional expression, and regulation of CFTR chloride channels Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2006; 291(4): R1157 - R1164. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |