|
|
||||||||
MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS
1Research Group Molecular Nutrition, University of Kiel, Kiel; and 2Physiology of Nutrition, Technical University of Munich, Freising-Weihenstephan, Germany
Submitted 19 October 2004 ; accepted in final form 15 August 2005
| ABSTRACT |
|---|
|
|
|---|
di- and tripeptide transport; polarized epithelial cells; lysosomes
The asymmetric distribution of apical transmembrane proteins is not completely understood. Direct or indirect sorting of newly synthesized proteins occurs in the trans-Golgi network (TGN), where proteins are assembled in specific vesicles. Information for basolateral targeting appears to be encoded in short signals in intracellular tails, such as tyrosine-based YXXØ or NPXY (with X representing any amino acid and Ø representing hydrophobic) and dileucine-based motifs (24), whereas apical targeting seems to be mediated by a wider range of signals. Protein-based signals are present in the transmembrane (16) or cytoplasmic domains. COOH-terminal postsynaptic density-95/Drosophila discs large/zonula occludens-1 (PDZ) motifs (TXL/F) mediating interaction with PDZ domain-containing proteins are suggested to play a role in apical targeting or anchoring of integral proteins in the apical membrane (25, 39, 50). More recently, new apical sorting motifs comprising a
-turn structure were identified in Na+-dependent transporter proteins (53, 54). Other mechanisms of apical targeting require either clustering of proteins into glycolipid- and cholesterol-enriched rafts, O-glycosylation (8, 27), or N-glycosylation (26) of extracellular domains.
PEPT2 is an integral membrane protein with 12 predicted transmembrane domains (TMDs) and cytoplasmic NH2 and COOH termini (3, 35). Because the cytosolic COOH-terminal regions of transmembrane proteins are more frequently involved in polarized expression, we have analyzed the COOH terminus of PEPT2 with respect to protein domains that are important to its apical expression. Cellular distribution of enhanced green fluorescent protein (EGFP)-tagged wild-type PEPT2 (PEPT2-WT) and a series of proteins with COOH-terminal truncations and amino acid substitutions were analyzed using confocal microscopy after expression in the polarized proximal tubule cell lines SKPT and OK. In the present study, we have demonstrated that the amino acids isoleucine-720 (I720) and leucine-722 (L722) are important for the apical localization of PEPT2. Deletion or exchange of these amino acids by alanine resulted in impaired apical cell surface expression and accumulation of the transporter mutants mainly in lysosomal structures. Tyrosine-based motifs near the last TMD seem also to be involved in the sorting of PEPT2. A mutant lacking the whole COOH terminus displayed a more diffuse intracellular accumulation pattern in contrast to a mutant that still contained these motifs. Internalization studies revealed that PEPT2 mutants were internalized at a higher rate than wild-type transporters.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
3'): CCAAGAAGACAAAGCTCTCACCGGTCCCAGGACTCT.
To introduce an AgeI site at the desired last COOH-terminal codon, PEPT2 truncation mutants were generated by performing PCR amplification using the forward primer (5'
3') TCGTCGTATCTCCAAGTGTGG and the following specific reverse primers (5'
3'): delC7, CCACCGGTAAGTTGATCATGTTCCC; delC8, CCACCGGTCCGTTGATCATGTTCCC; delC30, CCACCGGTATGGGAATATAGTAGTAGC; and delC36, CAACCGGTCCCATGATGGAGAAGATC. After EcoRV/AgeI restriction enzyme digestion of PCR products and PEPT2-EGFP, the PEPT2-WT COOH terminus was replaced by truncated COOH termini by subcloning of the PCR products into the EcoRV/AgeI sites of PEPT2-EGFP.
Construction of single-amino acid substitution mutants was performed using the QuickChange in vitro mutagenesis kit. The following primers and the complementary oligonucleotides containing the mutation in the middle were used (5'
3'): L722A, CCATATGCAAGGGAACATGATCAACGCAGAGACCAAG; I720A, CCATATGCAAGGGAACATGGCCAACTTAGAGACCAAG; L722I, CCATATGCAAGGGAACATGATCAACATAGAGACCAAG; I720L, CCATATGCAAGGGAACATGCTCAACTTAGAGACCAAG; and ILA, CCATATGCAAGGGAACATGATCCTCGCAGAGACCAAG. All constructs were verified by performing sequencing.
Cell culture. The renal proximal tubule cell lines from rat (SKPT-0193 Cl.2) and opossum (OK) were kindly provided by M. Brandsch (Martin-Luther-University, Halle, Germany) and H. Murer (University of Zurich, Zurich, Switzerland), respectively. Culture media, antibiotics, FBS, and trypsin solution were purchased from Life Technologies; apo-transferrin and dexamethasone were obtained from Sigma; and EGF was purchased from Promega.
OK cells were cultured in 1:1 DMEM-Ham's F-12 medium supplemented with 10% FBS and penicillin-streptomycin. SKPT cells were cultured in 1:1 DMEM-Ham's F-12 medium supplemented with 10% FBS, insulin, EGF, apo-transferrin, dexamethasone, and gentamicin. Cells were maintained at 37°C in a humidified atmosphere with 5% CO2. SKPT and OK cells were transiently transfected with a FuGENE 6 transfection reagent (Roche) mixture at a ratio of 2 µg of DNA to 3 µl of FuGENE 6 in a final 100-µl volume of serum-free medium per well according to the manufacturer's instructions. SKPT cells were seeded into six-well plates with coverslips and transfected 24 h after seeding at 70% confluence. OK cells were transiently transfected 2448 h after seeding under the same conditions. Stable transfections of OK cells were performed in six-well tissue culture plates. At
70% confluence, cells were transfected by adding the DNA-FuGENE 6 reagent mixture at a ratio of 2 µg of linearized DNA to 6 µl of FuGENE 6 in a final 100-µl volume of serum-free medium per well. After transfection (24 h), cells were split 1:9 into six-well plates and selected in OK medium containing 0.4 mg/ml G418 (Life Technologies) for 3 wk. Single colonies were picked.
Confocal microscopic immunofluorescence analysis. Cells were washed with PBS, fixed with 4% paraformaldehyde-PBS for 15 min, and permeabilized with 0.2% Triton X-100-PBS. Paraformaldehyde was quenched with 20 mM glycine-PBS and washed three times for 5 min with PBS before being blocked with 3% serum-0.1% Triton X-100-PBS for 30 min. Incubation with mouse MAb (BD Transduction Laboratories) against early endosomal antigen 1 (EEA1; 1:100 dilution) or Rab11 (1:50 dilution) and cathepsin D (1:50 dilution; Santa Cruz Biotechnology, Santa Cruz, CA) in 3% serum-0.1% Triton X-100-PBS was performed at 4°C overnight. After three 10-min washes with 3% serum-0.1% Triton X-100-PBS, cells were incubated with Cy3-conjugated secondary goat anti-mouse antibodies (1:600 dilution; Dianova) and donkey anti-rabbit antibodies (1:500 dilution; Dianova), respectively, for 1 h; washed three times for 10 min with PBS; and embedded in glycerol medium. Confocal images were obtained using a Leica TCS SP2 confocal laser-scanning microscope equipped with a x63 magnification oil-immersion lens objective. EGFP was excited with a 488-nm laser line and imaged at 500530 nm. Cy3 was excited at 543 nm and imaged at 560600 nm. EGFP and Cy3 were measured sequentially. LysoTracker Red DND-99 (Molecular Probes) staining was performed according to the manufacturer's instructions. Cells were grown on coverslips and incubated for 3060 min with 50 nM LysoTracker Red DND-99. Excitation was induced at 488/543 nm, and imaging was performed between 620 and 700 nm. Actin was stained with Alexa Fluor 633 phalloidin (Molecular Probes) after fixation and permeabilization of cells according to the manufacturer's instructions. Phalloidin was excited at 633 nm and imaged at 640700 nm. Images were analyzed using Leica confocal software version 2.5 and produced using Adobe Photoshop version 7.0 software.
Cell surface biotinylation and internalization assay. OK cells were grown on 9.2-cm2 petri dishes or 24-well plates for 8 days. Postconfluent (5 days) monolayers were preincubated with the lysosomal inhibitor leupeptin (100 µg/ml; Sigma) for internalization assays and washed three times with ice-cold PBS-CM (1.25 mM MgCl2 and 0.5 mM CaCl2, pH 7.5), and cell surface proteins were biotinylated by gentle shaking with 0.75 mg/ml EZ-Link sulfosuccinimidyl-2-(biotinamido)-ethyl-1,3-dithiopropionate (sulfo-NHS-SS-biotin) for internalization assays or EZ-Link sulfo-NHS-long chain (LC)-biotin (Pierce) in PBS-CM (pH 7.5) for 30 min on ice. Cells were washed three times with quenching buffer (100 mM glycine in PBS-CM) to remove nonreacted biotin. Subsequently, cells were washed twice with PBS-CM. For internalization assays, cells were incubated with medium at 37°C for the indicated time intervals. Remaining cell surface biotin was cleaved with 50 mM glutathione buffer (in mM: 90 NaCl, 1.25 MgCl2, and 1.25 CaCl2, pH 8.6). Unreacted glutathione was quenched by three washes with iodoacetamide (5 mg/ml PBS-CM; pH 7.4). Cells were scraped and solubilized using RIPA buffer (150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris·HCl, pH 8.0, and 0.1 mg/ml PMSF) supplemented with Complete Mini protease inhibitors (Roche), sonicated for 60 s, agitated on a shaker at 4°C for 30 min, and centrifuged at 14,000 rpm for 10 min to remove insoluble cellular debris. Cell lysate (100 µg) was incubated with Streptavidin Sepharose High Performance (Amersham Biosciences) in 300 µl of RIPA buffer for 3 h at 4°C. After brief centrifugation, supernatants were assumed to represent the intracellular basolateral pool, precipitated with acetone, and boiled in Laemmli buffer. Streptavidin-bound proteins were washed three times with RIPA buffer. Biotinylated proteins were eluted by boiling in Laemmli buffer and analyzed using SDS-PAGE and Western blot analysis.
SDS-PAGE, Western blot analysis, and ECL detection. Proteins were separated on 8% SDS polyacrylamide gels and transferred to PVDF membranes. Membrane blocking and incubation with antibodies were performed with 3% nonfat dry milk-TBST (20 mM Tris·HCl, pH 7.4, 137 mM NaCl, and 0.05% Tween 20). PEPT2-EGFP was detected with PAb against EGFP (1:2501:500 dilution, Living Colors A.V. peptide antibody; Clontech) and horseradish peroxidase-conjugated anti-rabbit IgG (1:5,000 dilution; Santa Cruz Biotechnology) and developed using ECL (Amersham Biosciences). Western blots were analyzed densitometrically using ImageJ public domain software (available at: http://rsb.info.nih.gov/ij/; National Institutes of Health, Bethesda, MD).
| RESULTS |
|---|
|
|
|---|
|
|
|
|
|
|
|
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
However, COOH-terminal tagging of PEPT2 with EGFP, and thus the elimination of the COOH-terminal group of the PDZ motif, which is important for interaction with PDZ domain-containing proteins (14), seems not to affect at least the apical expression of the protein. Moreover, deletion of the last seven COOH-terminal amino acids including the putative PDZ motif did not impair polarized distribution of PEPT2. However, we cannot exclude the possibility that binding of the PDZ motif to specific interaction partners such as PDZK1 might also be involved in the physiological or pathophysiological regulation mechanism of trafficking such as adaptation of the transport rate to the apical membrane (9), endocytosis (30), or recycling (34) and degradation (10).
Role of branched-chain amino acid residues in the COOH terminus.
Whereas the truncation of seven amino acids did not change surface expression, the removal of one more residue (L722) to obtain delC8 led to a marked shift in this protein's steady-state distribution. Similarly, delC30 and delC36 proteins also showed less apical localization and an enrichment in intracellular compartments. Furthermore, we have shown that the exchange of single-amino acid residues of I720 or L722 to alanine altered the distribution of PEPT2 drastically. Similarly to deletion mutants, these single-point mutants accumulated intracellularly. Whereas
90% of wild-type PEPT2 was found in the apical membrane of OK cells, less than one-half of mutant transporter proteins I720A and L722A were detected in this membrane domain. Surface biotinylation studies showed that the mutant proteins were internalized from the apical membrane at higher rates than WT or the ILA mutant. This might imply a function of I720 and L722 for membrane residence time and/or recycling of PEPT2. Because the mutant lacking the entire COOH terminus (delC36) showed a higher endocytosis rate than mutants I720A and I722A, other amino acid residues within COOH terminus also appear to be important to maintenance of membrane steady-state protein levels and/or recycling.
Generation of additional mutants I720L and L722I indicate that the amino acid positions 720 and 722 require branched-chain amino acids for correct localization. Moreover, the mutant ILA (720722) and N721A displayed a WT-like distribution along with strong apical staining. On the basis of these studies, it may be concluded that the residue 721 within the sequence I720N721L722 is not essential, as well as that the distance between the two branched-chain amino acid residues I720 and L722 does not appear to be critical for proper apical localization. Nevertheless, the asparagine-flanking isoleucine and leucine residues seem to be crucial to these proteins' appearance and/or residence time in the apical membrane.
However, these experiments were performed with a PEPT2 that lacked a functional PDZ motif because of COOH-terminal tagging. We are aware that possible attachment of PEPT2 to the cytoskeleton and insertion of the transporter into a network of regulating proteins by binding to scaffolding PDZ proteins can influence the stability of PEPT2 in the apical membrane. We cannot rule out that in another protein environment, the branched-chain amino acids described herein could act in another way. The possible function of the branched-chain amino acids in retaining PEPT2 in the apical membrane could cross react with possible regulation by a PDZ protein, and these possibilities require further investigation.
Nevertheless, leucine residues of dileucine motifs have been described as playing a role in multiple cellular sorting events by interaction either with µ-chain subunits of adaptor proteins (APs) or with Golgi-localized,
-ear-containing, Arf (ADP ribosylation factor)-binding GGA proteins to allow binding of several proteins and to associate with clathrin complexes (5, 7). Furthermore, leucine residues seem to be crucial to the localization of apical transmembrane proteins. A dileucine motif was demonstrated to participate in the anchoring of insulin receptors to microvilli (48), and in the sodium phosphate transporter NaPi type IIb, a single leucine residue in the cytosolic COOH terminus was identified as essential for apical membrane expression in OK cells (28). I720 and L722 in PEPT2 do resemble the previously described motifs associated with adjacent amino acids 718722/723. The sequence 718NMINL722 of PEPT2 mimics an N-not acidic-[IL]-X-Ø motif that was shown in plant cells to act as a vacuolar sorting signal in the NH2-terminal propeptide of prosporamin as well as at the COOH terminus of the mature protein (32, 36). Some similarity exists between PEPT2 amino acids 718NMINLE723 and a clathrin-binding motif called clathrin box pLØpØp (with P representing polar), whereas the leucine was observed to be nearly invariant (33). This observation demonstrates that signals similar to the PEPT2 COOH-terminal domain described herein are involved in several cellular sorting steps.
Intracellular localization. Although PEPT2 clearly shows apical membrane distribution, a small proportion of the wild-type protein could be detected along the endocytotic recycling pathway by performing colocalization studies of EEA1- and Rab11-positive compartments. This finding and the low endocytotic rate of the wild-type protein suggest that PEPT2 could be recycled to the plasma membrane after endocytosis rather than being delivered via late endosomes to lysosomes for degradation. PEPT2 mutants I720A and L722A were found in early endosomes and predominantly in lysosome, and their internalization rate was found to be three to four times higher than that of the wild type. The increased internalization rate seems to account, at least in part, for the altered phenotypic distribution of both mutants, with lower membrane density, reduced membrane residence time, and increased accumulation in lysosomes. However, we cannot exclude a priori that the mutant proteins bypass apical membrane targeting by direct sorting from the TGN to lysosomal membranes.
The PEPT2 mutant proteins did show accumulation in membranes of enlarged vesicles that could represent multivesicular bodies (MVBs). The formation of MVBs occurs at the level of endosomes to invaginate membrane proteins into the endosomal lumen before fusion with lysosomes and subsequent degradation of the proteins (43). However, accumulation of PEPT2 mutants in the outer membranes of enlarged, acidic, cathepsin D-positive organelles suggests a nondegradative pathway to which these proteins are submitted. Although the residues I720 and L722 appear to determine membrane residence time and/or recycling of the transporter, other signals may exist that account for the enhanced lysosomal accumulation of the two mutant proteins I720A and L722A. In PEPT2, two overlapping YXXØ motifs could act as lysosomal targeting signals. Interestingly, this motif is also present in PEPT1, although the COOH termini of these two transporters share little sequence similarity. For PEPT1 and a PEPT1-like transporter, respectively a lysosomal localization has been shown in renal cells and a role of peptide transporters for export of short-chain peptides from intralysosomal protein degradation have been proposed (59). A lysosomal localization therefore could represent a normal state, depending on cell type and physiological conditions. However, in SKPT and OK cells and most likely in normal renal tubular cells as well, PEPT2 is found in the apical membrane. This steady-state localization of PEPT2 seems to be critically determined by I720 and L722, which appear to dominate the tyrosine-based motifs. Other transmembrane proteins show a distance of seven or eight amino acids between the last residue of the TMD and the COOH-terminal YXXØ motif that mediates lysosomal targeting (44, 46), whereas the putative YXXØ motifs of PEPT2 are located in +1 and +3 positions relative to the TMD.
The mutant delC36, which lacks these tyrosine-based motifs, did not show this pronounced accumulation in membranes of enlarged vesicles but instead displayed a more diffuse intracellular distribution pattern in SKPT cells. This mutant protein was also found to be expressed at lower levels compared with WT and all other mutants. Accelerated degradation and ineffective passing through sorting machinery at different cellular sorting levels may explain the odd distribution of mutants lacking the tyrosine-based motifs. Tyrosine-based motifs, i.e., NPXY-like motifs and a YXXØ motif known to mediate basolateral sorting, were shown to be involved in the apical localization of the megalin receptor (55). One of these tyrosine-based motifs in PEPT2 contains a conserved proline residue in the Y+2 position. Proline residues were found to be favored compared with other residues in this position of tyrosine-based motifs in the µ1-, µ2-, and µ3-subunits of APs that function at the level of the TGN and the plasma membrane as well as endosomes (41). Thus tyrosine-based motifs of PEPT2 may be involved in its sorting at different cellular levels of the complex sorting machinery.
In conclusion, this study is the first to be reported in which intrinsic protein signals were investigated for apical membrane localization of the peptide transporter PEPT2 in epithelial cells. Our findings demonstrate that the conserved regions within the cytosolic COOH-terminal tail of PEPT2 bear different signals, including two branched-chain amino acid residues and tyrosine-based motifs that are important for proper localization and determination of membrane residence time of the transporter in tubular cells. The specific roles of the different motifs in the complex sorting processes and the proteins interacting with these domains need to be identified to understand the apical targeting of PEPT2.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Berger UV and Hediger MA. Distribution of peptide transporter PEPT2 mRNA in the rat nervous system. Anat Embryol (Berl) 199: 439449, 1999.[CrossRef][Medline]
3. Boll M, Herget M, Wagener M, Weber WM, Markovich D, Biber J, Clauss W, Murer H, and Daniel H. Expression cloning and functional characterization of the kidney cortex high-affinity proton-coupled peptide transporter. Proc Natl Acad Sci USA 93: 284289, 1996.
4. Boll M, Markovich D, Weber WM, Korte H, Daniel H, and Murer H. Expression cloning of a cDNA from rabbit small intestine related to proton-coupled transport of peptides,
-lactam antibiotics and ACE-inhibitors. Pflügers Arch 429: 146149, 1994.[CrossRef][Web of Science][Medline]
5. Bonifacino JS. The GGA proteins: adaptors on the move. Nat Rev Mol Cell Biol 5: 2332, 2004.[CrossRef][Web of Science][Medline]
6. Bonifacino JS and Dell'Angelica EC. Molecular bases for the recognition of tyrosine-based sorting signals. J Cell Biol 145: 923926, 1999.
7. Bonifacino JS and Traub LM. Signals for sorting of transmembrane proteins to endosomes and lysosomes. Annu Rev Biochem 72: 395447, 2003.[CrossRef][Web of Science][Medline]
8. Breuza L, Garcia M, Delgrossi MH, and Le Bivic A. Role of the membrane-proximal O-glycosylation site in sorting of the human receptor for neurotrophins to the apical membrane of MDCK cells. Exp Cell Res 273: 178186, 2002.[CrossRef][Web of Science][Medline]
9. Cheng J, Moyer BD, Milewski M, Loffing J, Ikeda M, Mickle JE, Cutting GR, Li M, Stanton BA, and Guggino WB. A Golgi-associated PDZ domain protein modulates cystic fibrosis transmembrane regulator plasma membrane expression. J Biol Chem 277: 35203529, 2002.
10. Cheng J, Wang H, and Guggino WB. Modulation of mature cystic fibrosis transmembrane regulator protein by the PDZ domain protein CAL. J Biol Chem 279: 18921898, 2004.
11. Choudhuri S, Cherrington NJ, Li N, and Klaassen CD. Constitutive expression of various xenobiotic and endobiotic transporter mRNAs in the choroid plexus of rats. Drug Metab Dispos 31: 13371345, 2003.
12. Dieck ST, Heuer H, Ehrchen J, Otto C, and Bauer K. The peptide transporter PepT2 is expressed in rat brain and mediates the accumulation of the fluorescent dipeptide derivative
-Ala-Lys-N
-AMCA in astrocytes. Glia 25: 1020, 1999.[CrossRef][Web of Science][Medline]
13. Döring F, Walter J, Will J, Föcking M, Boll M, Amasheh S, Clauss W, and Daniel H. Delta-aminolevulinic acid transport by intestinal and renal peptide transporters and its physiological and clinical implications. J Clin Invest 101: 27612767, 1998.[Web of Science][Medline]
14. Doyle DA, Lee A, Lewis J, Kim E, Sheng M, and MacKinnon R. Crystal structures of a complexed and peptide-free membrane protein-binding domain: molecular basis of peptide recognition by PDZ. Cell 85: 10671076, 1996.[CrossRef][Web of Science][Medline]
15. Dringen R, Hamprecht B, and Bröer S. The peptide transporter PepT2 mediates the uptake of the glutathione precursor CysGly in astroglia-rich primary cultures. J Neurochem 71: 388393, 1998.[Web of Science][Medline]
16. Dunbar LA, Aronson P, and Caplan MJ. A transmembrane segment determines the steady-state localization of an ion-transporting adenosine triphosphatase. J Cell Biol 148: 769778, 2000.
17. Faust PL, Kornfeld S, and Chirgwin JM. Cloning and sequence analysis of cDNA for human cathepsin D. Proc Natl Acad Sci USA 82: 49104914, 1985.
18. Fei YJ, Kanai Y, Nussberger S, Ganapathy V, Leibach FH, Romero MF, Singh SK, Boron WF, and Hediger MA. Expression cloning of a mammalian proton-coupled oligopeptide transporter. Nature 368: 563566, 1994.[CrossRef][Medline]
19. Gisler SM, Pribanic S, Bacic D, Forrer P, Gantenbein A, Sabourin LA, Tsuji A, Zhao ZS, Manser E, Biber J, and Murer H. PDZK1: I. a major scaffolder in brush borders of proximal tubular cells. Kidney Int 64: 17331745, 2003.[CrossRef][Web of Science][Medline]
20. Groneberg DA, Döring F, Nickolaus M, Daniel H, and Fischer A. Expression of PEPT2 peptide transporter mRNA and protein in glial cells of rat dorsal root ganglia. Neurosci Lett 304: 181184, 2001.[CrossRef][Web of Science][Medline]
21. Groneberg DA, Döring F, Theis S, Nickolaus M, Fischer A, and Daniel H. Peptide transport in the mammary gland: expression and distribution of PEPT2 mRNA and protein. Am J Physiol Endocrinol Metab 282: E1172E1179, 2002.
22. Groneberg DA, Nickolaus M, Springer J, Döring F, Daniel H, and Fischer A. Localization of the peptide transporter PEPT2 in the lung: implications for pulmonary oligopeptide uptake. Am J Pathol 158: 707714, 2001.
23. Hamman BD, Hendershot LM, and Johnson AE. BiP maintains the permeability barrier of the ER membrane by sealing the lumenal end of the translocon pore before and early in translocation. Cell 92: 747758, 1998.[CrossRef][Web of Science][Medline]
24. Heilker R, Spiess M, and Crottet P. Recognition of sorting signals by clathrin adaptors. Bioessays 21: 558567, 1999.[CrossRef][Web of Science][Medline]
25. Hernando N, Déliot N, Gisler SM, Lederer E, Weinman EJ, Biber J, and Murer H. PDZ-domain interactions and apical expression of type IIa Na/Pi cotransporters. Proc Natl Acad Sci USA 99: 1195711962, 2002.
26. Ihrke G, Bruns JR, Luzio JP, and Weisz OA. Competing sorting signals guide endolyn along a novel route to lysosomes in MDCK cells. EMBO J 20: 62566264, 2001.[CrossRef][Web of Science][Medline]
27. Jacob R, Alfalah M, Grünberg J, Obendorf M, and Naim HY. Structural determinants required for apical sorting of an intestinal brush-border membrane protein. J Biol Chem 275: 65666572, 2000.
28. Karim-Jimenez Z, Hernando N, Biber J, and Murer H. Requirement of a leucine residue for (apical) membrane expression of type IIb NaPi cotransporters. Proc Natl Acad Sci USA 97: 29162921, 2000.
29. Kato Y, Yoshida K, Watanabe C, Sai Y, and Tsuji A. Screening of the interaction between xenobiotic transporters and PDZ proteins. Pharm Res 21: 18861894, 2004.[CrossRef][Web of Science][Medline]
30. Kim JH, Lee-Kwon W, Park JB, Ryu SH, Yun CHC, and Donowitz M. Ca2+-dependent inhibition of Na+/H+ exchanger 3 (NHE3) requires an NHE3-E3KARP-
-actinin-4 complex for oligomerization and endocytosis. J Biol Chem 277: 2371423724, 2002.
31. Kocher O, Comella N, Tognazzi K, and Brown LF. Identification and partial characterization of PDZK1: a novel protein containing PDZ interaction domains. Lab Invest 78: 117125, 1998.[Web of Science][Medline]
32. Koide Y, Hirano H, Matsuoka K, and Nakamura K. The N-terminal propeptide of the precursor to sporamin acts as a vacuole-targeting signal even at the C terminus of the mature part in tobacco cells. Plant Physiol 114: 863870, 1997.[Abstract]
33. Lafer EM. Clathrin-protein interactions. Traffic 3: 513520, 2002.[CrossRef][Web of Science][Medline]
34. Lee-Kwon W, Kawano K, Choi JW, Kim JH, and Donowitz M. Lysophosphatidic acid stimulates brush border Na+/H+ exchanger 3 (NHE3) activity by increasing its exocytosis by an NHE3 kinase A regulatory protein-dependent mechanism. J Biol Chem 278: 1649416501, 2003.
35. Liu W, Liang R, Ramamoorthy S, Fei YJ, Ganapathy ME, Hediger MA, Ganapathy V, and Leibach FH. Molecular cloning of PEPT 2, a new member of the H+/peptide cotransporter family, from human kidney. Biochim Biophys Acta 1235: 461466, 1995.[Medline]
36. Matsuoka K and Nakamura K. Large alkyl side-chains of isoleucine and leucine in the NPIRL region constitute the core of the vacuolar sorting determinant of sporamin precursor. Plant Mol Biol 41: 825835, 1999.[CrossRef][Web of Science][Medline]
37. Mu FT, Callaghan JM, Steele-Mortimer O, Stenmark H, Parton RG, Campbell PL, McCluskey J, Yeo JP, Tock EPC, and Toh BH. EEA1, an early endosome-associated protein: EEA1 is a conserved
-helical peripheral membrane protein flanked by cysteine "fingers" and contains a calmodulin-binding IQ motif. J Biol Chem 270: 1350313511, 1995.
38. Mullins C and Bonifacino JS. The molecular machinery for lysosome biogenesis. Bioessays 23: 333343, 2001.[CrossRef][Web of Science][Medline]
39. Muth TR, Ahn J, and Caplan MJ. Identification of sorting determinants in the C-terminal cytoplasmic tails of the
-aminobutyric acid transporters GAT-2 and GAT-3. J Biol Chem 273: 2561625627, 1998.
40. Nakamura N, Lowe M, Levine TP, Rabouille C, and Warren G. The vesicle docking protein p115 binds GM130, a cis-Golgi matrix protein, in a mitotically regulated manner. Cell 89: 445455, 1997.[CrossRef][Web of Science][Medline]
41. Ohno H, Fournier MC, Poy G, and Bonifacino JS. Structural determinants of interaction of tyrosine-based sorting signals with the adaptor medium chains. J Biol Chem 271: 2900929015, 1996.
42. Pfister MF, Lederer E, Forgo J, Ziegler U, Lötscher M, Quabius ES, Biber J, and Murer H. Parathyroid hormone-dependent degradation of type II Na+/Pi cotransporters. J Biol Chem 272: 2012520130, 1997.
43. Piper RC and Luzio JP. Late endosomes: sorting and partitioning in multivesicular bodies. Traffic 2: 612621, 2001.[CrossRef][Web of Science][Medline]
44. Potter PK, Copier J, Sacks SH, Calafat J, Janssen H, Neefjes JJ, and Kelly AP. Accurate intracellular localization of HLA-DM requires correct spacing of a cytoplasmic YTPL targeting motif relative to the transmembrane domain. Eur J Immunol 29: 39363944, 1999.[CrossRef][Web of Science][Medline]
45. Ramamoorthy S, Liu W, Ma YY, Yang-Feng TL, Ganapathy V, and Leibach FH. Proton/peptide cotransporter (PEPT 2) from human kidney: functional characterization and chromosomal localization. Biochim Biophys Acta 1240: 14, 1995.[Medline]
46. Rohrer J, Schweizer A, Russell D, and Kornfeld S. The targeting of Lamp1 to lysosomes is dependent on the spacing of its cytoplasmic tail tyrosine sorting motif relative to the membrane. J Cell Biol 132: 565576, 1996.
47. Saito H, Okuda M, Terada T, Sasaki S, and Inui K. Cloning and characterization of a rat H+/peptide cotransporter mediating absorption of
-lactam antibiotics in the intestine and kidney. J Pharmacol Exp Ther 275: 16311637, 1995.
48. Shackleton S, Hamer I, Foti M, Zumwald N, Maeder C, and Carpentier JL. Role of two dileucine-like motifs in insulin receptor anchoring to microvilli. J Biol Chem 277: 4363143637, 2002.
49. Shen H, Smith DE, Yang T, Huang YG, Schnermann JB, and Brosius FC III. Localization of PEPT1 and PEPT2 proton-coupled oligopeptide transporter mRNA and protein in rat kidney. Am J Physiol Renal Physiol 276: F658F665, 1999.
50. Short DB, Trotter KW, Reczek D, Kreda SM, Bretscher A, Boucher RC, Stutts MJ, and Milgram SL. An apical PDZ protein anchors the cystic fibrosis transmembrane conductance regulator to the cytoskeleton. J Biol Chem 273: 1979719801, 1998.
51. Shu C, Shen H, Teuscher NS, Lorenzi PJ, Keep RF, and Smith DE. Role of PEPT2 in peptide/mimetic trafficking at the blood-cerebrospinal fluid barrier: studies in rat choroid plexus epithelial cells in primary culture. J Pharmacol Exp Ther 301: 820829, 2002.
52. Smith DE, Pavlova A, Berger UV, Hediger MA, Yang T, Huang YG, and Schnermann JB. Tubular localization and tissue distribution of peptide transporters in rat kidney. Pharm Res 15: 12441249, 1998.[CrossRef][Web of Science][Medline]
53. Subramanian VS, Marchant JS, Boulware MJ, and Said HM. A C-terminal region dictates the apical plasma membrane targeting of the human sodium-dependent vitamin C transporter-1 in polarized epithelia. J Biol Chem 279: 2771927728, 2004.
54. Sun AQ, Salkar R, Sachchidanand, Xu S, Zeng L, Zhou MM, and Suchy FJ. A 14-amino acid sequence with a
-turn structure is required for apical membrane sorting of the rat ileal bile acid transporter. J Biol Chem 278: 40004009, 2003.
55. Takeda T, Yamazaki H, and Farquhar MG. Identification of an apical sorting determinant in the cytoplasmic tail of megalin. Am J Physiol Cell Physiol 284: C1105C1113, 2003.
56. Teuscher NS, Novotny A, Keep RF, and Smith DE. Functional evidence for presence of PEPT2 in rat choroid plexus: studies with glycylsarcosine. J Pharmacol Exp Ther 294: 494499, 2000.
57. Ullrich O, Reinsch S, Urbé S, Zerial M, and Parton RG. Rab11 regulates recycling through the pericentriolar recycling endosome. J Cell Biol 135: 913924, 1996.
58. Urbé S, Huber LA, Zerial M, Tooze SA, and Parton RG. Rab11, a small GTPase associated with both constitutive and regulated secretory pathways in PC12 cells. FEBS Lett 334: 175182, 1993.[CrossRef][Web of Science][Medline]
59. Zhou X, Thamotharan M, Gangopadhyay A, Serdikoff C, and Adibi SA. Characterization of an oligopeptide transporter in renal lysosomes. Biochim Biophys Acta 1466: 372378, 2000.[Medline]
This article has been cited by other articles:
![]() |
V. S. Subramanian, J. S. Marchant, M. J. Boulware, T. Y. Ma, and H. M. Said Membrane targeting and intracellular trafficking of the human sodium-dependent multivitamin transporter in polarized epithelial cells Am J Physiol Cell Physiol, April 1, 2009; 296(4): C663 - C671. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Grati, N. Aggarwal, E. E. Strehler, and R. J. Wenthold Molecular determinants for differential membrane trafficking of PMCA1 and PMCA2 in mammalian hair cells J. Cell Sci., July 15, 2006; 119(14): 2995 - 3007. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |