HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: 290/2/C463    most recent 00350.2005v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (8) Citing Articles via Google Scholar Google Scholar Articles by Zhou, S. Articles by Mak, A. S. Search for Related Content PubMed PubMed Citation Articles by Zhou, S. Articles by Mak, A. S.

MUSCLE CELL BIOLOGY AND CELL MOTILITY

Effects of tyrosine phosphorylation of cortactin on podosome formation in A7r5 vascular smooth muscle cells

Department of Biochemistry and Protein Function Discovery Program, Queen's University, Kingston, Ontario, Canada

Submitted 14 July 2005 ; accepted in final form 14 September 2005

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
Cortactin, a predominant substrate of Src family kinases, plays an important role in Arp2/3-dependent actin polymerization in lamellipodia and membrane ruffles and was recently shown to be enriched in podosomes induced by either c-Src or phorbol ester. However, the mechanisms by which cortactin regulates podosome formation have not been determined. In this study, we showed that cortactin is required for podosome formation, using siRNA knockdown of cortactin expression in smooth muscle A7r5 cells. Treatment with phorbol ester or expression of constitutively active c-Src induced genesis of cortactin-containing podosomes as well as increase in phosphorylation of cortactin at Y421 and Y466, the Src phosphorylation sites on cortactin. The Src kinase inhibitor SU-6656 significantly inhibited formation of podosomes induced by phorbol ester and phosphorylation of cortactin, whereas PKC inhibitor did not affect podosome formation in c-Src-transfected cells. Unexpectedly, expression of cortactin mutants containing Y421F, Y421D, Y466F, or Y466D mutated sites did not affect podosome formation or cortactin translocation to podosomes, although endogenous tyrosine-phosphorylated cortactin at Y421 and Y466 was present in podosomes. Our data indicate that 1) PKC acts upstream of Src in phosphorylation of cortactin and podosome formation in smooth muscle cells; 2) expression of cortactin is essential for genesis of podosomes; 3) phosphorylation at Y421 and Y466 is not required for translocation of cortactin to podosomes, although phosphorylation at these sites appears to be enriched in podosomes; and 4) tyrosine phosphorylation of cortactin may be involved in regulation of stability and turnover of podosomes, rather than targeting this protein to the site of podosome formation.

actin cytoskeleton; Src; protein kinase C

Cross talk between PKC and Src in actin reorganization and podosome formation has been previously reported (2, 3, 15). In A7r5 cells, the phorbol ester tetradecanoylphorbol acetate (TPA) induces the disassembly of actin stress fibers concomitant with the appearance of membrane ruffles, which depend on PKC-mediated Src activity (2). Activation of Src by PKC appears to be indirect; however; TPA activates the protein tyrosine phosphatase-, which in turn dephosphorylates and activates Src (3). It also has been shown that PKC indirectly activates Src during podosome formation in mouse embryonic fibroblasts (15) involving an intermediate protein, AFAP-110, which binds to both Src and PKC, localizing them to the sites of podosome formation. In contrast, Src also has been shown to act upstream of PKC in response to several stimuli. For example, in murine fibroblasts, v-Src activates both PKC-dependent and -independent signaling pathways (36).

Cortactin is a multidomain scaffolding protein that plays a central role in de novo remodeling of the actin cytoskeleton. A variety of physiological and pathogenic stimuli such as platelet-derived growth factor, epidermal growth factor, and phorbol ester induce cortactin translocation from the cytosol to areas of dynamic actin reorganization, such as the peripheral lamellipodia, membrane ruffles, and podosomes (17, 18, 39, 40, 44). Cortactin was initially identified as a prominent substrate of Src (45, 46). Subsequently, other non-receptor protein tyrosine (Tyr) kinases, including Syk (14, 27), Fyn, and Fer (7, 12, 21, 23) also have been shown to phosphorylate cortactin in response to growth factors and stresses. The major phosphorylation sites of murine cortactin have been identified as Y421, Y466, and Y482, which are located in a carboxy-terminal proline-rich region (19). Phosphorylation of Y421 creates a docking site for the SH2 domain of Src and precedes the phosphorylation of Y466 and, possibly, Y482 (18). Although Tyr-phosphorylated cortactin is found to localize with F-actin in lamellipodia and podosomes (18), its role in actin cytoskeleton remodeling is poorly understood (8, 43). In vitro studies have shown that phosphorylation of cortactin by Src reduces the affinity of cortactin for actin and its ability to cross-link actin filaments (20). In addition, Src phosphorylation alters the ability of cortactin to interact with some of its binding partners (10, 11), including its ability to activate WASp/N-WASp (29). Although our understanding of the role of Tyr phosphorylation of cortactin is not complete, the consensus appears to be that the levels of Tyr phosphorylation in cortactin are positively correlated with cell migration and invasiveness (19, 33).

In the present study, we have shown that cortactin is essential for the formation of podosomes in PDBu-stimulated A7r5 cells. Treatment of cells with PDBu or expression of constitutively active c-Src induces the formation of podosomes concomitantly with phosphorylation of cortactin at sites Y421 and Y466. Inhibition of Src kinase was able to inhibit PDBu-induced podosome formation and phosphorylation of cortactin. However, the ability of cortactin to translocate to podosomes was independent of Tyr phosphorylation. Together, these data suggest that although cortactin is essential for the formation of podosomes, Tyr phosphorylation is not required for targeting cortactin to podosomes. Because phosphorylation of endogenous cortactin at Y421 and Y466 occurs in podosomes, Tyr phosphorylation may be involved in regulation of the podosome turnover.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
Reagents and antibodies. Rhodamine-labeled phalloidin, phorbol 12,13-dibutyrate, protein A-Sepharose beads, and polyclonal anti-c-Myc antibody, monoclonal anti-Flag antibody, monoclonal anti--actin antibody, and horseradish peroxidase (HRP)-conjugated secondary antibodies were purchased from Sigma-Aldrich. Bisindolylmaleimide I (BIM) and SU-6656 were obtained from Calbiochem. Monoclonal anti-cortactin (p80/85; clone 4F11), anti-phosphotyrosine (4G10), and anti-c-Src (EC10) antibodies were obtained from Upstate Biotechnology. Polyclonal anti-pY421 and anti-pY466 antibodies were obtained from Biosource International. Secondary antibodies coupled to AlexaFluor 350, 488, and 596 were purchased from Molecular Probes.

DNA constructs. Plasmids expressing the wild-type (SrcWT), dominant negative (SrcK259R, Y527F), and constitutively active (SrcY527F) chicken Src were a gift from Dr. B. Elliot (Queen's University) (22). Exogenous Src was identified with an antibody raised against chicken Src that does not cross-react with the endogenous rat Src. The NH₂-terminally Flag-tagged constructs encoding Y421F and Y466F and the Myc-tagged cortactin Y421/466/482F triple mutant were gifts from Dr. A. Kapus (The Toronto General Hospital and University Health Network) (12, 18). A cDNA construct encoding Myc-tagged full-length wild-type cortactin was used to generate Y421D and Y466D mutants by using the QuickChange XLII site-directed mutagenesis kit (Stategene). The identity of all constructs was confirmed using DNA sequencing analysis. An enhanced green fluorescent protein (EGFP)--actin expression plasmid was obtained from Clontech BD Bioscience.

Cell culture and transfection. A7r5 rat aortic smooth muscle cells (ATCC, Manassas, VA) were grown in low-glucose (1 g/l) Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin (Invitrogen) at 37°C and 5% CO₂. Cells were seeded on glass coverslips (Fisher Scientific) coated with 10 µg/ml fibronectin (Roche Applied Science) in a 24-well plate for immunofluoresence analysis or on 100-mm cell culture plates (Fisher Scientific) for immunoprecipitation studies. Cells were grown to 50–70% confluence before transfection with Lipofectamine PLUS reagents (Invitrogen), according to the manufacturer's instructions. Transfected cells were examined 24–48 h posttransfection.

siRNA knockdown. The siRNA with 3'-dTdT overhang targeting cortactin mRNA at AAGCUUCGAGAGAAUGUCUUC and a mismatched control AAGCUUCGACACAAUGUCUUC, mutated as underlined, was synthesized and duplexed with its corresponding complementary strands (Qiagen-Xeragon). The siRNA (56 nM) and pEGFP--actin (BD Bioscience) were transfected into A7r5 cells with the use of Lipofectamine 2000 reagents (Invitrogen), per the manufacturer's recommendations. Cells were treated with 5 µM PDBu for up to 60 min at 48 h posttransfection. Western blot analyses were carried out to assess the efficiency of the siRNA knockdown of cortactin. Briefly, A7r5 cells seeded in a 24-well plate were transfected with siRNA (56 nM), mismatched control siRNA (56 nM), or transfection reagent alone. At 72 h posttransfection, cell extracts were analyzed on SDS-PAGE, followed by immunoblotting with a monoclonal cortactin antibody. The amount of cortactin expressed in controls and knockdown cells was normalized to that of actin.

Immunofluorescence microscopy. A7r5 cells cultured on glass coverslips were briefly rinsed in PBS (138 mM NaCl, 26 mM KCl, 84 mM Na₂HPO₄, and 14 mM KH₂PO₄, pH 7.4), fixed in 3.2% paraformaldehyde (Sigma-Aldrich) for 10 min, washed in PBS, and then permeabilized for 10 min in 0.3% Triton X-100. After being blocked with 3% BSA (BioShop) for 30 min, cells were incubated with primary antibodies for 60 min at room temperature, followed by extensive washing with PBS and further incubation with designated secondary antibodies coupled with AlexaFluor 350 or 488 (Molecular Probes) and/or rhodamine-labeled phalloidin for 60 min at room temperature. Coverslips were mounted on glass slides with the use of fluorescence mounting medium (Dako). Fluorescent images were visualized with a Zeiss Axiovert S100 microscope equipped with a Plan-Neofluar x40 objective lens, a Plan-Apochromat x63 oil-immersion objective lens, a high-performance charge-coupled device camera (Cooke SensiCam), and Slidebook image analysis software (Intelligent Imaging Innovations).

Immunoprecipitation and immunoblotting. Cells were lysed in ice-cold lysis buffer containing 50 mM Tris·HCl, pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 1 mM NaF, 2 mM sodium orthovanadate, 10 mM sodium -glycerophosphate, 10 mM sodium pyrophosphate, and a protease inhibitor cocktail (Sigma-Aldrich). After incubation for 30 min at 4°C, lysates were cleared by centrifugation at 20,000 g for 15 min. The supernatant was precleared with protein A-Sepharose beads (Sigma-Aldrich) and further incubated with corresponding antibodies for 60 min at 4°C with gentle shaking. Immunocomplexes were captured with protein A-Sepharose beads, washed with lysis buffer, and eluted from beads by using Laemmli sample buffer, and boiled for 5 min. Samples were fractionated on 8% SDS-PAGE and transferred to nitrocellulose membranes (Millipore). Immunoblot analyses were performed using the designated primary antibodies (pan pY, pY421 cortactin, pY466 cortactin, pan cortactin, and c-Myc), the corresponding HRP-conjugated secondary antibodies, and enhanced chemiluminescent reagent (Perkin Elmer).

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
Src acts downstream of PKC in inducing podosome formation in smooth muscle cells. Unlike primary vascular smooth cells in culture, A7r5 cells retain a contractile phenotype characterized by a well-developed array of stress fibers (Fig. 1A) (25). Either treatment with PDBu or overexpression of constitutively active Src (SrcYF) readily disassembled the actin stress fibers and led to the production of podosomes, as shown in Fig. 1A and in agreement with previous reports (2, 3, 17, 42). Podosomes induced by both SrcYF and PDBu share common morphological features and contain similar marker proteins, including actin and cortactin (Fig. 1A) as well as Arp2/3, vinculin, and actinin (data not shown; Refs. 26, 42).

View larger version (47K): [in this window] [in a new window]   Fig. 1. Effects of Src on podosome formation in A7r5 cells. A: A7r5 cells grown on glass coverslips have a robust actin cytoskeleton, marked by a well-organized stress fiber network. Stimulation of cells with either phorbol-12,13-dibutyrate (PDBu) or transfection of cells with a constitutively active variant of Src (SrcYF) induced the disassembly of stress fibers and the formation of podosomes. A7r5 cells were either unstimulated (top) or treated with 5 µM PDBu for 30 min (middle). Cells were subsequently fixed and stained for actin (red) and cortactin (green) to locate podosomes. Cells cotransfected with a cDNA construct encoding the constitutively active c-Src (SrcYF) and enhanced green fluorescent protein (EGFP)--actin for 24 h (bottom). Cells were stained with antibodies to cortactin (red) or EGFP (green). EGFP--actin was used to identify Src-transfected cells and labeling of the actin fibers. Insets show an enlargement of a selected area of the cell to illustrate colocalization of actin and cortactin in podosomes. B: quantitative analyses for the effects of Src inhibitor SU-6656 and expression of Src constructs on podosome formation. A7r5 cells were treated with either 0.5 µM SU-6656 for 16 h or 1 µM bisindolylmaleimide I (BIM) for 30 min before stimulation with 5 µM PDBu for 30 min. Overexpression of wild-type c-Src (SrcWT), dominant negative c-Src (SrcKR), or constitutively activated c-Src (SrcYF) was achieved by transfection of cells with plasmids encoding c-Src for 24 h before inhibition and/or stimulation. Podosomes were visualized by staining for F-actin, and c-Src-transfected cells were identified by staining for c-Src. Data represent 3 independent experiments and are expressed as means (SD). *P < 0.01 as determined by Student's t-test.

siRNA knockdown of cortactin inhibits podosome formation induced by PDBu. As we have demonstrated, it is clear that PKC-mediated Src kinase activity is crucial in podosome formation in A7r5 cells, and cortactin, the major substrate of Src, is always present in the actin columns of the podosomes. Cortactin binds Arp2/3 and actin filaments to promote and stabilize actin branching in cell peripheries of motile cells (41, 46) and interacts with N-WASp at sites of active actin polymerization (29, 30). It is not surprising that podosomes, being a crucial part of the cell migration and invasion process, contain cortactin in all cell types studied so far (26). Although Tyr phosphorylation of cortactin has been shown to increase in podosomes, it remains unclear how phosphorylation of cortactin may contribute to the formation, stability, and turnover of podosomes, and it has not been clearly demonstrated whether cortactin is in fact required for podosome formation. To examine whether cortactin is required for podosome formation, we studied the effect of knocking down cortactin expression by siRNA on podosome formation induced by PDBu. We generated four siRNAs targeted to different regions of cortactin; two of the siRNAs were effective in knocking down cortactin expression. Transfection of A7r5 cells with siRNA169, targeting nucleotides 169 to 188 of cortactin, produced the best knockdown efficiency, as shown in Fig. 2A. We routinely observed a 60% reduction of cortactin expression in the siRNA169-transfected cells compared with the mock-transfected cells. The mismatched siRNA169m, on the other hand, produced 20% knockdown. To assess the effects of cortactin knockdown on podosome formation, we examined individual cells using immunofluorescence microscopy, as shown in Fig. 2, B and C. siRNA169 knockdown of cortactin significantly decreased the propensity of cells to form podosomes and the level of cortactin knockdown correlated with the degree of inhibition of podosome formation. These results suggest that cortactin is essential in PDBu-mediated smooth muscle podosome formation.

View larger version (49K): [in this window] [in a new window]   Fig. 2. Knockdown of cortactin expression by siRNA disrupts podosome formation. A: A7r5 cells were transfected with 0.5 µg (56 nM) of cortactin siRNA169, mismatched siRNA169m, or transfection reagent alone (mock). Cells were lysed, and Western blot analysis was performed on whole cell lysates, as described in MATERIALS AND METHODS, by using antibodies generated against cortactin (top). Blots were reprobed without striping with anti--actin antibodies (bottom) as a loading control. B and C: A7r5 cells were cotransfected with 0.5 µg (56 nM) of cortactin siRNA (B) or mismatched control (C) and a plasmid encoding EGFP--actin for a marker of transfected cells. Cells were stimulated with 5 µM PDBu for 60 min at 48 h posttransfection and stained for actin and cortactin. *Transfected cells.

View larger version (68K): [in this window] [in a new window]   Fig. 3. Tyrosine (Tyr) phosphorylation of cortactin is stimulated by PDBu treatment in a Src kinase-dependent manner. A: A7r5 cells were transfected with wild-type (SrcWT), constitutively active (SrcYF), or kinase-dead (SrcKR) constructs of c-Src or control plasmid for 24 h before stimulation with 5 µM PDBu for 30 min. Cells were lysed, and the cortactin was immunoprecipitated (IP) with anti-cortactin antibodies as described in MATERIALS AND METHODS. The Western blot (top) was first probed with antibodies against pY421, stripped and probed with anti-pY466 antibodies, and then stripped a second time and reprobed with anti-cortactin antibodies. A separate blot (bottom) was probed with antibodies against general phosphorylated Tyr (pY) and then stripped and reprobed with anti-cortactin antibodies. B: A7r5 cells treated with 5 µM PDBu for 0–30 min (as indicated). Cells were lysed, endogenous cortactin was immunoprecipitated with anti-cortactin antibodies, and the immunoprecipitates were subjected to immunoblot (IB) analysis. C: A7r5 cells were pretreated with 10 nM BIM, the PKC kinase inhibitor, for 30 min or with 0.5 µM SU-6656, the Src kinase inhibitor, for 16 h, followed by application of 5 µM PDBu for 30 min. Cells were lysed and cortactin was immunoprecipitated. Western blot analysis of the immunoprecipitates was performed with antibodies specific to pY421, then pY466, then total pY, and finally, a general cortactin antibody. Membranes were stripped before reprobing.

Although there is a positive correlation between Tyr phosphorylation of cortactin and podosome formation, it is not clear how an increase in Tyr phosphorylation of cortactin may play a role in podosome formation and/or turnover. To this end, we first examined whether phosphorylation of cortactin at Y421 and Y466 was present in podosomes. As shown in Fig. 4, in serum-stimulated A7r5 cells both pY421 and pY466 cortactin were distributed throughout the cytosol, at the periphery of the cell, and at the end of stress fibers (Fig. 4A). After PDBu treatment, both pY421 and pY466 cortactin were found localized to podosomes (Fig. 4, B and C).

View larger version (82K): [in this window] [in a new window]   Fig. 4. Tyr-phosphorylated cortactin localizes to PDBu-induced podosomes. Untreated A7r5 cells (A) or cells treated with 5 µM PDBu for 30 min (B and C) were immunostained for pY421 cortactin (B) and pY466 cortactin (C) by using phosphorylation site-specific antibodies (green), F-actin (red), and either total cortactin (pan cortactin; blue) or total phosphotyrosine (pan pY; blue), as indicated. In overlays, the brightness of the entire red channel was linearly reduced to better show the colocalization between the relatively intense red channel and faint green and blue channels.

View larger version (28K): [in this window] [in a new window]   Fig. 5. Cortactin localization to podosomes is not dependent on phosphorylation by Src. A7r5 cells transfected with plasmids encoding Myc-tagged Y421/466/482F cortactin cDNA were treated with 5 µM PDBu for 30 min. Cells expressing Y421/466/482F cortactin were visualized using staining with an anti-Myc antibody (blue), and F-actin was visualized with rhodamine-labeled phalloidin (red). pY421 cortactin (A) and pY466 cortactin (B) were labeled using phosphorylation site-specific antibodies (green).

View larger version (46K): [in this window] [in a new window]   Fig. 6. Expressed YF and YD cortactin mutants are coincidently localized in podosomes. A7r5 cells were transfected with cDNA constructs encoding Flag-tagged YF and corresponding Myc-tagged YD mutant cortactin and subsequently treated with 5 µM PDBu for 30 min. Cells were fixed and stained for actin (red), Flag (green), and Myc (blue).

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

Podosome formation can be induced by either Src or phorbol ester, and cross talk between the Src and PKC pathways appears to exist in the induction of actin cytoskeleton reorganization in vascular smooth muscle cells (2). It appears that c-Src may act either upstream (36) or downstream of PKC signaling (2, 4, 15). Although PKC has been shown to activate c-Src directly by phosphorylating it in vitro (35), recent data suggested that PKC activates Src kinase activity indirectly by phosphorylating the actin filament-associated protein AFAP-110, which in turn activates Src kinase activity, leading to actin reorganization (15). It has been shown that downstream substrates of Src involved in podosome formation include cortactin (15) and/or p190RhoGAP (2), which is able to elicit disassembly of stress fibers by inactivating Rho.

The objectives of this study were to establish whether PKC acts upstream or downstream of Src and to examine the effect of Tyr phosphorylation of the downstream effector of Src, cortactin, in podosome formation in vascular smooth muscle cells. We have demonstrated in this study that PKC induces podosome formation in A7r5 cells by activating Src. This was supported by our observations that 1) PDBu or constitutively active SrcYF, but not kinase-dead SrcKR, induces podosome formation; 2) either the specific inhibitor of Src SU-6656 or the kinase-dead SrcKR inhibits PDBu-induced podosome formation, indicating that PKC acts upstream of Src kinase; and 3) the PKC inhibitor BIM does not affect SrcYF-induced podosome formation as would be expected if Src is downstream of PKC.

Cortactin is known to be associated with F-actin and involved in Arp2/3-dependent actin polymerization, and cortactin has been localized to podosomes in all cell types studied so far (24, 39, 41, 44). However, it is not clear how cortactin may regulate podosome formation and/or turnover. To this end, we have established that cortactin is indeed required for podosome formation by showing that siRNA knockdown of cortactin expression inhibits PDBu-induced podosome formation in A7r5 cells. Our data demonstrated for the first time that disruption of cortactin expression by siRNA is able to block the initiation of podosomes, thus supporting the notion that cortactin is required for podosome formation. Interestingly, another SH3 domain-containing Src substrate has been shown to be required for the formation of podosomes in Src-transformed fibroblasts and several types of invasive cancer cells (37). Seals et al. (37) showed that reduction of the levels of the scaffolding protein Tsk5/Fish by shRNA or siRNA prevents both podosome formation and subsequent extracellular matrix degradation. These data together suggest that the SH3 domains of proteins such as cortactin and Tsk5/Fish are required for the recruitment and organization of signaling molecules to areas of the cell where podosomes are formed.

It is clear from our data and that of others that Src kinase activity is essential in the biogenesis of podosomes and that cortactin is the dominant substrate of Src; it remains an enigma, however, how Tyr phosphorylation of cortactin by Src may affect podosome biogenesis or actin reorganization in cell peripheries in actively moving cells. Tyr-phosphorylated cortactin has been shown to be enriched in podosomes of v-Src-transformed fibroblasts (18), but pTyr is not present in PDBu-induced podosomes in A7r5 cells (16). In the present study, we have shown that either PDBu or expression of constitutively activated SrcYF is sufficient to induce podosome formation with concomitant increase in phosphorylation of cortactin at Y421 and Y466. Treatment of PKC inhibitor or Src inhibitor significantly reduces the levels of PDBu-stimulated cortactin Tyr phosphorylation, indicating that PKC-mediated increase in Src kinase activity is essential for cortactin phosphorylation during podosome formation. However, we have shown clearly that cortactin was translocated to PDBu-induced podosomes irrespective of its phosphorylated status by using Y421/466/482F or Y421/466/482D triple mutants and Y421F/D or Y466F/D single mutants. This unexpected result suggests that phosphorylation of cortactin at Y421 and Y466 by Src plays little role in the targeting of cortactin to the podosomes. Because endogenously Tyr-phosphorylated cortactin appears to be enriched in podosomes (16) and Tyr phosphorylation of cortactin has a decreased ability to bind F-actin and to activate Arp2/3 complex (10, 19), it seems likely that Src phosphorylation of cortactin plays a role in regulating the turnover rate of actin bundles at the core of the podosomes. In addition, phosphorylation of cortactin by Src may occur predominantly after its translocation to podosomes, which have been shown to contain both PKC and Src (15).

In summary, we have shown that cortactin is indispensable for the formation of podosomes in A7r5 vascular smooth muscle cells. Although Tyr phosphorylation of cortactin is enhanced in response to PDBu, it is not required for podosome formation. PDBu-stimulated Tyr phosphorylation of cortactin likely contributed to actin depolymerization or, alternatively, resulted from actin depolymerization, which reflects the dynamic nature of podosomes.

	GRANTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
This work was supported by grants from Canadian Institutes of Health Research and Heart and Stroke Foundation of Canada (to A. S. Mak). B. A. Webb was supported by an Ontario Graduate Doctoral Scholarship.

	ACKNOWLEDGMENTS

 
We thank Dr. A. Kapus for providing plasmids encoding various cortactin constructs and Dr. B. Elliot for c-Src constructs. Lilly Jia is gratefully acknowledged for technical assistance. The Protein Function Discovery Facility is gratefully acknowledged for use of the imaging facilities.

	FOOTNOTES

 

Address for reprint requests and other correspondence: A. S. Mak, Dept. of Biochemistry, Queen's Univ., Kingston, ON, Canada K7L 3N6 (e-mail: maka{at}post.queensu.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

	REFERENCES

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
1. Amato PA, Unanue ER, and Taylor DL. Distribution of actin in spreading macrophages: a comparative study on living and fixed cells. J Cell Biol 96: 750–761, 1983.[Abstract/Free Full Text]

2. Brandt D, Gimona M, Hillmann M, Haller H, and Mischak H. Protein kinase C induces actin reorganization via a Src- and Rho-dependent pathway. J Biol Chem 277: 20903–20910, 2002.[Abstract/Free Full Text]

3. Brandt DT, Goerke A, Heuer M, Gimona M, Leitges M, Kremmer E, Lammers R, Haller H, and Mischak H. Protein kinase C induces Src kinase activity via activation of the protein tyrosine phosphatase PTP. J Biol Chem 278: 34073–34078, 2003.[Abstract/Free Full Text]

4. Bruce-Staskal PJ and Bouton AH. PKC-dependent activation of FAK and src induces tyrosine phosphorylation of Cas and formation of Cas-Crk complexes. Exp Cell Res 264: 296–306, 2001.[CrossRef][ISI][Medline]

5. Burgstaller G and Gimona M. Actin cytoskeleton remodelling via local inhibition of contractility at discrete microdomains. J Cell Sci 117: 223–231, 2004.[Abstract/Free Full Text]

6. Burns S, Thrasher AJ, Blundell MP, Machesky L, and Jones GE. Configuration of human dendritic cell cytoskeleton by Rho GTPases, the WAS protein, and differentiation. Blood 98: 1142–1149, 2001.[Abstract/Free Full Text]

7. Craig AW, Zirngibl R, Williams K, Cole LA, and Greer PA. Mice devoid of fer protein-tyrosine kinase activity are viable and fertile but display reduced cortactin phosphorylation. Mol Cell Biol 21: 603–613, 2001.[Abstract/Free Full Text]

8. Daly RJ. Cortactin signalling and dynamic actin networks. Biochem J 382: 13–25, 2004.[CrossRef][ISI][Medline]

9. Destaing O, Saltel F, Geminard JC, Jurdic P, and Bard F. Podosomes display actin turnover and dynamic self-organization in osteoclasts expressing actin-green fluorescent protein. Mol Biol Cell 14: 407–416, 2003.[Abstract/Free Full Text]

10. Dudek SM, Birukov KG, Zhan X, and Garcia JG. Novel interaction of cortactin with endothelial cell myosin light chain kinase. Biochem Biophys Res Commun 298: 511–519, 2002.[CrossRef][ISI][Medline]

11. Dudek SM, Jacobson JR, Chiang ET, Birukov KG, Wang P, Zhan X, and Garcia JG. Pulmonary endothelial cell barrier enhancement by sphingosine 1-phosphate: roles for cortactin and myosin light chain kinase. J Biol Chem 279: 24692–24700, 2004.[Abstract/Free Full Text]

12. Fan L, Ciano-Oliveira C, Weed SA, Craig AW, Greer PA, Rotstein OD, and Kapus A. Actin depolymerization-induced tyrosine phosphorylation of cortactin: the role of Fer kinase. Biochem J 380: 581–591, 2004.[CrossRef][ISI][Medline]

13. Fultz ME, Li C, Geng W, and Wright GL. Remodeling of the actin cytoskeleton in the contracting A7r5 smooth muscle cell. J Muscle Res Cell Motil 21: 775–787, 2000.[CrossRef][ISI][Medline]

14. Gallet C, Rosa JP, Habib A, Lebret M, Levy-Toledano S, and Maclouf J. Tyrosine phosphorylation of cortactin associated with Syk accompanies thromboxane analogue-induced platelet shape change. J Biol Chem 274: 23610–23616, 1999.[Abstract/Free Full Text]

15. Gatesman A, Walker VG, Baisden JM, Weed SA, and Flynn DC. Protein kinase C activates c-Src and induces podosome formation via AFAP-110. Mol Cell Biol 24: 7578–7597, 2004.[Abstract/Free Full Text]

16. Gimona M, Kaverina I, Resch GP, Vignal E, and Burgstaller G. Calponin repeats regulate actin filament stability and formation of podosomes in smooth muscle cells. Mol Biol Cell 14: 2482–2491, 2003.[Abstract/Free Full Text]

17. Hai CM, Hahne P, Harrington EO, and Gimona M. Conventional protein kinase C mediates phorbol-dibutyrate-induced cytoskeletal remodeling in A7r5 smooth muscle cells. Exp Cell Res 280: 64–74, 2002.[CrossRef][ISI][Medline]

18. Head JA, Jiang D, Li M, Zorn LJ, Schaefer EM, Parsons JT, and Weed SA. Cortactin tyrosine phosphorylation requires Rac1 activity and association with the cortical actin cytoskeleton. Mol Biol Cell 14: 3216–3229, 2003.[Abstract/Free Full Text]

19. Huang C, Liu J, Haudenschild CC, and Zhan X. The role of tyrosine phosphorylation of cortactin in the locomotion of endothelial cells. J Biol Chem 273: 25770–25776, 1998.[Abstract/Free Full Text]

20. Huang C, Ni Y, Wang T, Gao Y, Haudenschild CC, and Zhan X. Down-regulation of the filamentous actin cross-linking activity of cortactin by Src-mediated tyrosine phosphorylation. J Biol Chem 272: 13911–13915, 1997.[Abstract/Free Full Text]

21. Huang J, Asawa T, Takato T, and Sakai R. Cooperative roles of Fyn and cortactin in cell migration of metastatic murine melanoma. J Biol Chem 278: 48367–48376, 2003.[Abstract/Free Full Text]

22. Hung W and Elliott B. Co-operative effect of c-Src tyrosine kinase and Stat3 in activation of hepatocyte growth factor expression in mammary carcinoma cells. J Biol Chem 276: 12395–12403, 2001.[Abstract/Free Full Text]

23. Kapus A, Di Ciano C, Sun J, Zhan X, Kim L, Wong TW, and Rotstein OD. Cell volume-dependent phosphorylation of proteins of the cortical cytoskeleton and cell-cell contact sites. The role of Fyn and FER kinases. J Biol Chem 275: 32289–32298, 2000.[Abstract/Free Full Text]

24. Kaverina I, Stradal TE, and Gimona M. Podosome formation in cultured A7r5 vascular smooth muscle cells requires Arp2/3-dependent de-novo actin polymerization at discrete microdomains. J Cell Sci 116: 4915–4924, 2003.[Abstract/Free Full Text]

25. Kimes BW and Brandt BL. Characterization of two putative smooth muscle cell lines from rat thoracic aorta. Exp Cell Res 98: 349–366, 1976.[CrossRef][ISI][Medline]

26. Linder S and Aepfelbacher M. Podosomes: adhesion hot-spots of invasive cells. Trends Cell Biol 13: 376–385, 2003.[CrossRef][ISI][Medline]

27. Lopez I, Duprez V, Melle J, Dreyfus F, Levy-Toledano S, and Fontenay-Roupie M. Thrombopoietin stimulates cortactin translocation to the cytoskeleton independently of tyrosine phosphorylation. Biochem J 356: 875–881, 2001.[CrossRef][ISI][Medline]

28. Marchisio PC, Cirillo D, Naldini L, Primavera MV, Teti A, and Zambonin-Zallone A. Cell-substratum interaction of cultured avian osteoclasts is mediated by specific adhesion structures. J Cell Biol 99: 1696–1705, 1984.[Abstract/Free Full Text]

29. Martinez-Quiles N, Ho HY, Kirschner MW, Ramesh N, and Geha RS. Erk/Src phosphorylation of cortactin acts as a switch on-switch off mechanism that controls its ability to activate N-WASP. Mol Cell Biol 24: 5269–5280, 2004.[Abstract/Free Full Text]

30. Mizutani K, Miki H, He H, Maruta H, and Takenawa T. Essential role of neural Wiskott-Aldrich syndrome protein in podosome formation and degradation of extracellular matrix in src-transformed fibroblasts. Cancer Res 62: 669–674, 2002.[Abstract/Free Full Text]

31. Moreau V, Tatin F, Varon C, and Genot E. Actin can reorganize into podosomes in aortic endothelial cells, a process controlled by Cdc42 and RhoA. Mol Cell Biol 23: 6809–6822, 2003.[Abstract/Free Full Text]

32. Nitsch L, Gionti E, Cancedda R, and Marchisio PC. The podosomes of Rous sarcoma virus transformed chondrocytes show a peculiar ultrastructural organization. Cell Biol Int Rep 13: 919–926, 1989.[CrossRef][ISI][Medline]

33. Okamura H and Resh MD. p80/85 cortactin associates with the Src SH2 domain and colocalizes with v-Src in transformed cells. J Biol Chem 270: 26613–26618, 1995.[Abstract/Free Full Text]

34. Pfaff M and Jurdic P. Podosomes in osteoclast-like cells: structural analysis and cooperative roles of paxillin, proline-rich tyrosine kinase 2 (Pyk2) and integrin V3. J Cell Sci 114: 2775–2786, 2001.[Abstract/Free Full Text]

35. Purchio AF, Shoyab M, and Gentry LE. Site-specific increased phosphorylation of pp60v-src after treatment of RSV-transformed cells with a tumor promoter. Science 229: 1393–1395, 1985.[Abstract/Free Full Text]

36. Qureshi SA, Joseph CK, Rim M, Maroney A, and Foster DA. v-Src activates both protein kinase C-dependent and independent signaling pathways in murine fibroblasts. Oncogene 6: 995–999, 1991.[ISI][Medline]

37. Seals DF, Azucena EF, Pass I, Tesfay L, Gordon R, Woodrow M, Resau JH, and Courtneidge SA. The adaptor protein Tks5/Fish is required for podosome formation and function, and for the protease-driven invasion of cancer cells. Cancer Cell 7: 155–165, 2005.[CrossRef][ISI][Medline]

38. Tarone G, Cirillo D, Giancotti FG, Comoglio PM, and Marchisio PC. Rous sarcoma virus-transformed fibroblasts adhere primarily at discrete protrusions of the ventral membrane called podosomes. Exp Cell Res 159: 141–157, 1985.[CrossRef][ISI][Medline]

39. Uruno T, Liu J, Zhang P, Fan Y, Egile C, Li R, Mueller SC, and Zhan X. Activation of Arp2/3 complex-mediated actin polymerization by cortactin. Nat Cell Biol 3: 259–266, 2001.[CrossRef][ISI][Medline]

40. Vidal C, Geny B, Melle J, Jandrot-Perrus M, and Fontenay-Roupie M. Cdc42/Rac1-dependent activation of the p21-activated kinase (PAK) regulates human platelet lamellipodia spreading: implication of the cortical-actin binding protein cortactin. Blood 100: 4462–4469, 2002.[Abstract/Free Full Text]

41. Weaver AM, Karginov AV, Kinley AW, Weed SA, Li Y, Parsons JT, and Cooper JA. Cortactin promotes and stabilizes Arp2/3-induced actin filament network formation. Curr Biol 11: 370–374, 2001.[CrossRef][ISI][Medline]

42. Webb BA, Eves R, Crawley SW, Zhou S, Cote GP, and Mak AS. PAK1 induces podosome formation in A7r5 vascular smooth muscle cells in a PAK-interacting exchange factor-dependent manner. Am J Physiol Cell Physiol 289: C898–C907, 2005.[Abstract/Free Full Text]

43. Weed SA and Parsons JT. Cortactin: coupling membrane dynamics to cortical actin assembly. Oncogene 20: 6418–6434, 2001.[CrossRef][ISI][Medline]

44. Weed SA, Karginov AV, Schafer DA, Weaver AM, Kinley AW, Cooper JA, and Parsons JT. Cortactin localization to sites of actin assembly in lamellipodia requires interactions with F-actin and the Arp2/3 complex. J Cell Biol 151: 29–40, 2000.[Abstract/Free Full Text]

45. Wu H and Parsons JT. Cortactin, an 80/85-kilodalton pp60src substrate, is a filamentous actin-binding protein enriched in the cell cortex. J Cell Biol 120: 1417–1426, 1993.[Abstract/Free Full Text]

46. Wu H, Reynolds AB, Kanner SB, Vines RR, and Parsons JT. Identification and characterization of a novel cytoskeleton-associated pp60src substrate. Mol Cell Biol 11: 5113–5124, 1991.[Abstract/Free Full Text]

This article has been cited by other articles:

				A. Dorfleutner, Y. Cho, D. Vincent, J. Cunnick, H. Lin, S. A. Weed, C. Stehlik, and D. C. Flynn Phosphorylation of AFAP-110 affects podosome lifespan in A7r5 cells J. Cell Sci., July 15, 2008; 121(14): 2394 - 2405. [Abstract] [Full Text] [PDF]

				L. I. Cosen-Binker and A. Kapus Cortactin: The Gray Eminence of the Cytoskeleton. Physiology, October 1, 2006; 21(5): 352 - 361. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 290/2/C463    most recent 00350.2005v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (8) Citing Articles via Google Scholar Google Scholar Articles by Zhou, S. Articles by Mak, A. S. Search for Related Content PubMed PubMed Citation Articles by Zhou, S. Articles by Mak, A. S.