Am J Physiol Cell Physiol Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 290: C433-C443, 2006. First published September 14, 2005; doi:10.1152/ajpcell.00135.2005
0363-6143/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/2/C433    most recent
00135.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (20)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kuwano, Y.
Right arrow Articles by Rokutan, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kuwano, Y.
Right arrow Articles by Rokutan, K.

RECEPTORS AND SIGNAL TRANSDUCTION

Interferon-{gamma} activates transcription of NADPH oxidase 1 gene and upregulates production of superoxide anion by human large intestinal epithelial cells

Yuki Kuwano,1 Tsukasa Kawahara,1 Hironori Yamamoto,2 Shigetada Teshima-Kondo,3 Kumiko Tominaga,3 Kiyoshi Masuda,3 Kyoichi Kishi,1 Kyoko Morita,3 and Kazuhito Rokutan3,4

Departments of 1Nutritional Physiology, 2Clinical Nutrition, and 3Stress Science, Institute of Health Biosciences, The University of Tokushima Graduate School, Tokushima; and 4Research Institute of Science and Technology for Science, Japan Science and Technology, Tokyo, Japan

Submitted 22 March 2005 ; accepted in final form 9 September 2005


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
NADPH oxidase 1 (Nox1), a homolog of gp91phox, is dominantly expressed in large intestinal epithelium, and reactive oxygen species derived from Nox1 are suggested to serve a role in host defense. We report that interferon (IFN)-{gamma}, a crucial transactivator of the gp91phox gene, also stimulates expression of Nox1 mRNA and protein in large intestinal epithelium (T84 cells), leading to fourfold upregulation of superoxide anion (O2) generation. Introduction of small interfering Nox1 RNA completely blocked this priming. We cloned the region from –4,831 to +195 bp of the human Nox1 gene. To reveal IFN-{gamma}-responsive cis elements, we performed transient expression assays using a reporter gene driven by serially truncated Nox1 promoters in T84 cells. IFN-{gamma}-responsive elements were located between –4.3 and –2.6 kb, and one {gamma}-activated sequence (GAS) element present at –3,818 to –3,810 bp exhibited this IFN-{gamma}-dependent promoter activity. IFN-{gamma} caused tyrosine phosphorylation of signal transducer and activator of transcription 1 (STAT1) and produced a protein-GAS complex that was recognized by anti-STAT1 antibody. The introduction of three-point mutation of GAS, which did not interact with STAT1, completely canceled the IFN-{gamma}-dependent promoter activity of the region from –4,831 to +195 bp. A Janus protein tyrosine kinase 2 inhibitor (AG490) blocked the IFN-{gamma}-stimulated tyrosine phosphorylation of STAT1, promoter activity of the –4,831 to +195 bp region, Nox1 mRNA expression, and O2 production, also suggesting a crucial role of STAT1 and GAS in the IFN-{gamma}-stimulated transcription of the Nox1 gene. Our results support a potential contribution of Nox1 to mucosal host defense and inflammation in the colon.

signal transducer and activator of transcription 1; {gamma}-activated sequence; host defense


REACTIVE OXYGEN SPECIES (ROS) derived from the NADPH oxidase (Nox)/dual oxidase (Duox) family are suggested to regulate a variety of physiological and pathological processes (15, 27, 28). Among these family members, Nox1 is expressed predominantly in large intestinal epithelial cells (42) and conserves the structural domains common to the catalytic core of phagocyte NADPH oxidase (gp91phox, renamed Nox2), including the binding sites for heme, flavin, and NADPH. Nox1 requires activator 1 (NOXA1), organizer 1 (NOXO1) (3, 14, 45), p22phox (1), and small GTPase Rac1 (20, 37) for full activation of its O2-producing capability. This homolog is now recognized as an inducible O2-producing enzyme; interferon (IFN)-{gamma} (13), 1{alpha},25-dihydroxyvitamin D3 (13), or bacterial flagellin (21) induces Nox1 in large intestinal epithelium, and angiotensin II (48), prostaglandin F2{alpha} (18), or platelet-derived growth factor (18) stimulates the induction in vascular smooth muscle cells. ROS derived from the activated Nox1 regulate cell growth (2), vascular tone (29), host defense (13, 15, 21, 22), and probably transformation (6, 34, 42). However, the regulatory mechanisms for the Nox1 gene transcription remain to be elucidated.

Colon cancer cell lines (T84 and Caco-2 cells) respond to IFN-{gamma} and increase the Nox1 mRNA expression (13). IFN-{gamma} is a principal proinflammatory cytokine that modulates both innate and adaptive immunities and plays an important role in the pathogenesis of inflammatory diseases, including inflammatory bowel diseases (4). IFN-{gamma} signaling involves the types I and II IFN receptors, the receptor-associated Janus protein tyrosine kinases (JAKs), the signal transducers and activators of transcription (STATs), and members of the interferon regulatory factor (IRF) family of transcription factors (30). Ligand-induced oligomerization of the IFN receptor subunits triggers the phosphorylation and activation of JAK1 and JAK2. The activated JAKs phosphorylate the receptor on specific tyrosine residues, thereby recruiting the latent cytosolic transcription factor STAT1. Receptor-bound STAT1 is activated by phosphorylation of tyrosine- 701 by the JAKs as a prerequisite for dimerization. STAT1 homodimers translocate into the nucleus, bind to the {gamma}-activated sequence (GAS) element of IFN-{gamma}-responsive genes, and drive transcription of the genes (7).

IFN-{gamma} is a crucial regulator for transcription of the Nox2 gene (CYBB) in myeloid cells (911, 17, 32). Several transcription factors participate in the activity of the Nox2 gene promoter, which include CCAAT displacement protein (CDP) (5, 32, 41), CCAAT-binding protein-1 (CP1) (11, 32), yin yang 1 (YY1) (17), nuclear factor-Y (17), IRF-1, and IRF-2 (11, 26, 32, 33). Moreover, a member of the Ets family, PU.1, is the most important regulator specific for hematopoietic lineages (9, 10, 43). PU.1 interacts with IRF-1, IFN consensus sequence-binding protein (ICSBP), and cAMP-responsive element-binding protein (CREB)-binding protein (CBP) (9, 10). IFN-{gamma} induces the binding of PU.1 to the Nox2 promoter and stimulates this gene’s expression (9, 10, 19, 43). At the same time, STAT1 and IRF-1 together promote the IFN-{gamma}-induced transcription of the CYBB gene (26).

In contrast to Nox2, which is expressed only in myeloid cells, Nox1 has a broad tissue distribution. Consequently, various trans factors and cis elements regulate Nox1 gene transcription, depending on the particular cell type- and tissue-specific agonists involved. In this study, we present data indicating that STAT1 and the GAS element in the human Nox1 promoter play a critical role in the IFN-{gamma}-dependent transcription of Nox1 in human large intestinal epithelial cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
RT-PCR, real-time PCR, and Northern hybridization. T84 cells were cultured in Dulbecco's modified Eagle's medium (DMEM)-Ham's F-12 (1:1) medium (GIBCO, Grand Island, NY) containing 5% fetal bovine serum (FBS), 100 U/ml penicillin G, and 100 µg/ml streptomycin. Total RNA was extracted from these cells, human embryonic kidney (HEK)-293 cells, and human peripheral blood leukocytes prepared as previously described (22), using an acid guanidium-thiocynate-phenol chloroform mixture (46). RT-PCR was performed using the following specific PCR primer sets: Nox3, 5'-ACTGCCCTGACAGATGATTT-3' and 5'-CCTGCTCACTCATCCGTGTT-3, and Nox5, 5'-AACTTCTGGAAGTGGCTGCT-3' and 5'-AGGAGCACTGCTGATGGTGA-3'. The primer sets for Nox1, Nox2, Nox4, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were described previously (21). PCR was performed with the following sequential reactions: 94°C for 1 min, 55°C for 1 min, and 72°C for 2 min. Amplified PCR products were subcloned into TOPO 2.1 vector with the use of a TOPO TA cloning kit (Invitrogen, Carlsbad, CA). Each product was then sequenced to be the corresponding cDNA fragment. Levels of Nox1 and Nox3 mRNA were also measured using quantitative real-time PCR. Specific primers and probes for Nox1 (ABI Hs00246598), Nox3 (ABI Hs00210462), and GAPDH (ABI Hs99999905) were designed using the Primer Express program (Applied Biosystems, Foster City, CA). cDNA was generated from 1 µg of total RNA with Multiscribe reverse transcriptase (Applied Biosystems) using oligo(dT)/hexamer primers. Quantitative PCR was performed using the ABI 7500 (Applied Biosystems). Data were normalized for the amount of GAPDH mRNA.

Twenty micrograms of total RNA from T84 cells were run on a 1% agarose-formaldehyde gel and transferred to a nylon membrane (Hybond-N; Amersham Pharmacia, Piscataway, NJ). Membrane-bound RNA were then hybridized to a [{alpha}-32P]deoxycytidine triphosphate-labeled cDNA probe for human Nox1 as previously described (20).

Immunoblot analysis. Membrane proteins were prepared from T84 cells as previously described (21), and the level of Nox1 in the membrane fraction was measured using immunoblot analysis with a polyclonal antibody against the 544–556 amino acid residues of human Nox1 (21). Whole cell extracts were also prepared from cultured cells as described previously (47). To measure protein levels of NOXA1 and NOXO1, we prepared polyclonal anti-NOXA1 and anti-NOXO1 antibodies by immunizing rabbits with synthetic polypeptides corresponding to the 458–476 amino acid residues of human NOXA1 (GenBank accession no. AY255769) and the 348–362 amino acid residues of human NOXO1 (GenBank accession no. AY225768), respectively. NOXA1 and NOXO1 levels were measured by immunoblot analysis with these antibodies at a dilution of 1:1,000. Lamin A/C protein was measured using a 1:1,000 dilution of anti-lamin A/C antibody (Santa Cruz Biotechnology, Santa Cruz, CA) and a 1:5,000 dilution of horseradish peroxidase-conjugated anti-mouse IgG antibody (Amersham Pharmacia).

To assay phosphorylation of STAT1, we lysed cells in a lysis buffer (50 mM Tris·HCl, pH 8.0, containing 150 mM NaCl, 5 mM EDTA, 1% Nonidet P-40, 1 mM NaF, and 1 mM Na3VO4) supplemented with protease inhibitor (4 mM PMSF and 10 mM leupeptin). Cell lysates were centrifuged at 12,000 g for 10 min at 4°C, and the supernatant (30 µg of protein) was separated by SDS-PAGE using an 8% polyacrylamide gel and transferred onto a polyvinylidene difluoride membrane. After nonspecific binding sites were blocked with 4% purified milk casein, the filter was incubated for 1 h at room temperature with anti-phospho-STAT1 (tyrosine-701) antibody (Cell Signaling Technology, Beverly, MA) at a 1:1,000 dilution. After being washed with phosphate-buffered saline containing 0.05% (vol/vol) Tween 20, bound antibodies were detected using an enhanced chemiluminescence Western blotting detection system (Amersham Pharmacia). After bound antibodies were removed, the membrane was reblotted using an anti-{beta}-actin antibody as previously described (21).

RNA interference. Small interfering RNA (siRNA) duplexes, which correspond to nucleotides 1,381–1,399 from the translation start site of the human Nox1 mRNA and nucleotides 608–630 of the start site of the human lamin A/C mRNA (12), were purchased from B-Bridge International (Sunnyvale, CA). These sequences are not present in any other known mRNA according to BLAST analysis. T84 cells were plated at a concentration of 5 x 105 cells/well in 24-well culture plates and transfected with siPORT lipid (Ambion, Austin, TX) according to the manufacturer's protocol. After transfection, cells were treated with 1,000 U/ml IFN-{gamma} for 8 h. The rate of O2 release from the cells stimulated by phorbol 12-myristate 13-acetate (PMA; Sigma Chemical, St. Louis, MO) at a final concentration of 200 ng/ml was measured using the superoxide dismutase (SOD)-inhibitable reduction of cytochrome c (21).

Nox1 promoter constructs. A genomic DNA library was prepared from T84 cells, and the region between –4,831 and +195 bp of the human Nox1 gene was amplified using the following primer set: 5'-AGATCTCAATGTTGGAGTATATTTAA-3' (forward) and 5'-AAGCTTGGTTTGGAGCCCTTCTAGGC-3' (reverse); BglII and HindIII restriction sites in the forward and reverse primers, respectively, are underlined. The amplified product was used as a template to generate the shorter region between –1,946 and +195, –1,117 and +195, or –327 and +195 bp with the same reverse primer used to amplify the fragment from –4,831 to +195 bp and one of the following forward primers: 5'-AGATCTTGAAGGTTGCAGTGAAGGGAGATC-3' for –1,946 to +195 bp, 5'-AGATCTATATGTGTGACATTTGATCAACATT-3' for –1,117 to +195 bp, or 5'-AGATCTTTCTGAGCTAGCCAGGCTGAA-3' for –327 to +195 bp. The amplified products of the segments from –4,831 to +195, –1,946 to +195, –1,117 to +195, and –327 to +195 bp were ligated into a pGL3 basic vector (Promega, Madison, WI) (indicated as pGL-4831, pGL-1946, pGL-1117, and pGL-327, respectively). A mutant of GAS (indicated as pGL-4831GASmt) with a three-point mutation (–3,818 TCCAAGGGA –3,810) was prepared from pGL-4831 by PCR using a respective mutated primer.

The minimum promoter region of the herpes simplex virus-thymidine kinase (TK) gene was fused to a luciferase reporter gene of the pGL3 basic (pGL TK) vector (44). To identify functional IFN-{gamma}-responsive elements in the Nox1 5'-flank, fragments from –4,331 to –2,552, –3,120 to –2,552, –4,331 to –3,645, –3,969 to –2,552, and –3,969 to –3,645 bp of the Nox1 gene were generated by performing PCR using the following primer sets: –4,331 to –2,552 bp, 5'-GGTACCCAACCTAAAGTGTGTTACTTTAGA-3' (forward) and 5'-AAGCTTGCAGTGGTGCAATCTCGGCTCACTGCA-3' (reverse); –3,120 to –2,552 bp, 5'-GGTACCGGAGGCAGACGTTGCAGTAAGCCA-3' (forward) and 5'-AAGCTTGCAGTGGTGCAATCTCGGCTCACTGCA-3' (reverse); –4,331 to –3,645 bp, 5'-GGTACCCAACCTAAAGTGTGTTACTTTAGA-3' (forward) and 5'-AAGCTTGAGTATAGCGCAATGCACAGCACAT-3' (reverse); –3,969 to –2,552 bp, 5'-GGTACCGGAGTGGCCATGAGCATTTCTGGA-3' (forward) and 5'-AAGCTTGCAGTGGTGCAATCTCGGCTCACTGCA-3' (reverse); and –3,969 to –3,645 bp, 5'-GGTACCGGAGTGGCCATGAGCATTTCTGGA-3' (forward) and 5'-AAGCTTGAGTATAGCGCAATGCACAGCACAT-3' (reverse); Kpn1 and HindIII restriction sites in the forward and reverse primers, respectively, are underlined. All constructs were confirmed to be the corresponding fragments on the basis of DNA sequencing. These truncated fragments were subcloned into the pGL TK vector and indicated as pGL TK –4,331/–2,552, pGL TK –3,120/–2,552, pGL TK –4,331/–3,645, pGL TK –3,969/–2,552, and pGL TK –3,969/–3,645, respectively.

We also generated the pGL TK vector containing the wild-type and mutated GAS elements. Double-stranded synthetic oligonucleotides for the wild-type (sense, 5'-CAATGGCTTCCAGGAAAACTCCGGTAC-3'; antisense, 5'-CGGAGTTTTCCTGGAAGCCATTGGTAC-3') and mutated GAS (sense, 5'-CAATGGCTCCAAGGGAAACTCCGGTAC-3'; antisense, 5'-CGGAGTTTCCCTTGGAGCCATTGGTAC-3') elements were annealed and subcloned into the pGL TK vector with Kpn1 restriction sites (underlined).

Transient transfection and luciferase assay. Plasmid vectors for transfection were purified using a GenoPure plasmid midi kit (Roche Molecular Biochemicals). T84 cells (5 x 105) growing in 35-mm-diameter plastic culture dishes were transiently cotransfected with 1 µg of luciferase reporter vector and 1 µg of pCMV-{beta} plasmid (Clontech, Palo Alto, CA) using FuGene 6 transfection reagents (Roche Molecular Biochemicals) according to the manufacturer's instructions. Thirty-two hours after transfection, the cells were treated with human recombinant IFN-{gamma} (1,000 U/ml) for 6 h. Luciferase activity in the cells was measured using the Picagene luciferase assay kit (Toyo Ink, Tokyo, Japan) for 15 s with a luminometer. {beta}-Galactosidase activity was measured to standardize the transfection efficiency. Promoter activity of each construct was expressed as a ratio of luciferase to {beta}-galactosidase activity.

Electrophoretic mobility shift assay. Nuclear proteins were prepared from T84 cells as previously described (39). A double-stranded oligonucleotide for the GAS consensus binding site (–3,824 to –3,804 bp, AATGGCTTCCAGGAAAACTCC) was radiolabeled by filling in a 5' overhang with [{alpha}-32P]deoxycytidine 5'-triphosphate and Klenow fragment (New England Biolabs, Beverly, MA) and then purified using a QIAquick nucleotide removal kit (Qiagen, Chatsworth, CA). A mutated probe for the GAS site (GASmt; AATGGCTCCAAGGGAAACTCC) was used as a non-self-competitor. Protein-DNA binding reactions were performed with 5 µg of nuclear extract protein, 1 µl of 32P-labeled oligonucleotide (10,000 cpm), 1.5 µg of poly(dI-dC)·poly(dI-dC) in 10 mM Tris·HCl (pH 7.9), 50 mM NaCl, 5 mM MgCl2, 10 mM EDTA, 10 mM DTT, and 20% glycerol in a final volume of 10 µl. After being incubated at room temperature for 30 min, protein-DNA complexes were resolved on a 5% nondenaturing polyacrylamide gel in 0.5x Tris-borate-EDTA buffer at 4°C. The dried gel was exported to X-ray film (Kodak, Rochester, NY). For self-competition experiments, the nuclear protein was incubated with the unlabeled double-stranded oligonucleotide for 20 min at room temperature before addition of the 32P-labeled probe. Antibody perturbation experiments were performed by preincubating nuclear proteins with 1 µg of anti-STAT1 9H2 monoclonal antibody for 30 min at 4°C before adding the 32P-labeled probe.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Induction of Nox1 after treatment with IFN-{gamma} in cultured large intestinal epithelial cells. T84 cells were treated with different concentrations of IFN-{gamma} for 12 h, and the rates of PMA-stimulated O2 production and Nox1 induction were measured. As shown in Fig. 1A, 100 U/ml or higher concentrations of IFN-{gamma} elicited a significant increase in PMA-stimulated O2 generation by the cells in association with elevation of the Nox1 protein level (Fig. 1C). In response to 1,000 U/ml IFN-{gamma}, the cells upregulated O2 production within 8 h (Fig. 1B), coinciding with the induction of Nox1 protein (Fig. 1D). Real-time PCR demonstrated that T84 cells increased the Nox1 mRNA level within 4 h of IFN-{gamma} treatment, and the level continued to be elevated for 12–24 h (Fig. 1E), with these results being confirmed by Northern hybridization (Fig. 1F). Inclusion of actinomycin D completely blocked the IFN-{gamma}-stimulated Nox1 mRNA expression (Fig. 1F).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 1. Effects of interferon (IFN)-{gamma} on O2 production and NADPH oxidase 1 (Nox1) expression in large intestinal epithelial cells. A and B: after T84 cells were treated with IFN-{gamma} at the indicated concentrations for 8 h (A) or exposed to 1,000 U/ml IFN-{gamma} for the indicated times (B), O2 generation by these cells stimulated by PMA (200 ng/ml) was measured using the cytochrome c method. Values are means (SD), n = 8. #P < 0.01, significantly increased compared with untreated control cells (ANOVA and Scheffé's test). C and D: membrane proteins were prepared from T84 cells treated with the indicated concentrations of IFN-{gamma} for 8 h (C) or with 1,000 U/ml IFN-{gamma} for the indicated hours (D). Nox1 and {beta}-actin levels in the membrane fractions were measured by immunoblot analysis. The level of Nox1 protein after the indicated treatment with IFN-{gamma} was compared with that of untreated control cells (indicated as 0). Values are means (SD), n = 4. #P < 0.01, significantly increased compared with untreated cells (from ANOVA and Scheffé's test). Blots at bottom show representative results in 4 independent experiments. E and F: total RNA was also extracted from the cells treated with 1,000 U/ml IFN-{gamma} for the indicated hours in the absence or presence of 5 µM actinomycin D. The levels of Nox1 and GAPDH mRNA were measured using real time-PCR (E) or Northern hybridization (F). The change in Nox1 mRNA levels after the treatment was normalized to the amount of GAPDH mRNA. Values in E are means (SD), n = 4. #P < 0.01, significantly increased compared with untreated control cells (ANOVA and Scheffé's test).

 
IFN-{gamma} did not change the level of mRNA for p22phox, NOXA1, or Rac1 (data not shown), each of which is constitutively expressed by T84 cells (21). We further examined the effects of IFN-{gamma} on the levels of NOXA1 and NOXO1 proteins. IFN-{gamma} did not change the NOXA1 level (Fig. 2A), whereas it induced a small amount of NOXO1 protein (Fig. 2B). To correctly assess the specificity of the antibody against NOXA1 or NOXO1, we overexpressed these two proteins in COS-7 cells (21). Using these cells as a positive control, we confirmed the specificity of anti-NOXA1 (Fig. 2C) or anti-NOXO1 antibody (Fig. 2D) by performing the absorption test with the corresponding antigen peptide.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2. Effects of IFN-{gamma} on Nox activator 1 (NOXA1) and Nox organizer 1 (NOXO1) levels. Whole cell proteins were prepared from T84 cells after treatment with 1,000 U/ml IFN-{gamma} for the indicated hours, and the levels of NOXA1 (A) and NOXO1 (B) were measured using immunoblotting with anti-NOXA1 and anti-NOXO1 antibodies, respectively. To assess the specificity of each antibody correctly, COS-7 cells were transfected with full-length NOXA1 and NOXO1 cDNA as previously described (21). Whole cell proteins were prepared from these cells and subjected to immunoblotting. A 50 molar excess amount of the corresponding antigen peptide (Ag) completely absorbed the immunoreactivity of NOXA1 (C) or NOXO1 (D).

 
We also examined the effect of IFN-{gamma} on expression of the other Nox protein family members. T84 cells did not constitutively express mRNA for Nox2 (Fig. 3A), Nox4 (Fig. 3B), and Nox5 (Fig. 3C), and they did not do so after IFN-{gamma} stimulation. Although the Nox3 mRNA could be amplified by performing RT-PCR at 35 cycles (Fig. 3D), real-time PCR showed that the transcript level remained at lower levels after treatment with IFN-{gamma} (Fig. 3E).



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 3. Participation of Nox family members in IFN-{gamma}-stimulated O2 generation. A–D: T84 cells were left untreated or treated with 1,000 U/ml IFN-{gamma} for the indicated hours, and then total RNA was extracted from these cells. Expression of mRNA for Nox2 (A), Nox4 (B), Nox5 (C), and Nox3 (D) was detected using RT-PCR. The number of PCR cycles is 35. Human peripheral blood leukocytes were used as a positive control for Nox2 (phagocyte NADPH oxidase) and Nox5 (a lymphocyte NADPH oxidase), and HEK-293 cells were used as a positive control for Nox3 and Nox4. E: levels of the Nox3 mRNA after treatment with 1,000 U/ml IFN-{gamma} were measured using real-time PCR. Values are means (SD), n = 4. FH: T84 cells were transfected for 32 h with the indicated concentrations of double-stranded small interfering RNA (siRNA) directed against the human Nox1 mRNA sequence or with 10 nM human lamin A/C siRNA using siPORT lipid. After the transfection, these cells were left untreated or were treated with 1,000 U/ml IFN-{gamma} for 8 h. The level of Nox1 mRNA in these cells was measured using real-time-PCR (F). Values are means (SD), n = 4. #P < 0.01, significantly changed compared with untreated control cells (ANOVA and Scheffé's test). *P < 0.01, significantly decreased compared with IFN-{gamma}-stimulated Nox1 siRNA-untreated cells. The rate of PMA-stimulated O2 generation by the cells was measured as described in the legend to Fig. 1 (G and H, top). Values are means (SD), n = 8. #P < 0.05, significantly increased compared with untreated control cells (ANOVA and Scheffé's test). *P < 0.05, significantly decreased compared with IFN-{gamma}-stimulated Nox1 siRNA-untreated cells. At the same time, membrane proteins were prepared from these cells, and the levels of Nox1, {beta}-actin, and lamin A/C were measured using immunoblotting (G and H, bottom). Similar results were obtained in 3 independent experiments.

 
To confirm that Nox1 is an O2-producing enzyme responsible for the priming effect of IFN-{gamma}, we introduced human Nox1-specific siRNA into T84 cells and measured Nox1 level and PMA-stimulated O2 generation using T84 cells transfected with lamin A/C siRNA as a control. T84 cells were transfected with different concentrations of Nox1 siRNA for 48 h and then stimulated by IFN-{gamma} for 8 h. As shown in Fig. 3F, 0.1 nM or higher concentrations of Nox1 siRNA dose dependently blocked IFN-{gamma}-stimulated Nox1 mRNA expression, and 10 nM Nox1 siRNA almost completely blocked IFN-{gamma}-stimulated induction of Nox1 protein and upregulation of O2 production (Fig. 3G). The cells transfected with Nox1 siRNA did not affect the level of lamin A/C protein, and lamin A/C siRNA reduced its protein level without affecting constitutive and IFN-{gamma}-inducible levels of Nox1 (Fig. 3H). Together, these results suggest that transcriptional activation of the Nox1 gene may be crucial for the priming effect of IFN-{gamma} on O2 generation in large intestinal epithelial cells. To determine the mechanism for this transactivation, we examined IFN-{gamma}-responsive elements in the Nox1 gene.

Identification of IFN-{gamma}-responsive region in human Nox1 gene. The sequence of the cloned Nox1 gene (–4,831 to +195 bp, listed in Fig. 3) is 99.9% identical to that registered in the GenBank database (accession no. Z83819). Common consensus sequences of IFN-{gamma}-responsive elements are conserved, and a S1 nuclease protection assay confirmed the transcription start site as indicated in Fig. 4 and as previously reported (42). Therefore, we used the cloned 5'-flank in the following experiments.



View larger version (71K):
[in this window]
[in a new window]
 
Fig. 4. DNA sequence of the cloned human Nox1 gene. The entire DNA sequence of the human Nox1 gene cloned from a DNA library prepared from T84 cells is shown with nucleotide numbers at left. Putative IFN-{gamma}-responsive elements and possible cooperating elements are indicated with underlining. Bent arrow marks the transcriptional start site, and the intron 1 sequence is in lowercase.

 
The pGL3 basic luciferase reporter vector containing 1,117- and 1,946-bp proximal promoter regions of the gene, but not a 327-bp region, exhibited basal promoter activity (2- to 3-fold activation). Database searches revealed that the 5'-flank up to –1,946 bp contains no common consensus binding sites for known transcription factors responsive to IFN-{gamma}. In fact, these fragments did not respond to IFN-{gamma} (Fig. 5, top). We next focused on the more distal 5'-flanking region (–4.3 to –2.5 kb), in which binding elements for IRF-1, STAT1, and putative STAT1 coactivators, such as AP1, nuclear factor (NF)-{kappa}B, CREB, and CBP/p300 are present (Fig. 4). The full length of the cloned Nox1 5'-flanking region (–4,831 to +195 bp) transfected in T84 cells responded to IFN-{gamma} and exhibited significant promoter activity (Fig. 5, top).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 5. Identification of IFN-{gamma}-responsive region in the human Nox1 gene. Luciferase (Luc) reporter constructs containing serially truncated sequences of the 5'-flanking region of the Nox1 gene are illustrated at top left. Putative IFN-{gamma}-responsive elements are indicated at bottom left. After these constructs were cotransfected with pCMV-{beta} plasmid into T84 cells, cells were incubated without (open bars) or with 1,000 U/ml IFN-{gamma} (solid bars) for 6 h. Luciferase activities were normalized by accompanying activities of {beta}-galactosidase. Data are expressed as the multiple of increase (fold activation) over untreated cells for each construct. Values are means (SD) from 3 independent experiments.

 
On the basis of the above findings, a truncated fragment containing binding sites for IRF-1, STAT1, and NF-{kappa}B (–2,552 to –4,331 bp) was generated, and T84 cells were transfected with the reporter vector encoding this fragment. As shown in Fig. 5, bottom, the putative promoter region between –4,331 and –2,552 bp contains two IFN-{gamma}-responsive stimulated elements (IRSE) at the positions –4,115 to –4,103 bp (IRSE1) and –2,704 to –2,691 bp (IRSE2) and one GAS between –3,818 and –3,810 bp. IFN-{gamma} significantly activated the putative Nox1 promoter (pGL TK –4,331/–2,552). The removal of IRSE1 and GAS elements (pGL TK –3,120/–2,552) abolished the IFN-{gamma}-dependent promoter activity, whereas the fragment containing IRSE1 and GAS exhibited full promoter activity. The deletion of IRSE1 (pGL TK –3,969/–2,552) did not modify the full activity. Finally, we found that the region between –3,969 and –3,645 bp possessed the full promoter activity stimulated by IFN-{gamma} (Fig. 5, bottom).

Interaction between STAT1 and GAS. Phosphorylation of STAT1 at tyrosine-701 is an early and critical event for STAT1-mediated transactivation of IFN-{gamma}-responsive genes. The transcriptional activity is enhanced by the phosphorylation of serine-727 (30). Stimulation of T84 cells by IFN-{gamma} caused tyrosine phosphorylation of STAT1 (Fig. 6A). A JAK-2 tyrosine kinase inhibitor, AG490 (23), significantly inhibited the tyrosine phosphorylation (Fig. 6A).



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 6. Interaction between signal transducer and activator of transcription 1 (STAT1) and {gamma}-activated sequence (GAS). A: T84 cells were incubated with 1,000 U/ml IFN-{gamma} in the presence of the different concentrations of AG490 or vehicle (DMSO; shown as 0) for the indicated times. Equal amounts of cellular proteins (30 µg) were analyzed using immunoblotting with an antibody against tyrosine-phosphorylated STAT1 [P-Y (701) STAT1]. The blots were subsequently stripped and sequentially reprobed using an anti-STAT1 antibody (STAT1) and then an anti-{beta} actin antibody. B: nuclear proteins were extracted from T84 cells treated without or with 1,000 U/ml IFN-{gamma}. Binding reactions between 5 µg of protein of the nuclear extract and 10,000 cpm of 32P-labeled double-stranded oligonucleotide encoding the GAS were examined in the absence or presence of an excess of unlabeled GAS oligonucleotide (+, 50-fold; ++, 100-fold; +++, 150-fold excess) or a 150-fold molar excess of mutated GAS oligonucleotide (mt). C: nuclear extracts were preincubated with anti-STAT1 antibody (+, 1:25; ++, 1:50) for 1 h on ice before the 32P-labeled probe was added. Arrowhead indicates the supershifted DNA-protein complex. D: T84 cells were treated with 1,000 U/ml IFN-{gamma} for 1, 2, 4, or 8 h. Nuclear proteins were prepared from these cells and used in an electrophoretic mobility shift assay.

 
To determine whether the GAS consensus sequence (TTCCAGGAA) located at –3,818 and –3,810 bp in the 5'-flanking region was able to interact with STAT1, we synthesized a 21-bp double-stranded oligonucleotide (–3,824 to –3,804 bp; AATGGCTTCCAGGAAAACTCC) and used it as a probe for electrophoretic mobility shift assay. As shown in Fig. 6B, IFN-{gamma} generated a complex that was not found in cell lysates from cells not treated with IFN-{gamma}. Unlabeled self-oligonucleotide, but not the mutated GAS oligonucleotide (AATGGCTCCAAGGGAAACTCC), competed for formation of this complex. Moreover, preincubation with an anti-STAT1 antibody, but not mouse IgG, supershifted this band and produced a more slowly migrated band (Fig. 6C). Together, these results indicate that IFN-{gamma} produces an interaction between activated STAT1 and GAS present in the 5'-flanking region of the human Nox1 gene. After stimulation by IFN-{gamma}, the STAT1-GAS complex appeared within 1 h and continued to be present until 4 h (Fig. 6D).

Involvement of GAS element in IFN-{gamma}-dependent Nox1 promoter activity. To examine whether the GAS element exhibits IFN-{gamma}-stimulated promoter activity, we transfected T84 cells with the reporter plasmid encoding the construct from –3,824 to –3,804 bp (pGL TK GAS) or the mutated GAS construct (AATGGCTCCAAGGGAAACTCC) and compared the luciferase activity of each construct with that of the pGL TK vector alone as the control (Fig. 7A). The GAS element exerted the IFN-{gamma}-dependent promoter activity, whereas the mutated GAS did not (Fig. 7A). Furthermore, the mutated GAS nearly abolished the IFN-{gamma}-dependent activity of the full length of the cloned Nox1 promoter (–4,831 to +195 bp) (Fig. 7B). These results indicate that STAT1 and GAS may play a crucial role in transcription of the Nox1 gene in response to IFN-{gamma}.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 7. Involvement of GAS element in IFN-{gamma}-dependent Nox1 promoter activity. A: the GAS sequence (AATGGCTTCCAGGAAAACTCC) or mutated GAS sequence (AATGGCTCCAAGGGAAACTCC) was subcloned into the pGL TK vector (pGLTK GAS or pGLTK GAS mt, respectively). After cotransfection of these plasmids with pCMV-{beta} plasmid, T84 cells were treated without (open bars) or with 1,000 U/ml IFN-{gamma} (solid bars) for 6 h and then subjected to the luciferase assay as described in the legend to Fig. 5. B: T84 cells were transfected with the segment from –4,831 to +195 bp of the Nox1 gene (pGL-4831), the construct carrying the mutated GAS sequence (pGL-4831 GASmt), or pCMV-{beta} plasmid. The mutated nucleotides are underlined. These cells were incubated without (open bars) or with 1,000 U/ml IFN-{gamma} (solid bars) for 6 h and then subjected to the luciferase assay. Values are means (SD) from 3 independent experiments.

 
Effect of AG490 on IFN-{gamma}-induced transcription of Nox1 gene. We further examined the crucial role of STAT1 in the IFN-{gamma}-stimulated upregulation of O2 production by T84 cells. Pretreatment with AG490 for 1 h blocked the priming effect of IFN-{gamma} for enhanced O2 generation (Fig. 8A) and induction of the Nox1 mRNA expression (Fig. 8B) in a dose-dependent fashion. To examine the effects of AG490 on the IFN-{gamma}-stimulated Nox1 promoter activity, we transfected T84 cells with the full reporter construct (pGL-4831), treated cells with 100 µM AG490 for 1 h, and then stimulated them with IFN-{gamma} for 6 h. AG490 inhibited the phosphorylation of STAT1 (Fig. 6A) and the IFN-{gamma}-dependent Nox1 promoter activity (Fig. 8C).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 8. Effect of AG490 on IFN-{gamma}-stimulated upregulation of O2 production, Nox1 mRNA expression, and Nox1 promoter activity. A: T84 cells were incubated with 1,000 U/ml IFN-{gamma} in the presence of the different concentrations of AG490 or vehicle (DMSO) for 8 h, and the rate of O2 generation stimulated by PMA was measured. Values are means (SD), n = 8. #P < 0.05, significantly changed compared with untreated control cells. *P < 0.05, significantly changed compared with IFN-{gamma}-stimulated, AG490-untreated cells (ANOVA and Scheffé's test). B: levels of Nox1 and GAPDH mRNA were measured using real-time PCR after 8-h treatment with 1,000 U/ml IFN-{gamma} in the presence of the indicated concentrations of AG490 or vehicle (DMSO). C: T84 cells were transfected with pGL-4831 or pGL3 basic plasmid for 32 h. These cells were left untreated or were treated with 1,000 U/ml IFN-{gamma} in the presence of 100 µM AG490 or vehicle for 6 h, and their luciferase activities were measured. Values are means (SD) from 3 separate experiments. #P < 0.05, significantly decreased compared with AG480-untreated, IFN-{gamma}-stimulated cells (ANOVA and Scheffé's test).

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Produced by activated T lymphocytes and natural killer cells, IFN-{gamma} has a major role in host defense against microbial invasion. We report in this study that this cytokine induced the generation of ROS by cultured large intestinal epithelial cells. In response to IFN-{gamma}, T84 cells upregulated expression of the Nox1 mRNA and protein. Silencing of the Nox1 expression by siRNA completely blocked the IFN-{gamma}-induced production of O2 anion, indicating a pivotal role of Nox1 in this cellular response. Several lines of evidence suggest that Nox1 functions in host defense. In guinea pig gastric pit cells, Nox1 enhances O2 generation in response to Helicobacter pylori lipopolysaccharide (LPS), signaling through Toll-like receptor 4 (TLR4) (22, 46, 47). This increased oxidase activity reflects the action of LPS on several targets, including activation of Rac1 and transcription of Nox1 and its organizer, NOXO1 (20). In contrast, large intestinal epithelial cells preferentially use TLR5 for augmentation of Nox1-mediated O2 production (21). The rate of O2 generation by IFN-{gamma}-treated T84 cells accounts for only 0.5 and 5% of those by human neutrophils and macrophage colony-stimulating factor-activated mouse peritoneal macrophages (47), respectively. The amount is not enough to kill microorganisms directly, but it is enough to enhance proinflammatory cytokine production of the large intestinal epithelial cells (21). Thus Nox1 may constitute the early responses of epithelial cells against pathogens as part of local host defense. Geiszt et al. (13) suggested that Nox1 may be functionally similar to Nox2 and appears to replace Nox2 in the regulated production of O2. The evidence that IFN-{gamma} can stimulate induction of Nox1 in large intestinal epithelial cells further supports an important role in mucosal host defense. It is also probable that Nox1-derived ROS are involved in the initiation and/or potentiation of mucosal inflammation and inflammatory bowel diseases. Studies of patients and mouse models have revealed that Crohn's disease is driven by overproduction of interleukin (IL)-12, IFN-{gamma}, and TNF-{alpha} (4). ROS derived from IFN-{gamma}-activated Nox1 may be involved in the pathogenesis of TH1-mediated inflammatory diseases such as Crohn's disease. At present, it is not known whether the IFN-{gamma}-dependent activation of the Nox1 expression actually participates in mucosal host defense or inflammation. It is still possible that the findings reported in the present study may be restricted to cancer cell lines. Additional experiments are required to test the hypothesis.

The human Nox1 gene consists of 13 exons spanning ~31.49 kb of genomic DNA. IFN-{gamma} stimulates the transcription of both human Nox1 and Nox2 genes. However, the regulatory mechanism for the transcription of the Nox1 gene expressed in a wide variety of nonphagocytic cells should be distinct from that of the Nox2 gene dominantly expressed in myeloid cells. IFN-{gamma} has been proposed to regulate transcription of the Nox2 gene positively through at least three different pathways. First, BID/YY1 binds to the four binding sites in a region from –90 to –355 bp of the promoter after maturation-dependent dissociation of the transcriptional repressor CCAAT box binding protein (11, 17, 32). Second, IFN-{gamma} stimulates the binding of PU.1 or the complex hematopoietic associated factor-1 (HAF-1), consisting of PU.1, IRF-1, ICSBP, and CBP, to the PU.1/HAF-1-binding element centered at –53 bp of the promoter (7, 10, 43). Finally, STAT1 associated with the GAS element at –100 bp of the promoter (7, 26).

The Nox1 promoter lacks the PU.1/HAF-1-binding element (PU box), the mutation of which results in chronic granulomatous disease (25, 35, 43), and proximally (up to –2 kbp) does not contain any common binding sites for IFN-{gamma}-responsive transcription factors, which has been supported experimentally by its failure to respond to this cytokine. Within the 5'-flanking region of the Nox1 promoter, between –4.3 and –2.5 kb, which contains several binding motives for IFN-{gamma}-dependent transcription factors, we found that one GAS element located between –3,818 and –3,810 bp was crucial for the IFN-{gamma}-induced transcription of the Nox1 gene. IFN-{gamma} caused tyrosine phosphorylation of STAT1 and formation of the STAT1-GAS complex. The mutation of GAS almost completely abrogated the IFN-{gamma}-stimulated activation of the 4.8-kbp proximal promoter of the Nox1 gene. The importance of IFN-{gamma}-JAK-STAT1 pathway was also confirmed using a JAK2 kinase inhibitor.

STAT1 binds to the transcriptional coactivators, such as CBP, p300, p300/CBP-cointegrator protein, minichromosome maintenance-5, N-Myc-interacting protein, and breast cancer-associated gene (8, 16, 24, 36, 49). CBP and p300 serve as coactivators for many transcription factors (40). STAT1 also cooperates with both general (specificity protein-1) and inducible transcription factors (AP1, NF-{kappa}B) (31, 38). Therefore, STAT1-dependent transcriptional activation of the Nox1 gene may require the recruitment of coactivators and cooperation with general transcription factors and the core transcriptional machinery. Furthermore, TLR ligands (21, 22), IL-1{beta}, 1{alpha},25-dihydroxyvitamin D3 (13), angiotensin II (48), and possibly other mediators are able to upregulate Nox1 expression in different types of cells. Therefore, multiple trans factors and cis elements may regulate transcription of the Nox1 gene, depending on the cell type as well as the particular agonist used. Further studies are likely to reveal multiple pathways for transactivation of the Nox1 gene closely paralleling the tissue-specific function of Nox1-derived ROS.

It is now recognized that ectopic expression of Nox1 alone in cultured cells does not result in O2 production and that the coexpression of NOXO1 and NOXA1 is necessary for generation of a large amount of O2 (3, 14, 21, 45). In fact, IL-1{beta} (data not shown) and flagellin from Salmonella enteritidis (21) induce Nox1 in T84 cells, whereas both factors neither induce NOXO1 nor upregulate O2 production. In contrast, IFN-{gamma} stimulates a small but significant induction of NOXO1 as well as Nox1. To understand the biological function of IFN-{gamma} in large intestinal epithelial cells, we are now studying the mechanism for IFN-{gamma}-dependent transcription of the NOXO1 gene.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported in part by Grants-in-Aid for Scientific Research 14370184, 16017269, and 17390218 from the Japan Society for the Promotion of Science (to K. Rokutan).


    ACKNOWLEDGMENTS
 
We are grateful to Dr. William M. Nauseef (Iowa University) for critical review of this manuscript.


    FOOTNOTES
 

Address for reprint requests and other correspondence: K. Rokutan, Dept. of Stress Science, Institute of Health Biosciences, The Univ. of Tokushima Graduate School, 3-18-15 Kuramoto-cho, Tokushima 770-8503, Japan (e-mail: rokutan{at}basic.med.tokushima-u.ac.jp)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Ambasta RK, Kumar P, Griendling KK, Schmidt HH, Busse R, and Brandes RP. Direct interaction of the novel Nox proteins with p22phox is required for the formation of a functionally active NADPH oxidase. J Biol Chem 279: 45935–45941, 2004.[Abstract/Free Full Text]

2. Arnold RS, Shi J, Murad E, Whalen AM, Sun CQ, Polavarapu R, Parthasarathy S, Petros JA, and Lambeth JD. Hydrogen peroxide mediates the cell growth and transformation caused by the mitogenic oxidase Nox1. Proc Natl Acad Sci USA 98: 5550–5555, 2001.[Abstract/Free Full Text]

3. Banfi B, Clark RA, Steger K, and Krause KH. Two novel proteins activate superoxide generation by the NADPH oxidase NOX1. J Biol Chem 278: 3510–3513, 2003.[Abstract/Free Full Text]

4. Bouma G and Strober W. The immunological and genetic basis of inflammatory bowel disease. Nat Rev Immunol 3: 521–533, 2003.[CrossRef][ISI][Medline]

5. Catt D, Hawkins S, Roman A, Luo W, and Skalnik DG. Overexpression of CCAAT displacement protein represses the promiscuously active proximal gp91phox promoter. Blood 94: 3151–3160, 1999.[Abstract/Free Full Text]

6. Chamulitrat W, Schmidt R, Tomakidi P, Stremmel W, Chunglok W, Kawahara T, and Rokutan K. Association of gp91phox homolog Nox1 with anchorage-independent growth and MAP kinase-activation of transformed human keratinocytes. Oncogene 22: 6045–6053, 2003.[CrossRef][ISI][Medline]

7. Contursi C, Wang IM, Gabriele L, Gandina M, O'Shea J, Morse HC III, and Ozato K. IFN consensus sequence binding protein potentiates STAT1-dependent activation of IFN{gamma}-responsive promoter in macrophages. Proc Natl Acad Sci USA 97: 91–96, 2000.[Abstract/Free Full Text]

8. DaFonseca CJ, Shu F, and Zhang JJ. Identification of two residues in MCM5 critical for the assembly of MCM complexes and Stat1-mediated transcription activation in response to IFN-{gamma}. Proc Natl Acad Sci USA 98: 3034–3039, 2001.[Abstract/Free Full Text]

9. Eklund EA, Jalava A, and Kakar R. PU.1, interferon regulatory factor 1, and interferon consensus sequence-binding protein cooperate to increase gp91phox expression. J Biol Chem 273: 13957–13965, 1998.[Abstract/Free Full Text]

10. Eklund EA and Kakar R. Recruitment of CREB-binding protein by PU.1, IFN-regulatory factor-1, and the IFN consensus sequence-binding protein is necessary for IFN-{gamma}-induced p67phox and gp91phox expression. J Immunol 163: 6095–6105, 1999.[Abstract/Free Full Text]

11. Eklund EA, Luo W, and Skalnik DG. Characterization of three promoter elements and cognate DNA binding protein(s) necessary for IFN-{gamma} induction of gp91-phox transcription. J Immunol 157: 2418–2429, 1996.[Abstract]

12. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, and Toschl T. Duplex of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411: 494–498, 2001.[CrossRef][Medline]

13. Geiszt M, Lekstrom K, Brenner S, Hewitt SM, Dana R, Malech HL, and Leto TL. NAD(P)H oxidase 1, a product of differentiated colon epithelial cells, can partially replace glycoprotein gp91phox in the regulated production of superoxide by phagocytes. J Immunol 171: 299–306, 2003.[Abstract/Free Full Text]

14. Geiszt M, Lekstrom K, Witta J, and Leto TL. Protein homologues of p47phox and p67phox support superoxide production by NADP(H) oxidase 1 in colon epithelial cells. J Biol Chem 278: 20006–20012, 2003.[Abstract/Free Full Text]

15. Geiszt M and Leto TL. The Nox family of NAD(P)H oxidases: host defense and beyond. J Biol Chem 279: 51715–51718, 2004.[Free Full Text]

16. Horvai AE, Xu L, Korzus E, Brard G, Kalafus D, Mullen TM, Rose DW, Rosenfeld MG, and Glass CK. Nuclear integration of JAK/STAT and Ras/AP-1 signaling by CBP and p300. Proc Natl Acad Sci USA 94: 1074–1079, 1997.[Abstract/Free Full Text]

17. Jacobsen BM and Skalnik DG. YY1 binds five cis-elements and trans-activates the myeloid cell-restricted gp91phox promoter. J Biol Chem 274: 29984–29993, 1999.[Abstract/Free Full Text]

18. Katsuyama M, Fan C, Arakawa N, Nishinaka T, Miyagushi M, Taira K, and Yabe-Nishimura C. Essential role of ATF-1 in induction of NOX1, a catalytic subunit of NADPH oxidase: involvement of mitochondrial respiratory chain. Biochem J 386: 255–261, 2005.[CrossRef][ISI][Medline]

19. Kautz B, Kakar R, David E, and Eklund EA. SHP1 protein-tyrosine phosphatase inhibits gp91PHOX and p67PHOX expression by inhibiting interaction of PU.1, IRF1, interferon consensus sequence-binding protein, and CREB-binding protein with homologous cis elements in the CYBB and NCF2 genes. J Biol Chem 276: 37868–37878, 2001.[Abstract/Free Full Text]

20. Kawahara T, Kohjima M, Kuwano Y, Mino H, Teshima-Kondo S, Takeya R, Tsunawaki S, Wada A, Sumimoto H, and Rokutan K. Helicobacter pylori lipopolysaccharide activates Rac1 and transcription of NADPH oxidase Nox1 and its organizer NOXO1 in guinea pig gastric mucosal cells. Am J Physiol Cell Physiol 288: C450–C457, 2005.[Abstract/Free Full Text]

21. Kawahara T, Kuwano Y, Teshima-Kondo S, Takeya R, Sumimoto H, Kishi K, Tsunawaki S, Hirayama T, and Rokutan K. Role of nicotinamide adenine dinucleotide phosphate oxidase 1 in oxidative burst response to Toll-like receptor 5 signaling in large intestinal epithelial cells. J Immunol 172: 3051–3058, 2004.[Abstract/Free Full Text]

22. Kawahara T, Teshima S, Oka A, Sugiyama T, Kishi K, and Rokutan K. Type I Helicobacter pylori lipopolysaccharide stimulates Toll-like receptor 4 and activates mitogen oxidase 1 in gastric pit cells. Infect Immun 69: 4382–4389, 2001.[Abstract/Free Full Text]

23. Kim OS, Park EJ, Joe E, and Jou I. JAK-STAT signaling mediates gangliosides-induced inflammatory response in brain microglial cells. J Biol Chem 277: 40594–40601, 2002.[Abstract/Free Full Text]

24. Korzus E, Torchia J, Rose DW, Xu L, Kurokawa R, McInerney EM, Mullen TM, Glass CK, and Rosenfeld MG. Transcription factor-specific requirements for coactivators and their acetyltransferase functions. Science 279: 703–707, 1998.[Abstract/Free Full Text]

25. Kumatori A, Faizunnessa NN, Suzuki S, Moriuchi T, Kurozumi H, and Nakamura M. Nonhomologous recombination between the cytochrome b558 heavy chain gene (CYBB) and LINE-1 causes an X-linked chronic granulomatous disease. Genomics 53: 123–128, 1998.[CrossRef][ISI][Medline]

26. Kumatori A, Yang D, Suzuki S, and Nakamura M. Cooperation of STAT-1 and IRF-1 in interferon-{gamma}-induced transcription of the gp91phox gene. J Biol Chem 277: 9103–9111, 2002.[Abstract/Free Full Text]

27. Lambeth JD. Nox enzyme and the biology of reactive oxygen. Nat Rev Immunol 4: 181–189, 2004.[CrossRef][ISI][Medline]

28. Lambeth JD, Chang G, Arnold RS, and Edens WA. Novel homologs of gp91phox. Trends Biochem Sci 10: 459–461, 2000.

29. Lassegue B, Sorescu D, Szocs K, Yin Q, Akers M, Zhang Y, Grant SL, Lambeth JD, and Griendling KK. Novel gp91phox homologues in vascular smooth muscle cells: nox1 mediates angiotensin II-induced superoxide formation and redox-sensitive signaling pathway. Circ Res 88: 888–894, 2001.[Abstract/Free Full Text]

30. Levy DE and Darnell JE Jr. STATs: transcriptional control and biological impact. Nat Rev Mol Cell Biol 3: 651–662, 2002.[CrossRef][ISI][Medline]

31. Look DC, Pelletier MR, Tidwell RM, Roswit WT, and Holtzman MJ. Stat1 depends on transcriptional synergy with Sp1. J Biol Chem 270: 30264–30267, 1995.[Abstract/Free Full Text]

32. Luo W and Skalnik DG. CCAAT displacement protein competes with multiple transcriptional activators for binding to four sites in the proximal gp91phox promoter. J Biol Chem 271: 18203–18210, 1996.[Abstract/Free Full Text]

33. Luo W and Skalnik DG. Interferon regulatory factor-2 directs transcription from the gp91phox promoter. J Biol Chem 271: 23445–23451, 1996.[Abstract/Free Full Text]

34. Mitsushita J, Lambeth JD, and Kamata T. The superoxide-generating oxidase Nox1 is functionally required for Ras oncogene transformation. Cancer Res 64: 3580–3585, 2004.[Abstract/Free Full Text]

35. Newburger PE, Skalnik DG, Hopkins PJ, Eklund EA, and Curnutte JT. Mutations in the promoter region of the gene for gp91-phox in X-linked chronic granulomatous disease with decreased expression of cytochrome b558. J Clin Invest 94: 1205–1211, 1994.[Medline]

36. Ouchi T, Lee SW, Ouchi M, Aaronson SA, and Horvath CM. Collaboration of signal transducer and activator of transcription 1 (STAT1) and BRCA1 in differential regulation of IFN-{gamma} target genes. Proc Natl Acad Sci USA 97: 5208–5213, 2000.[Abstract/Free Full Text]

37. Park HS, Lee SH, Park D, Lee JS, Ryu SH, Lee WJ, Rhee SG, and Bae YS. Sequential activation of phosphatidylinositol 3-kinase, {beta}Pix, Rac1, and Nox1 in growth factor-induced production of H2O2. Mol Cell Biol 24: 4384–4394, 2004.[Abstract/Free Full Text]

38. Pine R. Convergence of TNF{alpha} and IFN{gamma} signalling pathways through synergistic induction of IRF-1/ISGF-2 is mediated by a composite GAS/{kappa}B promoter element. Nucleic Acids Res 25: 4346–4354, 1997.[Abstract/Free Full Text]

39. Rokutan K, Hirakawa T, Teshima S, Honda S, and Kishi K. Glutathione depletion impairs transcriptional activation of heat shock genes in primary cultures of guinea pig gastric mucosal cells. J Clin Invest 97: 2242–2250, 1996.[ISI][Medline]

40. Shikama N, Chan HM, Krstic-Demonacos M, Smith L, Lee CW, Cairns W, and La Thangue NB. Functional interaction between nucleosome assembly proteins and p300/CREB-binding protein family coactivators. Mol Cell Biol 23: 8933–8943, 2000.

41. Skalnik DG, Strauss EC, and Orkin SH. CCAAT displacement protein as a repressor of the myelomonocytic-specific gp91-phox gene promoter. J Biol Chem 266: 16736–16744, 1991.[Abstract/Free Full Text]

42. Suh YA, Arnold RS, Lassegue B, Shi J, Xu X, Sorescu D, Chung AB, Griendling KK, and Lambeth JD. Cell transformation by the superoxide-generating oxidase Mox1. Nature 401: 79–82, 1999.[CrossRef][Medline]

43. Suzuki S, Kumatori A, Haagen IA, Fujii Y, Sadat MA, Jun HL, Tsuji Y, Roos D, and Nakamura M. PU.1 as an essential activator for the expression of gp91phox gene in human peripheral neutrophils, monocytes, and B lymphocytes. Proc Natl Acad Sci USA 95: 6085–6090, 1998.[Abstract/Free Full Text]

44. Taketani Y, Segawa H, Chikamori M, Morita K, Tanaka K, Kido S, Yamamoto H, Iemori Y, Tatsumi S, Tsugawa N, Okano T, Kobayashi T, Miyamoto K, and Takeda E. Regulation of type II renal Na+-dependent inorganic phosphate transporters by 1,25-dihydroxyvitamin D3. Identification of a vitamin D-responsive element in the human NAPi-3 gene. J Biol Chem 273: 14575–14581, 1998.[Abstract/Free Full Text]

45. Takeya R, Ueno N, Kami K, Taura M, Kohjima M, Izaki T, Nunoi H, and Sumimoto H. Novel human homologues of p47phox and p67phox participate in activation of superoxide-producing NADPH oxidases. J Biol Chem 278: 25234–25246, 2003.[Abstract/Free Full Text]

46. Teshima S, Kutsumi H, Kawahara T, Kishi K, and Rokutan K. Regulation of growth and apoptosis of cultured guinea pig gastric mucosal cells by mitogenic oxidase 1. Am J Physiol Gastrointest Liver Physiol 279: G1169–G1176, 2000.[Abstract/Free Full Text]

47. Teshima S, Rokutan K, Nikawa T, and Kishi K. Guinea pig gastric mucosal cells produce abundant superoxide anion through an NADPH oxidase-like system. Gastroenterology 115: 1186–1196, 1998.[CrossRef][ISI][Medline]

48. Wingler K, Wunsch S, Kreutz R, Rothermund L, Paul M, and Schmidt HH. Upregulation of the vascular NAD(P)H-oxidase isoforms Nox1 and Nox4 by the rennin-angiotensin system in vitro and in vivo. Free Radic Biol Med 31: 1456–1464, 2001.[CrossRef][ISI][Medline]

49. Zhang JJ, Vinkemeier U, Gu W, Chakravarti D, Horvath CM, and Darnell JE Jr. Two contact regions between Stat1 and CBP/p300 in interferon gamma signaling. Proc Natl Acad Sci USA 93: 15092–15096, 1996.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
D. Gianni, B. Bohl, S. A. Courtneidge, and G. M. Bokoch
The Involvement of the Tyrosine Kinase c-Src in the Regulation of Reactive Oxygen Species Generation Mediated by NADPH Oxidase-1
Mol. Biol. Cell, July 1, 2008; 19(7): 2984 - 2994.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
A. Orient, A. Donko, A. Szabo, T. L. Leto, and M. Geiszt
Novel sources of reactive oxygen species in the human body
Nephrol. Dial. Transplant., May 1, 2007; 22(5): 1281 - 1288.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
B. Halliwell
Dietary polyphenols: Good, bad, or indifferent for your health?
Cardiovasc Res, January 15, 2007; 73(2): 341 - 347.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. Linden
Adenosine metabolism and cancer. Focus on "Adenosine downregulates DPPIV on HT-29 colon cancer cells by stimulating protein tyrosine phosphatases and reducing ERK1/2 activity via a novel pathway"
Am J Physiol Cell Physiol, September 1, 2006; 291(3): C405 - C406.