|
|
||||||||
VASCULAR BIOLOGY
1Department of Cell Biology, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma; and 2Garrison Institute on Aging and Department of Neuropsychiatry, Texas Tech University Health Sciences Center, Lubbock, Texas
Submitted 7 February 2005 ; accepted in final form 14 September 2005
| ABSTRACT |
|---|
|
|
|---|
platelet-derived growth factor; insulin-like growth factor
Although the continual presence of Ang1 is necessary for EC survival and vessel stability, the highly regulated expression of Ang2 appears to drive new blood vessel formation. Increasing the Ang1-to-Ang2 ratio appears to favor vascular stability, whereas decreasing the ratio promotes angiogenesis (22, 57). Ang2 expression occurs at the leading front of neovascular sprouts, thereby contributing to the destabilized vessel structure necessary for EC migration (52). Ang2 acts synergistically with VEGF-A to promote angiogenesis (53, 57), and the simultaneous expression of Ang2 and VEGFR-2 (KDR/Flk1) occurs during tumor-mediated activation of the host vasculature (52). Ang2 induces vascular remodeling in the presence of VEGF but EC death in the absence of VEGF (32). However, overexpression of Ang2 resulted in poor vascular formation and inhibited tumor growth (58). Blocking Ang2s association with Tie-2 in a mouse tumor model resulted in the cessation of tumor growth, as well as tumor regression in some animals (41). It was recently shown that blocking VEGF signaling in a tumor model caused a decrease in Ang2 expression and an increase in Ang1 expression, which then resulted in a transient increase in the number of patent, pericyte-coated vessels (55). In all of these cases, the ratio of Ang1 to Ang2 was found to be critical in determining the state of the tumor vasculature. An Ang2 imbalance has also been linked to nontumor vascular malformations (17) as well as to the capillary loss associated with glomerulonephritis (59). In vasculoproliferative diseases such as psoriasis, disease resolution is accompanied by a decrease in Ang2 levels (27). Thus regulating Ang2 levels is critical for the maintenance of vascular stability or the regulation of endothelial cell detachment as recently demonstrated in a three-dimensional culture model (48).
Although it is apparent that the role of Ang2 in vascular dynamics is critically important in both developmental and disease states, relatively little is known about the regulation of Ang2 expression. Ang1 expression was originally reported to be primarily constitutive (39), suggesting that changes in Ang2 expression may be an essential regulation point associated with angiogenesis and vessel stability. Factors such as hypoxia, VEGF, thrombin, TNF-
, and Sonic hedgehog increase Ang2 transcription rates in some cultured cells (21, 24, 35, 39, 45), whereas Ang1 and transforming growth factor-
1 decrease Ang2 transcription. Herein we present evidence that the Ang1-Ang2 balance can be altered significantly by a posttranscriptional Ang2 mRNA decay mechanism induced by PDGF stimulation of VSMCs. We demonstrate that PDGF-stimulated VSMCs rapidly destabilize Ang2 mRNA, leading to a decreased Ang2 protein levels, and resulting in a significant change in the balance between Ang1 and Ang2. In contrast, stimulation with IGF-I resulted in a transcription-mediated increase in Ang2 mRNA. The different responses to these two mediators of VSMC function were traced to distinct signaling pathways and demonstrate the ability of cells to regulate the angiopoietin balance by a variety of mechanisms.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-D-ribofuranoside (DRB; Sigma), 10 U0126 (Calbiochem), 15 LY-294002 (Calbiochem), 5 2,4,6-trimethyl-N-(m-3-trifluoromethylphenyl)benzenesulfonamide (m-3M3FBS, a PLC activator; Calbiochem), 2 A23187
[GenBank]
(Calbiochem), or 15 BAPTA-AM (Calbiochem). Soluble PDGF
-receptor (1 µg/ml; R&D Systems) was also used to neutralize PDGF in the medium with PDGF-stimulated cells. Semiquantitative and real-time RT-PCR. RNA was extracted using the guanidine thiocyanate method (7), modified as follows: chloroform-to-isoamyl alcohol ratio was reduced from 49:1 to 24:1, and an additional chloroform-to-isoamyl alcohol step was added before isopropanol precipitation. Total RNA was quantified using spectrophotometry and then reverse transcribed using the Superscript RT II RNase H RT (Invitrogen) protocol plus a 30-min 52°C incubation before the inactivation step. cDNA was diluted 10-fold for subsequent PCR. Semiquantitative PCR was performed using 1 U of Taq polymerase (TaKaRa) and 5 µl of cDNA per 20-µl reaction. A cycle number within the linear range of amplification was chosen for semiquantitative analysis for each primer set (Integrated DNA Technologies). PCR products were separated using agarose gel electrophoresis and stained with ethidium bromide before we performed densitometric analysis (ChemiImager 4400; Alpha Innotech). For real-time analysis, 5 µl of cDNA were added per 50 µl of real-time PCR cocktail, including SYBR Green (Bio-Rad) and 1.25 U of Taq polymerase (Invitrogen). Amplification was performed in a Bio-Rad MyIQ thermal cycler, and the comparative cycle at threshold (Ct) method (20) was used to determine relative changes in mRNA levels of both Ang2 and the control gene tissue inhibitor of metalloproteinases (TIMP)-2. The relative ratios of Ang2 to TIMP-2 were plotted using Prism version 3.02 software (GraphPad). Oligonucleotide primer sequences used in semiquantitative PCR were as follows: Ang2 forward, AGAGTATTGGCTGGGCAACGAGTT; Ang2 reverse, TCCTTTGTGCTAAAATCACTTCCT; Ang1 forward, AAATTATACTCAGTGGCTGGAA; Ang1 reverse, TTCTAGGATTTTATGCTCTAATAA; VEGF-A forward, GTATATCTTCAAGCCGTCCTGTGT; VEGF-A reverse, CTTGCAACGCGAGTCTGTGTTTTT; VEGF-D reverse, CCTGAGAGAAAAGAGCCCCAATAA; VEGF-D forward, TATGAACACAAGCACCTCCTACAT; myosin heavy chain forward, GTAGAAGGTGCTGTCAAAGCCA; myosin heavy chain reverse, AAGGAACAAATGAAGCCTCGTT; TIMP-2 forward, CGCTGGACGTTGGAGGAAAGAAGG; TIMP-2 reverse, GGGTCCTCGATGTCAAGAAACTCC; c-fos forward, ATACGTCTTCCTTTGTCTTCACCT, and c-fos reverse, GGAGAAAGAGAAAAGAGACACAGA. Oligonucleotide primer sequences used in real-time PCR were as follows: Ang2 forward, CAGCCAACCAGGAAGTGATT; Ang2 reverse, AAGTTGGAAGGACCACATGC; TIMP-2 forward, AAGGAGATGGCAAGATGCAC; and TIMP-2 reverse, TGTAGCATGGGATCATAGGG.
Heteronuclear RNA quantitation. Oligonucleotides were designed within the rat Ang2 gene on the basis of sequence comparison with the human gene. The forward primer was complementary to the 3' end of exon 6 (ATGGACATGGGTGGAGGAGGGTGGAC), and the reverse primer was made complementary to the 5' end of exon 7 (AGTGCTCATACAGAGAGTGTGCCTCG). Intron 6 was amplified and sequenced, and another set of oligonucleotides (forward, GCTTCCACAGCATAAATGTCCCTAGGA; reverse, TACTCCATTGCCCTGCTCGGTACAAAT) was designed for amplification within intron 6 of the prespliced RNA as described previously (5, 60). To estimate the transcription rate of Ang2 in PDGF-stimulated, IGF-stimulated, or nonstimulated cultures, total RNA was isolated as described above and converted to cDNA using Moloney murine leukemia virus RT (Fisher) and random hexanucleotides. cDNA was amplified using a range of cycle numbers, and PCR products were resolved on 1.5% agarose gels. Gels were denatured in 1 mol/l NaCl and 0.5 mol/l NaOH twice for 15 min and then neutralized by being soaked twice for 15 min in 0.5 mol/l Tris and 1.5 mol/l NaCl, pH 7.5. The cDNA was then transferred onto MagnaGraph nylon membranes (MSI, Westborough, MA) through wicking in 10x SSC overnight. Membranes were cross linked with UV light at 120 mJ/cm2 and then hybridized with 0.5 µg of the amplified portion of intron 6 of the Ang2 gene (MiracleHyb; Stratagene), which was labeled with 50 µCi [32P]dCTP using a nick translation kit (Amersham Biosciences). To demonstrate that this methodology measured relative transcription rates accurately, we also amplified intron 1 of c-fos, an immediate early gene known to be activated rapidly and transiently by PDGF stimulation (33). The transcription rate of c-fos was evaluated in PDGF-stimulated and nonstimulated cells. Oligonucleotide primers were similarly designed at the intron-exon boundaries of intron 1: forward, CTACTACCATTCCCCAGCCGACTC; and reverse, CTCTACTTTGCCCCTTCTGCCGAT. Intron 1 was sequenced and used to design additional primers within the intron: forward, GCGCGGTCAGAGCAGCCTTAGCCT; and reverse, AGCGGAGGTGAGCGAGGAGGTTC.
Immunoprecipitation and Western blot analysis.
Conditioned medium was collected from serum-starved VSMCs were treated with or without 25 ng/ml PDGF for 48 h. Recombinant mouse Tie2/Fc chimera (5 µg; R&D Systems) was added to the conditioned medium and rocked overnight at 4°C. Protein G slurry (30 µl, 50%; Upstate Biotechnology) was added to the conditioned medium and Tie2/Fc mixture and rocked at 4°C for 2 h. Protein G beads were pelleted using gentle centrifugation and washed six times in 1 ml of Nonidet P-40 (NP-40) wash buffer (150 mM NaCl, 1.0% NP-40, and 50 mM Tris·HCl, pH 8.0). SDS sample buffer plus 0.25 mM DTT were added to the pellet, which was boiled for 3 min before being separated using 10% SDS-PAGE. Proteins were then transferred onto nitrocellulose membranes, and specific protein bands were detected using a primary antibody against Ang2 (SC-7015; Santa Cruz Biotechnology). Whole cell lysates were also collected from PDGF-, IGF-, or nontreated VSMCs after 10 min of stimulation using standard RIPA buffer plus protease and phosphatase inhibitors. Proteins were detected using primary antibodies specific to the phosphorylated and nonphosphorylated forms of Akt, ERK, JNK, PLC-
1 (Cell Signaling Technology), and
-tubulin (Sigma-Aldrich). Proteins were visualized using chemiluminescence detection (EpiChem II imager; UVP) with secondary antibodies conjugated to alkaline phosphatase (Jackson ImmunoResearch).
| RESULTS |
|---|
|
|
|---|
|
|
|
|
|
effectively, whereas IGF-I only transiently activated Akt and ERK and failed to activate PLC-
(Fig. 6). On the basis of these findings, we investigated the role of phosphatidylinositol 3-kinase (PI3K)/Akt activation in Ang2 expression and found that the specific PI3K inhibitor LY-294002 was able to inhibit IGF-I-mediated Ang2 mRNA upregulation (Fig. 7A). Blocking PI3K did not affect PDGF-mediated Ang2 downregulation (Fig. 7B), consistent with the idea that signaling pathways associated with Ang2 transcriptional upregulation are distinct from growth factor-induced message destabilization. These results link Ang2 upregulation with PI3K/Akt activity and Ang2 message destabilization through pathways other than PI3K/Akt.
|
|
activation results in Ang2 mRNA decay.
PDGF is known to activate many signal transduction pathways through the PDGF
-receptor, including Ras/ERK, PI3K, and PLC-
pathways (19), and it did so in our cell model. To identify PDGF-induced signaling pathways that are responsible for Ang2 mRNA turnover, we treated cells with pharmacological inhibitors or activators specific to individual signaling pathways. U0126, an ERK/MAPK pathway inhibitor, was able to block ERK phosphorylation completely (Fig. 8A, bottom), but alone it was unable to inhibit PDGF-induced Ang2 mRNA turnover (Fig. 8A, top). Similarly, SP-600125, an inhibitor of several pathways, particularly JNK, alone was unable to block Ang2 turnover (Fig. 8B). However, VSMCs stimulated with PDGF-BB in the presence of both inhibitors were unable to downregulate Ang2 message levels (Fig. 8C). We next stimulated cells with the PLC activator m-3M3FBS (Fig. 9A). This compound was able to induce the same rapid Ang2 mRNA turnover as PDGF alone, yielding a similar decay rate. Because PLC-
, which is activated by the PDGF receptor, is known to activate the mobilization of intracellular Ca2+ from internal stores (2), we investigated the potential role of Ca2+ signaling in the regulation of Ang2 mRNA stability. Cells treated with A23187
[GenBank]
, a Ca2+ ionophore that increases the concentration of intracellular Ca2+, stimulated the rapid reduction in Ang2 mRNA levels similar to those observed using the PLC activator or PDGF (Fig. 9B). To demonstrate a direct link between PDGF, Ca2+ signaling, and Ang2 mRNA turnover, we pretreated cells with the cell-permeable Ca2+ chelator BAPTA-AM to inhibit intracellular Ca2+ signaling before the addition of PDGF or the PLC activator (Fig. 9C). In both cases, inhibition of Ca2+ signaling was sufficient to block either PLC- or PDGF-mediated Ang2 turnover. We also attempted to block PDGF-mediated PLC-
signaling with the PLC-
inhibitor U73122
[GenBank]
. Interestingly, the addition of U73122
[GenBank]
downregulated Ang2 message in the absence of PDGF (data not shown). It was previously shown that this PLC inhibitor can activate of Ca2+ signaling directly in some systems (3, 38), and this fact precluded its use in our cells. Together, these data suggest that the inability of IGF-I to stimulate MAPK and PLC-
pathways profoundly alters its effect on Ang2 expression.
|
|
| DISCUSSION |
|---|
|
|
|---|
PDGF stimulation could induce a rapid decrease in the stability of Ang2 mRNA, leading to a loss of Ang2 protein but without an apparent change in Ang2 transcription rates. Previous studies demonstrated an Ang2 mRNA half-life of
34 h in bovine retinal ECs with or without VEGF stimulation (39). Hypoxia has been shown to increase this half-life to almost 5 h (44) and to increase Ang2 transcription. One important feature that distinguishes our culture models is our ability to perform these experiments in serum-free medium. Previous studies in which researchers reported relatively short Ang2 mRNA half-lives were performed in the presence of serum (39) or with relatively brief periods of serum starvation (21), which may accelerate Ang2 mRNA decay. We have found that stimulating our VSMC model with serum led to a rapid loss of Ang2 mRNA. Interestingly, Ang2 mRNA was downregulated rapidly in hemangioma-derived ECs in response to serum, but this effect was not induced by PDGF (58). We have found evidence that other mediators of VSMC function, including thrombin, also stimulate Ang2 message turnover (Phelps E and Howard E, unpublished observations). We think that VSMCs rapidly downregulate Ang2 expression in response to conditions that mimic vascular injury, including exposure to serum factors. Additional studies are needed to confirm this hypothesis.
Through the use of the transcription inhibitor DRB, we calculated the endogenous half-life of Ang2 mRNA to be
6 h. PDGF addition, in the absence of the transcription inhibitor, accelerated this rate of decay to yield a half-life of only 3 h. To our surprise, the addition of both PDGF and DRB resulted in the same half-life determined using DRB alone. These observations have several possible explanations. First, Ang2 message destabilization may require the presence of one or more newly transcribed factors that PDGF stimulation induces; hence the ability of transcription inhibitors to block the process. Second, transcription inhibitors have been demonstrated to interfere selectively with the degradation of one type of AU-rich element-containing mRNA vs. another (43). In addition, different groups have reported different degradation characteristics of the same mRNA in different cell types (6, 28). Because transcription inhibition actually blocked PDGF-mediated Ang2 mRNA turnover, we were unable to quantitate the increased rate of Ang2 turnover accurately in PDGF stimulated cells. Our estimate of an Ang2 half-life in the presence of PDGF is likely to be too high, given that Ang2 transcription remained constant under these conditions (Fig. 2). Despite the complications inherent in using DRB or actinomycin D, we conclude on the basis of the present study that PDGF induces a reduction in Ang2 mRNA stability compared with nonstimulated cells, resulting in dynamic changes in Ang2 expression.
The results presented herein suggest that VSMCs have the ability to regulate Ang2 levels precisely through transcriptional and posttranscriptional mechanisms that are highly responsive to extracellular factors. In the case of transcriptional upregulation, we have identified the PI3K pathway as an important component in growth factor-mediated increases in Ang2 expression. We are currently investigating the mechanisms involved in increased Ang2 transcription; however, we can conclude that this process is completely distinct from growth factor-induced Ang2 message destabilization. This destabilization appears to involve multiple pathways, at least in the response of VSMCs to PDGF-BB. Our results suggest the involvement of multiple MAPK pathways. Similarly, we have linked Ca2+-mediated signaling pathways to the destabilization of Ang2 mRNA. We base this finding on the ability of the Ca2+ ionophore A23187
[GenBank]
to induce Ang2 mRNA turnover rapidly and on the ability of the intracellular Ca2+ chelator BAPTA-AM to block PDGF-mediated turnover. Our findings are consistent with the involvement of PLC-
on the basis of the ability of a synthetic PLC activator to induce turnover, as well as on the ability of PDGF, but not IGF-I, to induce turnover. A23187
[GenBank]
is known to induce the stabilization of AU-rich mRNA through a mechanism independent of transcription or translation (25); in our VSMCs, we also observed A23187
[GenBank]
-mediated message stabilization of two different classes of AU-rich mRNA (data not shown). Proteins required for the dynamic regulation of AU-rich mRNA also have been demonstrated to be upregulated in cells treated with A23187
[GenBank]
(46). Ca2+-induced stabilization of AU-rich mRNA has been linked to multiple signaling pathways (56), but it is not yet clear how Ca2+ signaling leads to the instability of Ang2 mRNA in our model system. It is possible that growth factor-mediated Ca2+ release leads to the activation of MAPK pathways that then initiate the Ang2 message destabilization mechanism; in fact, Ca2+/CaM signaling has been linked to both JNK and ERK activation and may provide an explanation of the ability of Ca2+ influx into cells to stimulate Ang2 message destabilization (9, 14).
Several instances in which Ang2 expression significantly decreased over time in both in vitro and in vivo models have been documented. In several cases of experimentally induced ischemia, Ang2 levels were transiently upregulated and then decreased significantly over time (1, 36, 37). During normal excisional wound healing, Ang2 was shown similarly to spike and then decline (23, 54). In cultured cells, previous studies demonstrated an increase in Ang2 mRNA in response to TNF-
within 6 h, with a rapid decrease to baseline within the next 4 h (24). Similarly, serum caused decreased Ang2 mRNA levels in hemangioma-derived ECs within 8 h (58). We postulate that regulated message stability plays a role in this regulation, and we have found that multiple extracellular signals lead to what we call the Ang2 instability phenotype. The observation that PDGF activation of VSMCs leads to decreases in Ang2 levels may, in fact, have relevance to vascular homeostasis. The importance of PDGF in vascular development has been well documented (19, 29, 31, 40). The PDGF
-receptor is of critical importance for initiating VSMC migration during the stabilization of primitive EC tubes. Lack of a functional PDGF
-receptor in the developing retina resulted in a vasculature that was completely deficient in pericytes and VSMCs, thereby resulting in microvascular leakage (51). Interestingly, addition of recombinant, modified Ang1 that was not subject to Ang2 inhibition increased EC integrity in the absence of pericytes or VSMCs and prevented vascular hemorrhage (51). This finding suggests that the leakiness of the retinal microvasculature may be an indirect result of PDGF
-receptor inhibition and that PDGF-mediated changes in angiopoietins are critical for normal development. Similarly, PDGF-deficient mice have been shown to die as a result of vessel leakiness and a lack of pericytes, particularly in the kidney (29, 31). Our results suggest that without PDGF
-receptor function, VSMCs may not normally turn over Ang2 message. The resultant increased expression of Ang2 mRNA shifts the Ang1-to-Ang2 ratio and favor Tie2 inhibition. Without Ang1-dependent Tie2 signaling, VSMCs or pericytes are not recruited to stabilize the primary vasculature, thereby resulting in the microvascular leakage and immature vascular structure reported previously (51).
A number of important genes associated with vascular remodeling and contractility are regulated to a significant degree by altered message stability. For example, VEGF-A message is stabilized in response to hypoxia by factors that bind to a sequence in its 3'-UTR (30). Similarly, the mRNA of several VSMC contractile proteins are controlled in part by mRNA turnover; for example, smooth muscle
-actin mRNA levels sharply decrease upon PDGF-induced activation through mechanisms that may include decreased message stability (8). Because Ang2 levels play a critical role in vessel stability and angiogenesis, it is not surprising that its regulation is tightly controlled. A constitutive but low level of Ang2 transcription, coupled with the ability to control mRNA stability and thus protein synthesis, would yield a rapid and flexible mechanism to control Ang2 expression precisely. We predict that this mechanism is a primary tool used by vascular associated cells to adjust the levels of Ang2 rapidly.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Berridge MJ. Inositol trisphosphate and calcium signalling. Nature 361: 315325, 1993.[CrossRef][Medline]
3. Berven LA and Barritt GJ. Evidence obtained using single hepatocytes for inhibition by the phospholipase C inhibitor U73122 of store-operated Ca2+ inflow. Biochem Pharmacol 49: 13731379, 1995.[CrossRef][Web of Science][Medline]
4. Bottles KD, Bullen EC, Updike DL, Vu TKH, Phelps E, Grammas P, and Howard EW. Gelatinase A expression in endothelial cells is regulated by at least two cis-acting promoter elements. Biochim Biophys Acta 1428: 147160, 1999.[Medline]
5. Bruce MC and Honaker CE. Transcriptional regulation of tropoelastin expression in rat lung fibroblasts: changes with age and hyperoxia. Am J Physiol Lung Cell Mol Physiol 274: L940L950, 1998.
6. Chen CYA, Xu N, and Shyu AB. mRNA decay mediated by two distinct AU-rich elements from c-fos and granulocyte-macrophage colony-stimulating factor transcripts: different deadenylation kinetics and uncoupling from translation. Mol Cell Biol 15: 57775788, 1995.[Abstract]
7. Chomczynski P and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156159, 1987.[Web of Science][Medline]
8. Corjay MH, Blank RS, and Owens GK. Platelet-derived growth factor-induced destabilization of smooth muscle
-actin mRNA. J Cell Physiol 145: 391397, 1990.[CrossRef][Web of Science][Medline]
9. Cullen PJ and Lockyer PJ. Integration of calcium and Ras signalling. Nat Rev Mol Cell Biol 3: 339348, 2002.[CrossRef][Web of Science][Medline]
10. Davis S, Aldrich TH, Jones PF, Acheson A, Compton DL, Jain V, Ryan TE, Bruno J, Radziejewski C, Maisonpierre PC, and Yancopoulos GD. Isolation of angiopoietin-1, a ligand for the TIE2 receptor, by secretion-trap expression cloning. Cell 87: 11611169, 1996.[CrossRef][Web of Science][Medline]
11. Diglio CA, Grammas P, Giacomelli F, and Wiener J. Rat heart-derived endothelial and smooth muscle cell cultures: isolation, cloning and characterization. Tissue Cell 20: 477492, 1988.[CrossRef][Web of Science][Medline]
12. Dumont DJ, Gradwohl G, Fong GH, Puri MC, Gertsenstein M, Auerbach A, and Breitman ML. Dominant-negative and targeted null mutations in the endothelial receptor tyrosine kinase, tek, reveal a critical role in vasculogenesis of the embryo. Genes Dev 8: 18971909, 1994.
13. Dumont DJ, Yamaguchi TP, Conlon RA, Rossant J, and Breitman ML. tek, a novel tyrosine kinase gene located on mouse chromosome 4, is expressed in endothelial cells and their presumptive precursors. Oncogene 7: 14711480, 1992.[Web of Science][Medline]
14. Enslen H, Tokumitsu H, Stork PJS, Davis RJ, and Soderling TR. Regulation of mitogen-activated protein kinases by a calcium/calmodulin-dependent protein kinase cascade. Proc Natl Acad Sci USA 93: 1080310808, 1996.
15. Gale NW, Thurston G, Hackett SF, Renard R, Wang Q, McClain J, Martin C, Witte C, Witte MH, Jackson D, Suri C, Campochiaro PA, Wiegand SJ, and Yancopoulos GD. Angiopoietin-2 is required for postnatal angiogenesis and lymphatic patterning, and only the latter role is rescued by angiopoietin-1. Dev Cell 3: 411423, 2002.[CrossRef][Web of Science][Medline]
16. Grammas P, Diglio C, Giacomelli F, and Wiener J. Growth properties and receptor expression in vascular smooth muscle cells from hypertensive rats. Clin Exp Hypertens 16: 207227, 1994.[Web of Science][Medline]
17. Hashimoto T, Lam T, Boudreau NJ, Bollen AW, Lawton MT, and Young WL. Abnormal balance in the angiopoietin-Tie2 system in human brain arteriovenous malformations. Circ Res 89: 111113, 2001.
18. Heldin CH, Wasteson A, and Westermark B. Platelet-derived growth factor. Mol Cell Endocrinol 39: 169187, 1985.[CrossRef][Web of Science][Medline]
19. Heldin CH and Westermark B. Mechanism of action and in vivo role of platelet-derived growth factor. Physiol Rev 79: 12831316, 1999.
20. Higuchi R, Fockler C, Dollinger G, and Watson R. Kinetic PCR analysis: real-time monitoring of DNA amplification reactions. Biotechnology 11: 10261030, 1993.[CrossRef][Medline]
21. Huang YQ, Li JJ, Hu L, Lee M, and Karpatkin S. Thrombin induces increased expression and secretion of angiopoietin-2 from human umbilical vein endothelial cells. Blood 99: 16461650, 2002.
22. Jones N, Iljin K, Dumont DJ, and Alitalo K. Tie receptors: new modulators of angiogenic and lymphangiogenic responses. Nat Rev Mol Cell Biol 2: 257267, 2001.[CrossRef][Web of Science][Medline]
23. Kampfer H, Pfeilschifter J, and Frank S. Expressional regulation of angiopoietin-1 and -2 and the tie-1 and -2 receptor tyrosine kinases during cutaneous wound healing: a comparative study of normal and impaired repair. Lab Invest 81: 361373, 2001.[Web of Science][Medline]
24. Kim I, Kim JH, Ryu YS, Liu M, and Koh GY. Tumor necrosis factor-
upregulates angiopoietin-2 in human umbilical vein endothelial cells. Biochem Biophys Res Commun 269: 361365, 2000.[CrossRef][Web of Science][Medline]
25. Klein N, Curatola AM, and Schneider RJ. Calcium-induced stabilization of AU-rich short-lived mRNAs is a common default response. Gene Expr 7: 357365, 1999.[Web of Science][Medline]
26. Koblizek TI, Weiss C, Yancopoulos GD, Deutsch U, and Risau W. Angiopoietin-1 induces sprouting angiogenesis in vitro. Curr Biol 8: 529532, 1998.[CrossRef][Web of Science][Medline]
27. Kuroda K, Sapadin A, Shoji T, Fleischmajer R, and Lebwohl M. Altered expression of angiopoietins and Tie2 endothelium receptor in psoriasis. J Invest Dermatol 116: 713720, 2001.[CrossRef][Web of Science][Medline]
28. Laroia G, Cuesta R, Brewer G, and Schneider RJ. Control of mRNA decay by heat shock-ubiquitin-proteasome pathway. Science 284: 499502, 1999.
29. Leveen P, Pekny M, Gebre-Medhin S, Swolin B, Larsson E, and Betsholtz C. Mice deficient for PDGF B show renal, cardiovascular, and hematological abnormalities. Genes Dev 8: 18751887, 1994.
30. Levy NS, Chung S, Furneaux H, and Levy AP. Hypoxic stabilization of vascular endothelial growth factor mRNA by the RNA-binding protein HuR. J Biol Chem 273: 64176423, 1998.
31. Lindahl P, Johansson BR, Leveen P, and Betsholtz C. Pericyte loss and microaneurysm formation in PDGF-B-deficient mice. Science 277: 242245, 1997.
32. Lobov IB, Brooks PC, and Lang RA. Angiopoietin-2 displays VEGF-dependent modulation of capillary structure and endothelial cell survival in vivo. Proc Natl Acad Sci USA 99: 1120511210, 2002.
33. Loflin PT, Chen CY, Xu N, and Shyu AB. Transcriptional pulsing approaches for analysis of mRNA turnover in mammalian cells. Methods 17: 1120, 1999.[CrossRef][Web of Science][Medline]
34. Maisonpierre PC, Suri C, Jones PF, Bartunkova S, Wiegand SJ, Radziejewski C, Compton D, McClain J, Aldrich TH, Papadopoulos N, Daly TJ, Davis S, Sato TN, and Yancopoulos GD. Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science 277: 5560, 1997.
35. Mandriota SJ and Pepper MS. Regulation of angiopoietin-2 mRNA levels in bovine microvascular endothelial cells by cytokines and hypoxia. Circ Res 83: 852859, 1998.[Web of Science][Medline]
36. Mandriota SJ, Pyke C, Di Sanza C, Quinodoz P, Pittet B, and Pepper MS. Hypoxia-inducible angiopoietin-2 expression is mimicked by iodonium compounds and occurs in the rat brain and skin in response to systemic hypoxia and tissue ischemia. Am J Pathol 156: 20772089, 2000.
37. Matsunaga T, Warltier DC, Tessmer J, Weihrauch D, Simons M, and Chilian WM. Expression of VEGF and angiopoietins-1 and -2 during ischemia-induced coronary angiogenesis. Am J Physiol Heart Circ Physiol 285: H352H358, 2003.
38. Mogami H, Lloyd Mills C, and Gallacher DV. Phospholipase C inhibitor, U73122, releases intracellular Ca2+, potentiates Ins(1,4,5)P3-mediated Ca2+ release and directly activates ion channels in mouse pancreatic acinar cells. Biochem J 324: 645651, 1997.[Medline]
39. Oh H, Takagi H, Suzuma K, Otani A, Matsumura M, and Honda Y. Hypoxia and vascular endothelial growth factor selectively up-regulate angiopoietin-2 in bovine microvascular endothelial cells. J Biol Chem 274: 1573215739, 1999.
40. Ohlsson R, Falck P, Hellström M, Lindahl P, Boström H, Franklin G, Ährlund-Richter L, Pollard J, Soriano P, and Betsholtz C. PDGFB regulates the development of the labyrinthine layer of the mouse fetal placenta. Dev Biol 212: 124136, 1999.[CrossRef][Web of Science][Medline]
41. Oliner J, Min H, Leal J, Yu D, Rao S, You E, Tang X, Kim H, Meyer S, Han SJ, Hawkins N, Rosenfeld R, Davy E, Graham K, Jacobsen F, Stevenson S, Ho J, Chen Q, Hartmann T, Michaels M, Kelley M, Li L, Sitney K, Martin F, Sun JR, Zhang N, Lu J, Estrada J, Kumar R, Coxon A, Kaufman S, Pretorius J, Scully S, Cattley R, Payton M, Coats S, Nguyen L, Desilva B, Ndifor A, Hayward I, Radinsky R, Boone T, and Kendall R. Suppression of angiogenesis and tumor growth by selective inhibition of angiopoietin-2. Cancer Cell 6: 507516, 2004.[CrossRef][Web of Science][Medline]
42. Papapetropoulos A, García-Cardeña G, Dengler TJ, Maisonpierre PC, Yancopoulos GD, and Sessa WC. Direct actions of angiopoietin-1 on human endothelium: evidence for network stabilization, cell survival, and interaction with other angiogenic growth factors. Lab Invest 79: 213223, 1999.[Web of Science][Medline]
43. Peng SS, Chen CY, and Shyu AB. Functional characterization of a non-AUUUA AU-rich element from the c-jun proto-oncogene mRNA: evidence for a novel class of AU-rich elements. Mol Cell Biol 16: 14901499, 1996.[Abstract]
44. Pichiule P, Chavez JC, and LaManna JC. Hypoxic regulation of angiopoietin-2 expression in endothelial cells. J Biol Chem 279: 1217112180, 2004.
45. Pola R, Ling LE, Silver M, Corbley MJ, Kearney M, Blake Pepinsky R, Shapiro R, Taylor FR, Baker DP, Asahara T, and Isner JM. The morphogen Sonic hedgehog is an indirect angiogenic agent upregulating two families of angiogenic growth factors. Nat Med 7: 706711, 2001.[CrossRef][Web of Science][Medline]
46. Ruth JH, Esnault S, Jarzembowski JA, and Malter JS. Calcium ionophore upregulation of AUUUA-specific binding protein activity is contemporaneous with granulocyte macrophage colony-stimulating factor messenger RNA stabilization in AML14.3D10 cells. Am J Respir Cell Mol Biol 21: 621628, 1999.
47. Sato TN, Tozawa Y, Deutsch U, Wolburg-Buchholz K, Fujiwara Y, Gendron-Maguire M, Gridley T, Wolburg H, Risau W, and Qin Y. Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation. Nature 376: 7074, 1995.[CrossRef][Medline]
48. Scharpfenecker M, Fiedler U, Reiss Y, and Augustin HG. The Tie-2 ligand angiopoietin-2 destabilizes quiescent endothelium through an internal autocrine loop mechanism. J Cell Sci 118: 771780, 2005.
49. Suri C, Jones PF, Patan S, Bartunkova S, Maisonpierre PC, Davis S, Sato TN, and Yancopoulos GD. Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis. Cell 87: 11711180, 1996.[CrossRef][Web of Science][Medline]
50. Suri C, McClain J, Thurston G, McDonald DM, Zhou H, Oldmixon EH, Sato TN, and Yancopoulos GD. Increased vascularization in mice overexpressing angiopoietin-1. Science 282: 468471, 1998.
51. Uemura A, Ogawa M, Hirashima M, Fujiwara T, Koyama S, Takagi H, Honda Y, Wiegand SJ, Yancopoulos GD, and Nishikawa SI. Recombinant angiopoietin-1 restores higher-order architecture of growing blood vessels in mice in the absence of mural cells. J Clin Invest 110: 16191628, 2002.[CrossRef][Web of Science][Medline]
52. Vajkoczy P, Farhadi M, Gaumann A, Heidenreich R, Erber R, Wunder A, Tonn JC, Menger MD, and Breier G. Microtumor growth initiates angiogenic sprouting with simultaneous expression of VEGF, VEGF receptor-2, and angiopoietin-2. J Clin Invest 109: 777785, 2002.[CrossRef][Web of Science][Medline]
53. Visconti RP, Richardson CD, and Sato TN. Orchestration of angiogenesis and arteriovenous contribution by angiopoietins and vascular endothelial growth factor (VEGF). Proc Natl Acad Sci USA 99: 82198224, 2002.
54. Wen CY, Ito M, Chen LD, Matsuu M, Shichijo K, Nakayama T, Nakashima M, Xu ZM, Ohtsuru A, Hsu CT, and Sekine I. Expression of Tie-2 and angiopoietin-1 and -2 in early phase of ulcer healing. J Gastroenterol 38: 431435, 2003.[CrossRef][Web of Science][Medline]
55. Winkler F, Kozin SV, Tong RT, Chae SS, Booth MF, Garkavtsev I, Xu L, Hicklin DJ, Fukumura D, di Tomaso E, Munn LL, and Jain RK. Kinetics of vascular normalization by VEGFR2 blockade governs brain tumor response to radiation: role of oxygenation, angiopoietin-1, and matrix metalloproteinases. Cancer Cell 6: 553563, 2004.[Web of Science][Medline]
56. Wyss A and Moroni C. Calcium-dependent and oncogenic IL-3 mRNA stabilization can be distinguished pharmacologically and by sequence requirements in the 3'UTR. Growth Factors 18: 109118, 2000.[Web of Science][Medline]
57. Yancopoulos GD, Davis S, Gale NW, Rudge JS, Wiegand SJ, and Holash J. Vascular-specific growth factors and blood vessel formation. Nature 407: 242248, 2000.[CrossRef][Medline]
58. Yu Y, Varughese J, Brown LF, Mulliken JB, and Bischoff J. Increased Tie2 expression, enhanced response to angiopoietin-1, and dysregulated angiopoietin-2 expression in hemangioma-derived endothelial cells. Am J Pathol 159: 22712280, 2001.
59. Yuan HT, Tipping PG, Li XZ, Long DA, and Woolf AS. Angiopoietin correlates with glomerular capillary loss in anti-glomerular basement membrane glomerulonephritis. Kidney Int 61: 20782089, 2002.[CrossRef][Web of Science][Medline]
60. Zhang M, Pierce RA, Wachi H, Mecham RP, and Parks WC. An open reading frame element mediates posttranscriptional regulation of tropoelastin and responsiveness to transforming growth factor
1. Mol Cell Biol 19: 73147326, 1999.
61. Zhu B, Zhao G, Witte DP, Hui DY, and Fagin JA. Targeted overexpression of IGF-I in smooth muscle cells of transgenic mice enhances neointimal formation through increased proliferation and cell migration after intraarterial injury. Endocrinology 142: 35983606, 2001.
This article has been cited by other articles:
![]() |
E. Shema, I. Tirosh, Y. Aylon, J. Huang, C. Ye, N. Moskovits, N. Raver-Shapira, N. Minsky, J. Pirngruber, G. Tarcic, et al. The histone H2B-specific ubiquitin ligase RNF20/hBRE1 acts as a putative tumor suppressor through selective regulation of gene expression Genes & Dev., October 1, 2008; 22(19): 2664 - 2676. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Hall Review of the Pericyte during Angiogenesis and its Role in Cancer and Diabetic Retinopathy Toxicol Pathol, October 1, 2006; 34(6): 763 - 775. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |