Am J Physiol Cell Physiol Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 289: C802-C810, 2005. First published May 11, 2005; doi:10.1152/ajpcell.00597.2004
0363-6143/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/4/C802    most recent
00597.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, D.
Right arrow Articles by Yun, C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, D.
Right arrow Articles by Yun, C. C.

MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS

Activation of NHE3 by dexamethasone requires phosphorylation of NHE3 at Ser663 by SGK1

Dongsheng Wang,1 Hong Sun,1 Florian Lang,2 and C. Chris Yun1

1Division of Digestive Diseases, Departments of Medicine and Physiology, Emory University School of Medicine, Atlanta, Georgia; and 2Department of Physiology, University of Tubingen, Germany

Submitted 6 December 2004 ; accepted in final form 6 May 2005


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Glucocorticoids stimulate Na+ absorption by activation of the epithelial Na+/H+ exchanger NHE3 in the kidney and intestine. It has been thought that glucocorticoid-induced activation of NHE3 is solely dependent on transcriptional induction of the NHE3 gene. While the transcriptional regulation remains an essential part of the chronic effect of glucocorticoids, a previous study by us identified the serum- and glucocorticoid-inducible kinase 1 (SGK1) as an important component of the activation of NHE3 by glucocorticoids. In this work, we have demonstrated phosphorylation of NHE3 by SGK1 as the key mechanism for the stimulation of the transport activity by glucocorticoids. By using in vitro SGK1 kinase assay and site-directed mutagenesis, we have identified Ser663 of NHE3 to be the major site of phosphorylation by SGK1. Ser663 is invariantly conserved in all NHE3 proteins from several species, and the mutation of Ser663 to Ala blocks the effect of dexamethasone, demonstrating the importance of phosphorylation at Ser663. We also show that phosphorylation of NHE3 precedes the changes in NHE3 activity, and the increased activity is associated with an increased amount of NHE3 proteins in the surface membrane. These data reveal that dexamethasone activates NHE3 activity by phosphorylating the NHE3 protein, which initiates trafficking of the protein into the plasma membrane.

intestinal epithelial cells; Na absorption; phosphorylation


THE Na+/H+ exchanger 3 (NHE3) is a key protein that mediates transcellular reabsorption of Na+ and HCO3 in the kidney and intestine. Several studies (4, 5, 27, 50) have demonstrated that glucocorticoids stimulate fluid and electrolyte transport. This stimulation occurs in part by a direct effect on Na+ absorption by NHE3 (4, 5, 50). The studies using small animals demonstrated that glucocorticoids elevate the level of NHE3 mRNA without affecting NHE1 mRNA expression (4, 6, 50). These studies indicated that the effect of glucocorticoids on NHE3 is mediated via transcriptional regulation resulting in an increased expression of the carrier protein to perform transport. On the other hand, it has been reported that glucocorticoids activate Na+/H+ exchange independent of changes in NHE3 expression, suggesting that glucocorticoid-mediated activation of Na+/H+ exchanger might involve more than transcriptional regulation of the NHE3 gene (6, 28). In a recent study, we reported that the serum and glucocorticoid-inducible kinase 1 (SGK1), in conjunction with Na+/H+ exchanger regulatory factor 2 (NHERF2), plays a pivotal role in glucocorticoid-mediated activation of NHE3 (45, 46). Co-expression of a kinase-inactive form of SGK1 blocked activation of NHE3 by glucocorticoids, suggesting that activity of SGK1 may be essential in NHE3 regulation. SGK1 was originally identified as a gene rapidly induced by glucocorticoids (18, 42). SGK1 is ubiquitously expressed in a wide variety of tissues, including the intestine and kidney. The physiological and pathophysiological function of SGK1 is not well understood, but recent studies using the SGK1 knockout mouse provided strong evidence supporting its role in electrolyte homeostasis (19, 43). In addition, other studies have shown that an increasing number of transporters and channels are regulated by SGK1 (26).

In this study, we report that NHE3 is directly phosphorylated by SGK1 at Ser663. Mutation of Ser663 blocks stimulation of NHE3 by dexamethasone, suggesting that SGK1-dependent phosphorylation of NHE3 is a key step in glucocorticoid-induced activation of NHE3.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Vectors. pcDNA3.1 harboring opossum kidney (OK) NHE3 or rabbit NHE3 has previously been described (16, 48). OK NHE3 is tagged with 6xHis and c-Myc epitope at the carboxyl terminus. Rabbit NHE3 is tagged with an antibody epitope derived from vesicular stomatitis virus glycoprotein fused at the carboxyl terminus (23). Human SGK1 and the kinase-dead SGK1/K127M tagged with a hemagglutinin (HA) epitope at the NH2 terminus have previously been described (46).

Cell culture and transfection. Intestinal epithelial cells (IEC6) (35) were cultured at 37°C in 95% air-5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5% fetal bovine serum, 0.1 U/ml insulin, 50 µg/ml streptomycin, and 50 U/ml penicillin. For transfection, cells grown to 70% confluence in 10 cm dishes were incubated for 16 h with 15 µg plasmid DNA and 40 µl lipofectamine 2000 (Invitrogen). IEC6 cells expressing NHE3 (IEC6/NHE3) were selected by resistance to G418 (400 µg/ml) and acid-loading in the presence of either 10 µM dimethyl amiloride or 30 µM HOE-694 (48). IEC6/NHE3 cells transfected with SGK1 or SGK1/K127M were selected by resistance to hygromycin (300 U/ml). Before being assayed, cells were rendered quiescent by serum starvation in DMEM for 18–24 h and treated with 1 µM dexamethasone or ethanol for 4 or 24 h. For all the studies, transfected cells were used within 10 passages.

Western immunoblot analysis. Cells were lysed in a lysis buffer (50 mM Tris-Cl, pH 7.4, 150 mM NaCl, 0.1 mM PMSF, 5 mg/ml aprotinin, 1 mM pepstatin, 1 mM iodoacetamide, 5 µg/ml leupeptin, and 1% Triton X-100), followed by centrifugation at 15,000 g at 4°C for 30 min as described in our previous study (47). Lysates were resolved by 10% SDS-PAGE, and Western immunoblot analysis was performed as previously described (25, 47). The anti-NHERF2 antibody, Ab2570, was previously described (46, 47). The HA-antibody was obtained from Covance. The anti-OK NHE3 antibody 5683 was provided by Dr. Orson Moe at the University of Texas Southwestern Medical Center (14).

In vitro phosphorylation assay. Cells expressing NHE3 were lysed in the lysis buffer supplemented with phosphatase inhibitors composed of (in mM) 1 EGTA, 1 EDTA, 1 Na orthovanadate, 10 Na fluoride, 10 Na pyrophosphate, and 25 {beta}-glycerophosphate, as described above. NHE3 was purified by being immobilized on Ni-NTA resins (Qiagen). The immobilized NHE3 was incubated with 25 ng of the constitutively active SGK1 (Upstate) in 20 mM Tris, pH 7.4, 10 mM MgCl2, 5 µM ATP, 2 µM PKA inhibitor, 1 mM DTT, and 10 µCi [{gamma}-32P]ATP. In other experiments, the recombinant proteins corresponding to the carboxyl terminal (CT) domain of NHE3 were used as substrates (47). The phosphorylated samples were resolved by SDS-PAGE, followed by transfer onto nitrocellulose membrane. Phosphorylation levels were quantified by a densitometric analysis using the Typhoon phosphoimager (Amersham). To normalize the levels of phosphorylation to the amount of proteins, the amounts of NHE3 immunoprecipitated was determined by Western immunoblot using the anti-NHE3 antiserum 5683.

Site-directed mutagenesis. Site-directed mutagenesis was performed using the QuickChange site-directed mutagenesis kit according to the recommendation by the manufacturer (Stratagene). The presence of mutation was confirmed by nucleotide sequencing.

RT-PCR. Total RNA was prepared from IEC6 cells with the use of TRIzol (Life Technologies). Adult male Sprague-Dawley rat was anesthetized with pentobarbital sodium and total TNA was extracted from whole kidney homogenate with the use of TRIzol. Five micrograms of total RNA were used for the subsequent synthesis of cDNA using the First Strand Synthesis kit, as recommended by the manufacturer (Life Technology). For detection of NHE isoforms, the following primer pairs were used (8): NHE1: TCTGCCGTCTCAACTGTCTCTA and CCCTTCAACTCCTCATTCACCA; NHE2: GCAGATGGTAATAGCAGCGA and CCTTGGTGGGGGCTTGGGTG; and NHE3: GGAACAGAGGCGGAGGAGCAT and GAAGTTGTGTGCCAGATTCTC. Each reaction was performed from 1 µl of cDNA. Amplification was performed for 40 cycles at 94°C/60 s, 60°C/45 s, and 72°C/60 s.

In vitro back-phosphorylation assay. An in vitro back-phosphorylation was performed as previously described to access dexamethasone-induced phosphorylation of NHE3 (53). IEC6 cells transfected with control NHE3 or NHE3/S663A were treated with dexamethasone for 0–24 h. Cell lysates were prepared and NHE3 was affinity purified as indicated above using Ni-NTA resins. The purified NHE3 was subjected to in vitro phosphorylation as described above using the purified SGK1 and [{gamma}-32P]ATP, followed by SDS-PAGE and autoradiography.

Na+-dependent intracellular pH recovery. The Na+-dependent changes in intracellular pH (pHi) by NHE3 was determined with the use of the ratio-fluorometric, pH-sensitive dye 2',7'-bis-(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) as previously described (25). Briefly, cells were seeded on coverslips, grown to confluence, and then serum starved overnight. Cells were washed in Na buffer composed of (in mM) 130 NaCl, 20 HEPES, 5 KCl, 1 tetramethylammonium-PO4 (TMA-PO4), 2 CaCl2, 1 MgSO4, and 18 glucose, and then dye-loaded by incubation for 40 min with 6.5 µM BCECF-AM in the same solution. The coverslips were mounted on a perfusion chamber mounted on an inverted microscope, and were superfused with NH4 buffer (40 mM NH4Cl, 90 mM NaCl, 20 mM HEPES, 5 mM KCl, 1 mM TMA-PO4, 2 mM CaCl2, 1 mM MgSO4, and 18 mM glucose) and subsequently with TMA buffer (130 mM TMA-Cl, 20 mM HEPES, 5 mM KCl, 1 mM TMA-PO4, 2 mM CaCl2, 1 mM MgSO4, and 18 mM glucose). Na buffer containing 30 µM HOE-694 was then reintroduced to drive Na-dependent pH recovery. Calibration of the fluorescence signal was performed using the K+/H+ ionophore nigericin as described previously (25). The microfluorometry was performed on a Nikon TE200 inverted microscope with a Nikon CFI Super Fluor x40 objective, coupled to a Lambda 10–2 filter wheel controller equipped with a multiwavelength filter set designed for BCECF. Photometric data was acquired using the Metafluor software (Universal Imaging). Na+/H+ exchange rate was described by the rate of pHi recovery, which was calculated by determining slopes along the pHi recovery by linear least-squares analysis over a minimum of 9 s.

Surface biotinylation. Surface biotinylation of NHE3 was performed as previously described (1, 21). Briefly, cells grown in 10-cm petri dishes were rinsed three times in PBS, followed by borate buffer composed of (in mM) 154 NaCl, 7.2 KCl, 1.8 CaCl2, and 10 H3BO3, pH 9.0. Hereafter all of the procedures were performed at 4°C. Cells were then incubated for 40 min with 1.5 mg of NHS-SS-biotin (Pierce, Rockford, IL) in borate buffer. Unbound NHS-SS-biotin was quenched with Tris buffer (20 mM Tris, pH 7.4, 120 mM NaCl). Cells were then rinsed with PBS, scraped, solubilized in 1 ml of the lysis buffer described above, and sonicated for 20 s. The lysate was agitated for 30 min and spun to remove insoluble cell debris. An aliquot was retained as the total fraction representing the total cellular NHE3 antigen. The remainder was incubated with streptavidin-agarose (Pierce) for 1 h. The strepavidin-agarose beads were washed with the lysis buffer, and this represented the surface NHE3. Dilutions of the total and surface NHE3 were resolved by SDS-PAGE, immunoblotted with anti-NHE3 antibody, followed by densitometric analysis to quantify the amounts of the total and surface NHE3.

Statistics. Densitometric analyses were performed on the Typhoon phosphoimager (Amersham) using the ImageQuant program. Statistical significance was assessed by ANOVA. Results were considered statistically significant when P < 0.05. If not otherwise specified, results are presented as the means ± SE.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
SGK1 is necessary for dexamethasone-induced activation of NHE3. IEC6 cells are nontransformed cells isolated from the rat small intestine (35). IEC6 cells express NHE1 and NHE2 but lack NHE3 based on RT-PCR (Fig. 1A). The absence of NHE3 was also confirmed by complete blockage of Na+/H+ exchange activity by 30 µM HOE-694 (Fig. 1B) or 10 µM dimethyl amiloride (data not shown). We transfected IEC6 cells with either OK NHE3 or rabbit NHE3, and the cells were selected by H+ death in the presence of 30 µM HOE-694 to obtain stable transfectants (41). Figure 1C shows that the transfected cells exhibited Na+/H+ exchange activity in the presence of 30 µM HOE-694, demonstrating the expression of NHE3. Our previous study (46) demonstrated the necessity of NHERF2 in dexamethasone-induced stimulation of NHE3. The presence of NHERF2 in IEC6 cells was determined by Western blot analysis using the anti-NHERF2 antibody Ab2750 (Fig. 1D). The results show that NHERF2 with molecular mass of 43 kDa was expressed in IEC6 cells, suggesting that IEC6 cells may be used as an intestinal epithelial model system to study the molecular mechanism underlying dexamethasone-induced activation of NHE3. To corroborate IEC6 cells as a cell system to study NHE3 regulation, we studied the effect of Ca2+ ionomycin on NHE3 in IEC6 cells. Several studies have described regulation of NHE3 activity in response to elevated intracellular Ca2+ concentration that activates protein kinase C (13, 21). Treatment of IEC6/NHE3 cells with 0.5 µM ionomycin resulted in a significant inhibition of NHE3 activity (Fig. 1E), suggesting that the transport activity of the exogenously expressed NHE3 is regulated by protein kinases in IEC6 cells.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1. Expression of Na+/H+ exchanger (NHE3) in intestinal epithelial cells (IEC6). A: RT-PCR was performed to determine NHE expression in IEC6 cells. PCR products with expected size of 422 bp (NHE1) and 310 bp (NHE2) were obtained. NHE3 (321 bp) was not visible indicating the absence of NHE3 in IEC6 cells. RNA from the rat kidney was used as a positive control for NHE3. B: Na+/H+ exchange activity in IEC6 cells are determined by measuring the rate of Na-dependent pH recovery. Endogenous Na+/H+ exchange activity in IEC6 cells was completely blocked in the presence of 30 µM HOE-694 in the Na+ buffer. Removal of the inhibitor resulted in a rapid Na+-dependent recovery, which was subsequently blocked by reintroduction of the inhibitor. A representative trace of three separate experiments is shown. C: transfection of NHE3 in IEC6 cells resulted in HOE-694-insensitive Na-dependent pH recovery. A representative trace of three separate experiments is shown. D: the presence of NHE regulatory factor 2 (NHERF2) in IEC6 cells was determined by Western immunoblot using the anti-NHERF2 antibody, Ab2570 (45, 46). Expression of human NHERF2 in IEC6 cells (IEC6/NHERF2) resulted in an increased intensity of the 43-kDa protein. As a positive control, PS120 fibroblasts transfected with NHERF2 were used. E: IEC6/NHE3 cells were serum starved overnight and were treated with 0.5 µM ionomycin or ethanol (control) before measurement of Na+-dependent pH recovery. NHE3 activity was inhibited in the presence of inonomycin. Average of 4 traces for each condition is shown as means ± SE. Na-dependent pHi recovery in the presence of ionomycin is statistically different compared with the rate in the absence, P < 0.05.

 
To determine whether NHE3 expressed in IEC6 cells respond to glucocorticoids, IEC6/NHE3 cells were treated with 1 µM dexamethasone for 24 h. In agreement with the known effect of dexamethasone, the treatment with dexamethasone resulted in ~30% increase in NHE3 activity (Figs. 2A and 4A). We have previously shown that SGK1 plays an important role in the activation of NHE3 transport activity by glucocorticoids (46). To confirm the importance of SGK1 in the dexamethasone-induced regulation of NHE3 in IEC6 cells, we constitutively expressed HA-SGK1 or the kinase-dead HA-SGK1/K127M (Fig. 2B). The constitutive expression of SGK1 resulted in an increased response to dexamethasone relative to sham-transfected cells. On the contrary, expression of the kinase-dead SGK1/K127M completely blocked the dexamethasone-induced activation of NHE3, suggesting that SGK1 plays a crucial role in the regulation of NHE3.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2. Activation of NHE3 by serum and glucocorticoid-inducible kinase 1 (SGK1) in IEC6 cells. A: IEC6/NHE3 cells were transfected with pcDNA (cont), pcDNA-HA-SGK1 (SGK1) or pcDNA-HA-SGK1/K127M (K127M) and the cells were selected by hygromycin to obtain stably transfected cell lines. The cells were serum deprived overnight to render them quiescent. The cells were then treated with 1 µM dexamethasone for 18–24 h (+) or ethanol (–). NHE3 activity was determined fluorometrically as Na-dependent pH recovery in the presence of 30 µM HOE-694 to inhibit NHE1 and NHE2 as detailed in MATERIALS AND METHODS. For determination of pHi recovery rate ({Delta}pHi/min), slopes were calculated along the pHi recovery by linear least-square analysis. The rates of pHi recovery at pHi 6.5 are shown. Average of at least 20 traces for each condition is shown. *P < 0.05 compared with respective controls. ns, not significant. B: expression of exogenous SGK1 proteins was demonstrated by Western immunoblot with the anti-hemagglutinin (HA) antibody.

 


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. Effect of dexamethasone on activity of NHE3 with S663A mutation. A: IEC6 cells expressing opossum kidney (OK) NHE3 or NHE3/S663A were treated with 1 µM dexamethasone for 2, 4, or 24 h. NHE3 activity was determined as Na+-dependent pH recovery. The rates of pHi recovery at pHi 6.5 are shown. Results are means ± SE. n = 5. *P < 0.05 compared with the untreatment controls. B: IEC6 cells expressing NHE3/S6663A or NHE3/S607A were treated with dexamethasone for 18–24 h. Results are means ± SE; n = 3. *P < 0.05 compared with the nontreatment controls. ns, not significant compared with the untreatment controls.

 
NHE3 is a direct target of phosphorylation by SGK1. Although our studies show that SGK1 appears to be a key protein, the mechanism underlying the NHE3 activation by SGK1 is unknown. One known mechanism whereby protein kinases regulate NHE3 is by phosphorylation of NHE3 protein (24, 52, 53). The optimal consensus sequence for phosphorylation by SGK1 is R-x-R-x-x-S/T-{Phi}, where S/T is the site of phosphorylation, and {Phi} is a hydrophobic residue (22, 32). Within NHE3 protein sequences, there is a R-K-R-L-E-S-F motif at amino acid 663, which is conserved in all NHE3 proteins from rabbit, rat, human and OK cells. Ser663 in rabbit NHE3 corresponds to Ser669 in OK NHE3. These serine residues will collectively be referred to as S663 hereafter. In addition to the R-K-R-L-E-S-F motif, there are 3 RRxS motifs at amino acids 555, 607, and 693 that might be targeted by SGK1. We, therefore, determined whether NHE3 is a direct target of phosphorylation by SGK1. To determine SGK1-dependent phosphorylation of NHE3, we used recombinant proteins encoding the NHE3 CT domain: C3:711 (aa 475–711), C3:660 (aa 475–660), C3:637 (aa 475–637), and C3:585 (aa 475–585). These recombinant constructs were expressed and purified from Escherichia coli as His-tagged proteins (47). As noted previously (47), the entire CT tail of NHE3 (aa 475–832) could not be expressed in bacteria, and was not included in this experiment. Figure 3A shows that the C3:711 construct was more robustly phosphorylated by SGK1 relative to the shorter constructs. Although the low phosphocontents of the shorter constructs might arise from fewer phosphorylation sites within them, the labeling could be washed off by incubating the gel in the electrophoresis buffer. Hence, we assumed that these were likely nonspecific background. These results suggested that NHE3 is a direct substrate of SGK1, and the potential phosphorylation site(s) is located between aa 660 and 711. However, the exclusion of the region beyond aa 711 and the membrane-bound domain left the possibility that there could be unconventional phosphorylation sites in these regions.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3. SGK1 phosphorylates NHE3 at S663. A: in vitro SGK1 kinase assay was performed on recombinant NHE3 CT constructs. Recombinant proteins were incubated with purified SGK1 in the presence of [{gamma}-32P]ATP, as detailed in MATERIALS AND METHODS. A total of 3 experiments were performed with similar results. B: recombinant COOH terminal domain of wild-type (wt) NHE3 (C3:711) and NHE3 with the S663A mutation (C3711/S663A) were incubated with SGK1 in the presence of [{gamma}-32P]ATP. The S663A mutation resulted in a significant decrease in phosphorylation of the recombinant proteins (left). Four independent experiments were performed with similar results. The levels of phosphorylation are quantified by a densitometric analysis and normalized to the amounts of the recombinant proteins (right). C: NHE3 proteins were purified from lysates prepared from IEC6 cells expressing NHE3, NHE3/S663A, or NHE3/S607A. Purified NHE3 proteins were 32P-labeled by SGK1, and phosphorylation was determined by autoradiography and normalized against the amount of NHE3 protein immunoprecipitated as determined by Western immunoblots. Results from at least 3 independent experiments were represented as means ± SE are shown on the right. *P < 0.01.

 
As mentioned earlier, the classic SGK1 consensus phosphorylation site is present at S663 of NHE3. To determine whether S663 is the site of phosphorylation by SGK1, we mutated S663 within the C3:711 construct to Ala. Figure 3B reveals that the extent of phosphorylation by SGK1 was decreased by ~69 ± 5% as the result of the S663A mutation, suggesting that S663 is targeted by SGK1. This was further confirmed by in vitro kinase assays on NHE3 or NHE3/S663A affinity purified from IEC6 cells. Figure 3C shows that the S663A mutation decreased the level of NHE3 phosphorylation to 40 ± 4% of the control. Therefore, the extent of decrease in NHE3 phosphocontent as a result of the S663A mutation was similar between the recombinant proteins and immunoprecipitated NHE3. The source of the residual phosphorylation in the S663A mutant is not known. We believe this is likely nonspecific labeling by SGK1 under the assay conditions, although there is a possibility that an additional unconventional phosphorylation site exists in the CT domain of NHE3. To determine whether SGK1 can phosphorylate the RRxS motif, we determined SGK1-induced phosphorylation of NHE3 with Ser607 mutated to Ala, NHE3/S607A. Unlike the S663A mutation, mutation of the RRxS motif at Ser607, which is a site phosphorylated by protein kinase A (PKA) (24, 52), did not affect the level of NHE3 phosphorylation by SGK1. Together, these results demonstrate that SGK1 specifically phosphorylates S663 and that SGK1 does not phosphorylate the RRxS motif.

Phosphorylation at S663 of NHE3 is necessary for dexamethasone-induced activation. We next studied whether the S663A mutation affects the activation of NHE3 by dexamethasone. In IEC6 cells, dexamethasone treatment for 2 h had no apparent effect on NHE3 activity (Fig. 4A). However, consistent with previous studies in Caco-2 cells (41), the NHE3 activity in IEC6 cells was significantly stimulated after 4 h or 24 h with dexamethasone. The mutation of S663A in NHE3 did not affect the basal Na+/H+ exchange activity of NHE3 indicating that this mutation did not alter the carrier activity or trafficking of NHE3 under the basal conditions. However, we found that dexamethasone for 24 h (Fig. 4B) or 4 h (data not shown) did not activate the transport activity in the presence of the S663A mutation. To show that the lack of response to dexamethasone is specific to the S663A mutation, we determined the effect of dexamethasone on NHE3/S607A. As noted earlier, Ser607 of rabbit NHE3 (identical to Ser605 in rat NHE3) is a phosphorylation site by PKA and the mutation at Ser607 renders NHE3 unresponsive to PKA (24, 52). Unlike the S663A mutant, it is shown in Fig. 3C that the S607A mutation did not affect SGK1-mediated phosphorylation of NHE3 protein. In accord with the in vitro phosphorylation, NHE3/S607A was stimulated to the same extent by dexamethasone as the control NHE3. These results strongly suggested that dexamethasone activated NHE3 via a change in phosphorylation of NHE3 at S663.

To determine whether dexamethasone-dependent induction of NHE3 activity correlates with phosphorylation of NHE3, we determined the time course of dexamethasone-induced phosphorylation of NHE3. Previous studies (53) have shown that NHE3 exhibits a high level of basal phosphorylation in vivo making it difficult to resolve the change in phosphocontent of NHE3. To overcome this problem, we employed an in vitro back-phosphorylation assay to determine the phosphorylation states of NHE3 in response to dexamethasone (53). In this technique, endogenous phosphates were incorporated into NHE3 during the dexamethasone treatments and the phosphorylation sites cannot be phosphorylated by SGK1 under in vitro conditions. On the other hand, in untreated cells, these sites are not occupied by unlabeled phosphate residues and these sites should be available to SGK1 to phosphorylate in vitro. Thus a decrease in back-phosphorylation reflects an increase in endogenous phosphorylation. Cells were treated with dexamethasone for the indicated times and NHE3 proteins were isolated under conditions preventing dephosphorylation. The purified NHE3 was then incubated with purified SGK1 and [{gamma}-32P]ATP to incorporate radioactive phosphate into sites that were not phosphorylated in situ. Figure 5A shows the levels of back-phosphorylation of NHE3 purified from IEC6 cells that were treated with dexamethasone for different time durations. Normalization of the levels of back-phosphorylation to the amount of NHE3 proteins (Fig. 5A) revealed that dexamethasone significantly blocked subsequent back-phosphorylation of NHE3 by SGK1, indicating that NHE3 was phosphorylated in situ during the dexamethasone treatment. The phosphorylation occurred at as early as 2 h, at which time NHE3 activity was not increased in response to dexamethasone. In contrast to the control NHE3, the phosphorylation level of NHE3/S663A (Fig. 5B) was low even in the absence of dexamethasone, consistent with the earlier results. More importantly, the phosphorylation levels of NHE3/S663A were not changed throughout the dexamethasone treatment. Taken together, these data demonstrate that dexamethasone induces phosphorylation of NHE3 at S663A and this change in phosphorylation precedes the increase in NHE3 activity.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5. Back-phosphorylation of NHE3 by SGK1. A: IEC6/NHE3 cells were treated with dexamethasone for 0–24 h. OK NHE3 proteins were affinity purified, and subjected to in vitro phosphorylation using SGK1. Top, representative results on back-phosphorylation of NHE3 and Western immunoblots are shown. Bottom, the extent of back-phosphorylation was normalized to the amounts of NHE3 protein. Results from 3 independent experiments are presented as means ± SE. *P < 0.05 compared with 0 h. B: back-phosphorylation of NHE3/S663A was determined as earlier. Top, representative results on back-phosphorylation of NHE3/S663A and Western blot from 3 experiments are shown. Bottom, normalized back-phosphorylation is shown.

 
Dexamethasone increased the abundance of NHE3 protein at the cell surface. Dexamethasone stimulates Na+/H+ exchange in part by increasing the amount of NHE3 transcripts (4, 5, 49, 50). We next determined whether the dexamethasone-mediated increase in Na+/H+ activity arise from an increased insertion of NHE3 into the surface membrane. The amount of surface NHE3 antigen before and after dexamethasone treatment in IEC6/NHE3 cells was determined by surface biotinylation. We estimated the amount of NHE3 on the surface membrane as fractions of the total cellular NHE3 protein in IEC6 cells. Upon an exposure to 1 µM dexamethasone for 4 h, the surface NHE3 antigen was increased by 56 ± 6.5% (Fig. 6). A similar increase in the surface NHE3 antigen was observed at 24 h (45 ± 7%). In contrast to control NHE3, there was no observable difference in the amount of NHE3/S663A on the plasma membrane after dexamethasone treatment. These results suggest that dexamethasone stimulates NHE3 activity by enhancing insertion of NHE3 protein into the surface membrane, which is closely linked to the phosphorylation at S663.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 6. Surface biotinylation of NHE3. A: cells were labeled with biotin, and biotinylated proteins were precipitated using streptavidin-agarose. Dilutions of total (T) and surface (S) fractions were resolved by SDS-PAGE, and the amount of NHE3 proteins were determined by immunoblot. Bottom, as a control for surface biotinylation, the presence of histone H1 only in the total fractions but not in the surface fraction. Representative figures from 3 independent experiments are shown. B: quantification of the surface NHE3 is shown. For each experiment, the densitometric values of the surface NHE3 were normalized to the total NHE3. *P < 0.01 compared with the untreated controls.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In the present work, we studied the underlying mechanism stimulating NHE3 activity by SGK1 in response to dexamethasone. We concluded that SGK1 phosphorylates NHE3 based on the following observations: 1) SGK1 phosphorylated NHE3 whether expressed as recombinant proteins or immunoprecipitated from tissue culture cells, 2) we identified S663 of NHE3 as the major site of phosphorylation by SGK1, 3) dexamethasone-induced stimulation of NHE3 activity at 4–24 h was preceded by an increase in phosphorylation level of NHE3, and 4) the S663A mutation in NHE3 blocked the stimulation of NHE3 activity by dexamethasone.

In this work, we used IEC6 cells as a cell model system to study the regulation of NHE3. IEC6 cells have an epitheloid origin from rat small intestine (35). Previous studies (34, 35) showed that IEC6 cells retained some characteristics of normal intestinal cells, but exhibit a flattened appearance and the lack of immunological determinants specific for differentiated villus cells. Consistently, IEC6 cells lacked the expression of NHE3, but expressed NHERF1 (data not shown) and NHERF2, two major scaffold proteins present in intestinal villus cells. To our knowledge, the regulation of NHE3 activity has not been studied in IEC6 cells. However, previous studies using non-epithelial PS120 and AP1 cells, epithelial Caco-2 and OK cells, or intestinal brush border vesicles have shown remarkable similarity in the regulation of NHE3, although some difference in NHE3 regulation has also been noted (13, 14, 21, 52). Our previous studies showed that SGK1 mediated the dexamethasone-mediated activation of NHE3 in both OK cells and PS120 fibroblasts, and this activation was facilitated by the presence of NHERF2. We demonstrated the presence of NHERF2 in IEC6 cells and the stimulation of NHE3 activity by dexamethasone. In addition, NHE3 was acutely inhibited by Ca2+ ionophore, further demonstrating the validity of IEC6 cells as a cell culture model system to study the regulation of NHE3. However, it is conceivable that there could be subtle difference in the regulation of NHE3 in IEC6 cells compared with normal polarized epithelium.

SGK1 was first shown to stimulate sodium reabsorption in aldosterone-responsive segments of the outer medulla of the kidney by specifically targeting the epithelial Na channel (ENaC) (11, 29, 33). It has been suggested that SGK1 regulates ENaC via phosphorylation of Nedd4–2 that affects binding of Nedd4–2 to the PY-motif of ENaC (15, 38, 39). Although direct phosphorylation of ENaC is not yet demonstrated, a mutation of the SGK1 consensus motif in the {alpha}-subunit of ENaC abolished the stimulatory effect of SGK1, suggesting a potential role of direct phosphorylation by SGK1 (17). Similarly, our data suggest that mutation of the SGK1 consensus motif at Ser663 abolished the dexamethasone-induced activation of NHE3-mediated transport. However, it seems unlikely that SGK1 affects the interaction of NHE3 via Nedd4 or Nedd4–2 because NHE3, with an exception of NHE3 from human, lacks a PY motif (20), and the importance of the PY motif in human NHE3 is yet to be proven.

The substrate specificity of SGK1 is similar to that of Akt1 and the putative phosphorylation site is determined to be RxRxxS/T based on studies using random peptides (22, 32). On the basis of this, some substrates that contain this motif have been identified (10, 12, 36, 51). The presence of a putative SGK1 phosphorylation site in NHE3 strongly suggests a role of phosphorylation in NHE3 activation. Our results indicated that S663 in NHE3 is the major site of phosphorylation by SGK1. The Ser residue is strictly conserved in all NHE3 proteins from multiple species and the mutation to Ala attenuated the extent of phosphorylation, The RxRxxS/T motif encompasses the consensus phosphorylation site, RxxS/T, by PKA, which also regulates NHE3 activity. PKA-mediated signaling results in inhibition of NHE3 and two independent studies identified Ser552 (identical to Ser555 in rabbit NHE3 or Ser560 on OK NHE3) and Ser605 (identical to Ser607 in rabbit NHE3 or Ser613 in OK NHE3) (24, 52). However, our data showed that the S607A mutation in rabbit NHE3 did not reduce the SGK1-mediated phosphorylation of NHE3 and did not affect the activation of NHE3 activity by dexamethasone. In the case of renal outer medullary K+ channel (ROMK), it has recently been shown that phosphorylation at Ser44 led to a drastic reduction in K+ current and surface expression of the ROMK protein in Xenopus oocytes (44). Unlike ROMK, the S663A mutation in NHE3 did not alter basal Na+/H+ exchange activity, suggesting the probable differences in the underlying mechanisms regulating NHE3 and ROMK by SGK1.

SGK1 has now been implicated in the activation of several channels and transporters, including the renal outer medullary K+ channel ROMK, the cystic fibrosis transmembrane conductance regulator, Na+ dicarboxylate cotransporter NaDCT-1, Na+-K+-2Cl cotransporter, Na+-K+-ATPase, and NHE3 (7, 11, 31, 37, 40, 44, 46). In some cases, translocation of channels or transporters to the plasma membrane mediated by SGK1 has been suggested as a possible mechanism, but how SGK1 may mediate translocation of protein(s) is yet to be elucidated. Our data showed that the increase in NHE3 phosphorylation precedes the stimulation of NHE3 activity after a treatment with dexamethasone. For instance, at 2 h with dexamethasone treatment, NHE3-mediated transport activity was not affected despite the increase in NHE3 phosphorylation (Figs. 4A and 5A). Phosphorylation of NHE3 occurring before the activation of NHE3 activity is consistent with our conclusion that phosphorylation at S663 of NHE3 is a key event in NHE3 regulation by dexamethasone. The present study showed that dexamethasone induced translocation of NHE3 into the plasma membrane, but not NHE3/S663A, suggesting that phosphorylation at S663 is closely associated with the translocation of NHE3 protein into the plasma membrane. Our preliminary studies indicate the effect of dexamethasone on NHE3 can partially be disrupted by nocodazole, indicating a microtubule-dependent mechanism (D. Wang and C. C. Yun, unpublished data). Furthermore, there was a substantial decrease in NHE3 phosphorylation at 24 h compared with 12 h, presenting the possibility that NHE3 might be subjected to dephosphorylation once inserted or translocated to the plasma membrane. Whether the phosphorylation at S663 triggers the translocation by enhancing the association with the trafficking assembly remains an intriguing prospect.

As we suggested earlier (46), the glucocorticoid-mediated activation of NHE3 consists of both genomic and non-genomic regulation. This is based on, in addition to the known transcriptional induction of NHE3 and SGK1, the difference in the magnitude of activation in cells endogenously expressing NHE3 compared with the heterologous expression of NHE3. For instance, in PS120 fibroblasts and IEC6 cells transfected with NHE3, the augmentation in NHE3 activity ranges 30–50% compared with 100% or more in Caco-2 or OK cells with endogenous NHE3 expression (3, 46). We attributed this difference to the presence or the lack of transcriptional induction of NHE3 mRNA in the respective cell lines. If the role of SGK1 is to phosphorylate NHE3, it seems paradoxical why a minimum of 3–4 h is required for NHE3 activity to be stimulated. One possibility is that the limiting step might be the induction of SGK1. On the basis of previous studies (9, 30), it is anticipated that dexamethasone initiates transcriptional, translational, and posttranslational modification of SGK1, resulting in eventual phosphorylation of NHE3 at S663. However, SGK1 mRNA level is rapidly induced by dexamethasone although the rate of posttranscriptional modification is not clear (2, 9, 30). An alternative mechanism may involve induction of other regulatory or adaptor proteins by dexamethasone. These regulatory proteins may interact with NHE3 in a phosphorylation-dependent manner and this interaction is necessary for translocation of NHE3 to the surface. Additional studies are needed to elucidate this hypothesis.

In summary, our work demonstrated that SGK1 specifically phosphorylates NHE3 at Ser663 in response to dexamethasone and mutation of S663 abolishes the stimulatory effect of dexamethasone on NHE3 transport activity. The stimulation of NHE3 activity was accompanied by increased NHE3 protein abundance at the plasma membrane. These findings suggest that SGK1 plays a pivotal role in activation of NHE3 in response to dexamethasone by phosphorylating NHE3 that stimulates insertion NHE3 protein into the plasma membrane.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-061418 and by the American Heart Association Southeast Affiliate. We thank the Emory Epithelial Pathobiology Research Development Center (supported by DK-064399) for IEC6 cells.


    ACKNOWLEDGMENTS
 
We are extremely grateful to Dr. Orson Moe for OK NHE3 cDNA and anti-OK NHE3 antiserum 5683, and for helpful discussions. We also thank Drs. H.-J. Lang and J. Punter at Aventis Pharma for providing HOE-694.


    FOOTNOTES
 

Address for reprint requests and other correspondence: C. C. Yun, Div. of Digestive Diseases, Whitehead Bldg., Suite 201, 615 Michael St., Atlanta, GA 30322 (e-mail: ccyun{at}emory.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Akhter S, Cavet ME, Tse CM, and Donowitz M. C-terminal domains of Na+/H+ exchanger isoform 3 are involved in the basal and serum-stimulated membrane trafficking of the exchanger. Biochemistry 39: 1990–2000, 2000.[CrossRef][Medline]

2. Alvarez de la Rosa D, Coric T, Todorovic N, Shao D, Wang T, and Canessa CM. Distribution and regulation of expression of serum- and glucocorticoid-induced kinase-1 in the rat kidney. J Physiol 551: 455–466, 2003.[Abstract/Free Full Text]

3. Baum M, Amemiya M, Dwarakanath V, Alpern RJ, and Moe OW. Glucocorticoids regulate NHE-3 transcription in OKP cells. Am J Physiol Renal Fluid Electrolyte Physiol 270: F164–F169, 1996.[Abstract/Free Full Text]

4. Baum M, Biemesderfer D, Gentry D, and Aronson PS. Ontogeny of rabbit renal cortical NHE3 and NHE1: effect of glucocorticoids. Am J Physiol Renal Fluid Electrolyte Physiol 268: F815–F820, 1995.[Abstract/Free Full Text]

5. Baum M, Cano A, and Alpern RJ. Glucocorticoids stimulate Na+/H+ antiporter in OKP cells. Am J Physiol Renal Fluid Electrolyte Physiol 264: F1027–F1031, 1993.[Abstract/Free Full Text]

6. Baum M, Moe OW, Gentry DL, and Alpern RJ. Effect of glucocorticoids on renal cortical NHE-3 and NHE-1 mRNA. Am J Physiol Renal Fluid Electrolyte Physiol 267: F437–F442, 1994.[Abstract/Free Full Text]

7. Boehmer C, Embark HM, Bauer A, Palmada M, Yun CH, Weinman EJ, Endou H, Cohen P, Lahme S, Bichler KH, and Lang F. Stimulation of renal Na+ dicarboxylate cotransporter 1 by Na+/H+ exchanger regulating factor 2, serum and glucocorticoid inducible kinase isoforms, and protein kinase B. Biochem Biophys Res Commun 313: 998–1003, 2004.[CrossRef][Web of Science][Medline]

8. Borensztein P, Froissart M, Laghmani K, Bichara M, and Paillard M. RT-PCR analysis of Na+/H+ exchanger mRNAs in rat medullary thick ascending limb. Am J Physiol Renal Fluid Electrolyte Physiol 268: F1224–F1228, 1995.[Abstract/Free Full Text]

9. Brennan FE and Fuller PJ. Rapid upregulation of serum and glucocorticoid-regulated kinase (sgk) gene expression by corticosteroids in vivo. Mol Cell Endocrinol 166: 129–136, 2000.[CrossRef][Web of Science][Medline]

10. Brunet A, Park J, Tran H, Hu LS, Hemmings BA, and Greenberg ME. Protein kinase SGK mediates survival signals by phosphorylating the forkhead transcription factor FKHRL1 (FOXO3a). Mol Cell Biol 21: 952–965, 2001.[Abstract/Free Full Text]

11. Chen SY, Bhargava A, Mastroberardino L, Meijer OC, Wang J, Buse P, Firestone GL, Verrey F, and Pearce D. Epithelial sodium channel regulated by aldosterone-induced protein sgk. Proc Natl Acad Sci USA 96: 2514–2519, 1999.[Abstract/Free Full Text]

12. Chun J, Kwon T, Kim DJ, Park I, Chung G, Lee EJ, Hong SK, Chang SI, Kim HY, and Kang SS. Inhibition of mitogen-activated kinase kinase kinase 3 activity through phosphorylation by the serum- and glucocorticoid-induced kinase 1. J Biochem (Tokyo) 133: 103–108, 2003.[Abstract/Free Full Text]

13. Cohen ME, Wesolek J, McCullen J, Rys-Sikora K, Pandol S, Rood RP, Sharp GWG, and Donowitz M. Carbachol- and elevated Ca2+-induced translocation of fucntionally active protein kinase C to the brush border of rabbit ileal Na+ absorbing cells. J Clin Invest 88: 855–863, 1991.[Web of Science][Medline]

14. Collazo R, Fan L, Hu MC, Zhao H, Wiederkehr MR, and Moe OW. Acute regulation of Na+/H+ exchanger NHE3 by parathyroid hormone via NHE3 phosphorylation and dynamin-dependent endocytosis. J Biol Chem 275: 31601–31608, 2000.[Abstract/Free Full Text]

15. Debonneville C, Flores SY, Kamynina E, Plant PJ, Tauxe C, Thomas MA, Munster C, Chraibi A, Pratt JH, Horisberger JD, Pearce D, Loffing J, and Staub O. Phosphorylation of Nedd4–2 by Sgk1 regulates epithelial Na+ channel cell surface expression. EMBO J 20: 7052–7059, 2001.[CrossRef][Web of Science][Medline]

16. Di Sole F, Cerull R, Babich V, Quinones H, Gisler SM, Biber J, Murer H, Burckhardt G, Helmle-Kolb C, and Moe OW. Acute regulation of Na/H exchanger NHE3 by adenosine A1 receptors is mediated by calcineurin homologous protein. J Biol Chem 279: 2962–2974, 2004.[Abstract/Free Full Text]

17. Diakov A and Korbmacher C. A novel pathway of epithelial sodium channel activation involves a serum- and glucocorticoid-inducible kinase consensus motif in the C terminus of the channel’s {alpha}-subunit. J Biol Chem 279: 38134–38142, 2004.[Abstract/Free Full Text]

18. Firestone GL, Giampaolo JR, and O’Keeffe BA. Stimulus-dependent regulation of serum and glucocorticoid inducible protein kinase (SGK) transcription, subcellular localization and enzymatic activity. Cell Physiol Biochem 13: 1–12, 2003.[Web of Science][Medline]

19. Huang DY, Wulff P, Volkl H, Loffing J, Richter K, Kuhl D, Lang F, and Vallon V. Impaired regulation of renal K+ elimination in the sgk1-knockout mouse. J Am Soc Nephrol 15: 885–891, 2004.[Abstract/Free Full Text]

20. Itani OA, Campbell JR, Herrero J, Snyder PM, and Thomas CP. Alternate promoters and variable splicing lead to hNedd4–2 isoforms with a C2 domain and varying number of WW domains. Am J Physiol Renal Physiol 285: F916–F929, 2003.[Abstract/Free Full Text]

21. Kim JH, Lee-Kwon W, Park JB, Ryu SH, Yun CH, and Donowitz M. Ca2+-dependent inhibition of Na+/H+ exchanger 3 requires a NHE3/E3KARP/{alpha}-actinin-4 complex for oligomerization and endocytosis. J Biol Chem 277: 23714–23724, 2002.[Abstract/Free Full Text]

22. Kobayashi T and Cohen P. Activation of serum- and glucocorticoid-regulated protein kinase by agonists that activate phosphatidylinositide 3-kinase is mediated by 3-phosphoinositide-dependent protein kinase-1 (PDK1) and PDK2. Biochem J 339: 319–328, 1999.[CrossRef][Web of Science][Medline]

23. Kreis TE. Microinjected antibodies against the cytoplasmic domain of vesicular stomatis virus glycoprotein block its tranport to the cell surface. EMBO J 5: 931–941, 1986.[Web of Science][Medline]

24. Kurashima K, Yu FH, Cabado AG, Szabo EZ, Grinstein S, and Orlowski J. Identification of sites required for down-regulation of Na/H exchanger NHE3 activity by cAMP-dependent protein kinase. J Biol Chem 272: 28672–28679, 1997.[Abstract/Free Full Text]

25. Lamprecht G, Weinman EJ, and Yun CC. The role of NHERF and E3KARP in the cAMP-mediated inhibition of NHE3. J Biol Chem 273: 29972–29978, 1998.[Abstract/Free Full Text]

26. Lang F, Henke G, Embark HM, Waldegger S, Palmada M, Bohmer C, and Vallon V. Regulation of channels by the serum and glucocorticoid-inducible kinase–implications for transport, excitability, and cell proliferation. Cell Physiol Biochem 13: 41–50, 2003.[CrossRef][Web of Science][Medline]

27. Meneely R and Ghishan FK. Intestinal maturation in the rat: the effect of glucocorticoids on sodium, potassium, water and glucose absorption. Pediatr Res 16: 776–778, 1982.[Web of Science][Medline]

28. Muto S, Ebata S, Okada K, Saito T, and Asano Y. Glucocorticoid modulates Na+/H+ exchange activity in vascular smooth muscle cells by nongenomic and genomic mechanisms. Kidney Int 57: 2319–2333, 2000.[CrossRef][Web of Science][Medline]

29. Naray-Fejes-Toth A, Canessa C, Cleaveland ES, Aldrich G, and Fejes-Toth G. SGK is an aldosterone-induced kinase in the renal collecting duct Effects on epithelial Na+ channels. J Biol Chem 274: 16973–16978, 1999.[Abstract/Free Full Text]

30. Naray-Fejes-Toth A, Fejes-Toth G, Volk KA, and Stokes JB. SGK is a primary glucocorticoid-induced gene in the human. J Steroid Biochem Mol Biol 75: 51–56, 2000.[CrossRef][Web of Science][Medline]

31. Palmada M, Embark HM, Yun C, Bohmer C, and Lang F. Molecular requirements for the regulation of the renal outer medullary K+ channel ROMK1 by the serum- and glucocorticoid-inducible kinase SGK1. Biochem Biophys Res Commun 311: 629–634, 2003.[CrossRef][Web of Science][Medline]

32. Park J, Leong ML, Buse P, Maiyar AC, Firestone GL, and Hemmings BA. Serum and glucocorticoid-inducible kinase (SGK) is a target of the PI 3-kinase-stimulated signaling pathway. EMBO J 18: 3024–3033, 1999.[CrossRef][Web of Science][Medline]

33. Pearce D. SGK1 regulation of epithelial sodium transport. Cell Physiol Biochem 13: 13–20, 2003.[CrossRef][Web of Science][Medline]

34. Quaroni A, Tian JQ, Goke M, and Podolsky DK. Glucocorticoids have pleiotropic effects on small intestinal crypt cells. Am J Physiol Gastrointest Liver Physiol 277: G1027–G1040, 1999.[Abstract/Free Full Text]

35. Quaroni A, Wands J, Trelstad R, and Isselbacher K. Epithelioid cell cultures from rat small intestine. Characterization by morphologic and immunologic criteria. J Cell Biol 80: 248–265, 1979.[Abstract/Free Full Text]

36. Sakoda H, Gotoh Y, Katagiri H, Kurokawa M, Ono H, Onishi Y, Anai M, Ogihara T, Fujishiro M, Fukushima Y, Abe M, Shojima N, Kikuchi M, Oka Y, Hirai H, and Asano T. Differing roles of Akt and serum- and glucocorticoid-regulated kinase in glucose metabolism, DNA synthesis, and oncogenic activity. J Biol Chem 278: 25802–25807, 2003.[Abstract/Free Full Text]

37. Setiawan I, Henke G, Feng Y, Bohmer C, Vasilets LA, Schwarz W, and Lang F. Stimulation of Xenopus oocyte Na+,K+ ATPase by the serum and glucocorticoid-dependent kinase sgk1. Pflügers Arch 444: 426–431, 2002.[CrossRef][Web of Science][Medline]

38. Snyder PM, Olson DR, and Thomas BC. SGK modulates Nedd4–2-mediated inhibition of ENaC. J Biol Chem 277: 5–8, 2002.[Abstract/Free Full Text]

39. Verrey F, Loffing J, Zecevic M, Heitzmann D, and Staub O. SGK1: aldosterone-induced relay of Na+ transport regulation in distal kidney nephron cells. Cell Physiol Biochem 13: 21–28, 2003.[CrossRef][Web of Science][Medline]

40. Wagner CA, Ott M, Klingel K, Beck S, Melzig J, Friedrich B, Wild KN, Broer S, Moschen I, Albers A, Waldegger S, Tummler B, Egan ME, Geibel JP, Kandolf R, and Lang F. Effects of the serine/threonine kinase SGK1 on the epithelial Na+ channel (ENaC) and CFTR: implications for cystic fibrosis. Cell Physiol Biochem 11: 209–218, 2001.[CrossRef][Web of Science][Medline]

41. Wakabayashi S, Fafournoux P, Sardet C, and Pouyssegur J. The Na/H antiporter cytoplasmic domain mediates growth factor signals and contols "H+-sensing". Proc Natl Acad Sci USA 89: 2424–2428, 1992.[Abstract/Free Full Text]

42. Webster MK, Goya L, Ge Y, Maiyar AC, and Firestone GL. Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol 13: 2031–2040, 1993.[Abstract/Free Full Text]

43. Wulff P, Vallon V, Huang DY, Volkl H, Yu F, Richter K, Jansen M, Schlunz M, Klingel K, Loffing J, Kauselmann G, Bosl MR, Lang F, and Kuhl D. Impaired renal Na+ retention in the sgk1-knockout mouse. J Clin Invest 110: 1263–1268, 2002.[CrossRef][Web of Science][Medline]

44. Yoo D, Kim BY, Campo C, Nance L, King A, Maouyo D, and Welling PA. Cell surface expression of the ROMK (Kir 1.1) channel is regulated by the aldosterone-induced kinase, SGK-1, and protein kinase A. J Biol Chem 278: 23066–23075, 2003.[Abstract/Free Full Text]

45. Yun CC. Concerted roles of SGK1 and the Na+/H+ exchanger regulatory factor 2 (NHERF2) in regulation of NHE3. Cell Physiol Biochem 13: 29–40, 2003.[CrossRef][Web of Science][Medline]

46. Yun CC, Chen Y, and Lang F. Glucocorticoid activation of Na+/H+ exchanger isoform 3 revisited. The roles of SGK1 and NHERF2. J Biol Chem 277: 7676–7683, 2002.[Abstract/Free Full Text]

47. Yun CC, Lamprecht G, Forster DV, and Sidor A. NHE3 kinase A regulatory protein E3KARP binds the epithelial brush border Na+/H+ exchanger NHE3 and the cytoskeletal protein ezrin. J Biol Chem 273: 25856–25863, 1998.[Abstract/Free Full Text]

48. Yun CC, Oh S, Zizak M, Steplock D, Tsao S, Tse CM, Weinman EJ, and Donowitz M. cAMP-mediated inhibition of the epithelial brush border Na/H exchanger, NHE3, requires an associated regulatory protein. Proc Natl Acad Sci USA 94: 3010–3015, 1997.[Abstract/Free Full Text]

49. Yun CC, Palmada M, Embark HM, Fedorenko O, Feng Y, Henke G, Setiawan I, Boehmer C, Weinman EJ, Sandrasagra S, Korbmacher C, Cohen P, Pearce D, and Lang F. The serum and glucocorticoid inducible kinase SGK1 and the Na+/H+ exchange regulating factor NHERF2 synergize to stimulate the renal outer medullary K+ channel ROMK1. J Am Soc Nephrol 13: 2823–2830, 2002.[Abstract/Free Full Text]

50. Yun CHC, Gurubhagavatula S, Levine SA, Montgomery JLM, Cohen ME, Cragoe EJ, Pouyssegur J, Tse CM, and Donowitz M. Glucocorticoid stimulation of ileal Na+ absorptive cell brush border Na/H exchange and association with an increase in message for NHE-3, an epithelial Na/H exchanger isoform. J Biol Chem 268: 206–211, 1993.[Abstract/Free Full Text]

51. Zhang BH, Tang ED, Zhu T, Greenberg ME, Vojtek AB, and Guan KL. Serum- and glucocorticoid-inducible kinase SGK phosphorylates and negatively regulates B-Raf. J Biol Chem 276: 31620–31626, 2001.[Abstract/Free Full Text]

52. Zhao H, Wiederkehr MR, Fan L, Collazo RL, Crowder LA, and Moe OW. Acute inhibition of Na/H exchanger NHE-3 by cAMP. Role of protein kinase A and NHE-3 phosphoserines 552 and 605. J Biol Chem 274: 3978–3987, 1999.[Abstract/Free Full Text]

53. Zizak M, Lamprecht G, Steplock D, Tariq N, Shenolikar S, Donowitz M, Yun CH, and Weinman EJ. cAMP-induced phosphorylation and inhibition of Na+/H+ exchanger 3 (NHE3) are dependent on the presence but not the phosphorylation of NHE regulatory factor. J Biol Chem 274: 24753–24758, 1999.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J. Exp. Biol.Home page
R. T. Alexander and S. Grinstein
Tethering, recycling and activation of the epithelial sodium-proton exchanger, NHE3
J. Exp. Biol., June 1, 2009; 212(11): 1630 - 1637.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. W. Musch, A. Lucioni, and E. B. Chang
Aldosterone regulation of intestinal Na absorption involves SGK-mediated changes in NHE3 and Na+ pump activity
Am J Physiol Gastrointest Liver Physiol, November 1, 2008; 295(5): G909 - G919.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
R. Sarker, M. Gronborg, B. Cha, S. Mohan, Y. Chen, A. Pandey, D. Litchfield, M. Donowitz, and X. Li
Casein Kinase 2 Binds to the C Terminus of Na+/H+ exchanger 3 (NHE3) and Stimulates NHE3 Basal Activity by Phosphorylating a Separate Site in NHE3
Mol. Biol. Cell, September 1, 2008; 19(9): 3859 - 3870.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
V. A Stevens, S. Saad, P. Poronnik, C. A Fenton-Lee, T. S Polhill, and C. A Pollock
The role of SGK-1 in angiotensin II-mediated sodium reabsorption in human proximal tubular cells
Nephrol. Dial. Transplant., June 1, 2008; 23(6): 1834 - 1843.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
M. Donowitz and X. Li
Regulatory Binding Partners and Complexes of NHE3
Physiol Rev, July 1, 2007; 87(3): 825 - 872.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
D. Wang, H. Zhang, F. Lang, and C. C. Yun
Acute activation of NHE3 by dexamethasone correlates with activation of SGK1 and requires a functional glucocorticoid receptor
Am J Physiol Cell Physiol, January 1, 2007; 292(1): C396 - C404.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. M. Karinch, C.-M. Lin, Q. Meng, M. Pan, and W. W. Souba
Glucocorticoids have a role in renal cortical expression of the SNAT3 glutamine transporter during chronic metabolic acidosis
Am J Physiol Renal Physiol, January 1, 2007; 292(1): F448 - F455.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
G. Lamprecht and U. Seidler
The emerging role of PDZ adapter proteins for regulation of intestinal ion transport
Am J Physiol Gastrointest Liver Physiol, November 1, 2006; 291(5): G766 - G777.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
C. Sandu, F. Artunc, M. Palmada, R. Rexhepaj, F. Grahammer, A. Hussain, C. Yun, D. R. Alessi, and F. Lang
Impaired intestinal NHE3 activity in the PDK1 hypomorphic mouse
Am J Physiol Gastrointest Liver Physiol, November 1, 2006; 291(5): G868 - G876.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
F. Lang, C. Bohmer, M. Palmada, G. Seebohm, N. Strutz-Seebohm, and V. Vallon
(Patho)physiological Significance of the Serum- and Glucocorticoid-Inducible Kinase Isoforms.
Physiol Rev, October 1, 2006; 86(4): 1151 - 1178.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/4/C802    most recent
00597.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, D.
Right arrow Articles by Yun, C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, D.
Right arrow Articles by Yun, C. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.