|
|
||||||||
CELLULAR METABOLISM
Department of Oncology, Lombardi Comprehensive Cancer Center, Georgetown University Medical Center, Washington, District of Columbia
Submitted 23 February 2005 ; accepted in final form 24 March 2005
| ABSTRACT |
|---|
|
|
|---|
protease-activated receptor-2; hepatocyte growth factor; urokinase; sphingosine 1-phosphate; Kunitz domain
Whereas HAI-1 functions as the physiological inhibitor of matriptase, this inhibitor is also involved in matriptase activation (24). Like most other serine proteases, activation of matriptase requires cleavage at its canonical activation motif to convert a single-chain zymogen to the two-chain active enzyme (1). However, compared with most other serine proteases, in which activation is conducted by other active proteases, matriptase activation depends on its own active site triad (24). Therefore, matriptase must transactivate itself, whereby interactions between at least two matriptase zymogens, and possibly other proteins, such as HAI-1, leads to the activation cleavage (24). This hypothesis has been further supported by the fact that in immortal human mammary epithelial cells, matriptase and HAI-1 are cotranslocated and accumulated at activation foci, either at cell-cell junctions or vesicle-like structures, during matriptase activation induced, respectively, by blood-borne sphingosine 1-phosphate (S1P) (1, 2, 9) or suramin, a sulfide-rich chemical (13). The involvement of HAI-1 in matriptase activation therefore provides an efficient mechanism to inhibit active matriptase. Consequently, activated matriptase is almost exclusively detected in complexes bound to HAI-1 (13). The dual functions of HAI-1 in both matriptase activation and inhibition suggest a critical role of the inhibitor in the regulation of matriptase function, not only in suppression of undesired matriptase proteolysis, but also in the regulation of matriptase activation. In the present study, we further explored the role of HAI-1 in the regulation of matriptase activation by reducing the expression levels of HAI-1 or sequestering HAI-1 using an anti-HAI-1 monoclonal antibody. Interestingly, reduced HAI-1 expression or availability caused spontaneous activation of matriptase and enhanced activation of matriptase by S1P. Furthermore, this spontaneous activation of matriptase was closely associated with a defect in the trafficking of the protease, and coexpression of HAI-1 with matriptase corrected this defect. These results suggest that regulation of matriptase by HAI-1 may occur at multiple levels, including protein biosynthesis, intracellular trafficking, prevention of uncontrolled spontaneous activation, regulated activation, and ectodomain shedding.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture conditions. Immortalized 184 A1N4 human mammary epithelial cells were a gift from Dr. Martha Stampfer (Lawrence Berkeley National Laboratory, Berkeley, CA), and maintained as described in a previous study (1). BT549 human breast cancer cells were cultured in Iscove's minimal essential media (Invitrogen, Rockville, MD) supplemented with 5% fetal bovine serum in a humidified chamber at 37°C and 5% CO2.
Monoclonal antibodies and Western blot analysis. Human matriptase protein was detected using the M32 monoclonal antibody, that recognizes the third LDL receptor domain of matriptase and can interact with both the latent (one chain) and activated (two chain) forms of the protease (9, 15). Activated matriptase was detected by the M69 monoclonal antibody (MAb), which recognizes an epitope present only in the activated, two-chain form of the enzyme (1, 2). Human HAI-1 was detected with the use of the HAI-1-specific monoclonal antibody M19 (15). The latent form matriptase could be detected by MAb M32 at either 70 kDa (NH2 terminal processed form) or at 93 kDa (the full-length matriptase, seen mainly with forced expression of matriptase). The activated matriptase was detected by MAbs M69 or M19 at 120 kDa (70-kDa active matriptase plus full-length HAI-1) or at 85 kDa (the full-length HAI-1 complexed with the serine protease domain of matriptase). M32 MAb only recognizes the 120-kDa complex, but not the 85-kDa complex (13). M19 MAb also detects the 55-kDa full-length HAI-1.
Immunofluorescence microscopy. Cells were plated onto microcover glasses and grown for 2 days. Cells received different treatments, as indicated in each figure. Cells were then fixed and permeabilized in phosphate-buffered saline containing in 0.05% Triton X-100 and 3.7% formaldehyde for 20 min at room temperature, followed by three washes with phosphate-buffered saline. Matriptase, activated matriptase, and HAI-1 were detected with Alexa Fluor dye-conjugated M32, M69, and M19 monclonal antibodies, respectively. F-actin was visualized with Texas red-conjugated phalloidin (Molecular Probes), and nuclei were stained with 4,6-diamidino-2-phenylindole. Golgi were visualized using the GM130 monoclonal antibody (BD Biosciences, Palo Alto, CA), followed by a secondary goat anti-mouse FITC-conjugated antibody. For costaining of Golgi and matriptase, the GM130 antibody staining was followed by Alexa Fluor 594-conjugated M32 antibody and a 100-fold excess of mouse IgG to prevent the cross-reaction of any GM130-bound goat anti-mouse FITC with the Alexa Fluor 594-conjugated M32 monoclonal antibody. After fluorescent staining, cover glasses were mounted with Prolong Antifade (Molecular Probes), and the fluorescent images were captured by the MetaVue software package (Molecular Devices) on a Nikon Eclipse E600 digital fluorescence microscope.
HAI-1 small interfering RNA. Two independent small interfering (si)RNA target sites were selected in HAI-1 using standard design criteria (5): HAI-1A, AACUGCAACUUGGCGCUAGU; and HAI-1B, AGAUCUGCAAG AGUUUCGUU. Synthetic siRNA oligos against these targets were purchased from Dharmacon in a duplex-ready 2'-angiotensin-converting enzyme-protected form and prepared and stored according to the manufacturer's instructions. Cells plated on 18-mm-thick glass coverslips, for immunofluorescence microscopy, or in tissue culture dishes, were transfected with the siRNA using oligofectamine and Opti-MEM medium (Invitrogen, Carlsbad, CA), according to the manufacturer's instructions. Identical results were obtained with HAI-1A and HAI-1B (11), and control experiments that used siRNA directed against an irrelevant gene had no effect.
Constructs and transfections. The cDNA clones for the full-length human matriptase coding sequence, or the full-length human HAI-1 coding sequence in the vector pcDNA3.1 (Invitrogen), were used in transient transfections. These constructs were also used to make site-directed mutants of matriptase or HAI-1. For making site-directed mutations, the QuikChange Site Directed Mutagenesis Kit (Stratagene, La Jolla, CA) was used with primers containing appropriate nucleotide changes, according to the manufacturer's protocol. All deletion mutants were confirmed by DNA sequencing. For each mutant, at least two separately isolated expression constructs were isolated and tested in transient transfections. Transient transfection of human matriptase or human HAI-1 constructs (wild type or mutant) was accomplished using Fugene 6 transfection reagent (Roche Diagnostics, Indianapolis, IN), according to the manufacturer's protocol. When conducting cotransfections, the amount of DNA used with the transfection reagent was kept constant for each individual transfection by including empty vector pcDNA3.1 DNA where appropriate.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
|
HAI-1 is required for expression of matriptase. Given these complex and well-coordinated relationships between matriptase and HAI-1, it seems likely that HAI-1 may also play a role during matriptase biosynthesis and degradation. This notion was first supported when we attempted to exogenously express matriptase in BT549 breast cancer cells that do not endogenously express either matriptase or HAI-1. When BT549 cells were transiently transfected with wild-type matriptase alone, only a very low level of matriptase protein was detected by Western blot analysis with the use of anti-matriptase MAb M32 on long exposure of blots. However, transient transfection with a cDNA coding for HAI-1 resulted in strong expression of exogenous HAI-1 in these cells (Fig. 6). When the protease was cotransfected with the inhibitor, much higher levels of matriptase were seen. The poor expression of matriptase, when the protease was transfected alone, may result from its proteolytic activity because exogenous expression of matriptase mutants altered in the catalytic triad (S805A matriptase) or in the substrate binding pocket (D799A matriptase) were achieved in BT549 breast cancer cells independently of the presence of HAI-1 (Fig. 6). Whereas high levels of matriptase expression were achieved for the matriptase mutant altered in its active site triad, coexpression of the inactive catalytic triad matriptase mutant with wild-type matriptase caused poor expression of both matriptase species (Fig. 6). These results suggest that unopposed matriptase proteolytic activity could be toxic for its expression, and that the presence of HAI-1 corrects this toxic effect, leading to higher levels of matriptase expression.
|
|
The first Kunitz domain, but not the second, is required for HAI-1 to facilitate matriptase intracellular trafficking. Because the intracellular trafficking of matriptase depended on HAI-1, we were able to test which domains in HAI-1 were essential for protease expression and trafficking. HAI-1 contains two Kunitz-type serine protease inhibitory domains, Kunitz domain I (at the amino terminus) and Kunitz domain II (at the carboxyl terminus), with an intervening LDL receptor class A domain (25) (Fig. 7).
The Kunitz domain is an
60 amino acid long-serine protease inhibitory domain for which the bovine basic pancreatic trypsin inhibitor represents the prototypic structure (4). The P1 residue of Kunitz-type inhibitory domains (the amino acid residue COOH terminal to the second conserved cysteine residue) is recognized as the active center responsible for the inhibitory specificity. For example, the corresponding amino acid residues in the Kunitz domains of HAI-1 are Arg260 in domain I and Lys385 in domain II, and therefore these Kunitz domains are predicted to be specific for trypsin-like serine proteases, such as matriptase (interacting with Asp799 in the substrate binding pocket of matriptase). Mutation of Arg260 will completely abolish the inhibitory activity of a Kunitz domain. A previous study (6) of molecular modeling strongly suggested that the first, but not the second, Kunitz domain of HAI-1 is responsible for the inhibition of matriptase. In addition to Arg260, Arg258 was also suggested to be crucial for the activity of Kunitz domain I. Therefore, we constructed point mutations at these three critical basic residues in Kunitz domains I and II (Arg258, Arg260, and Lys385).
Mutation of critical arginine residues in the first Kunitz domain of HAI-1 (R258L and R260L HAI-1) completely abolished the ability of HAI-1 to facilitate the intracellular trafficking of matriptase (Fig. 8). In cotransfection experiments with these HAI-1 mutants, matriptase was poorly expressed, as determined by M32 Western blot analysis, and did not traffic properly, as determined by matriptase immunofluorescence (data not shown). However, mutation of a critical basic residue in the second Kunitz domain of HAI-1 (K385L HAI-1) did not affect the ability of HAI-1 to facilitate matriptase trafficking because matriptase expressed well (Fig. 8) and underwent proper intracellular trafficking, as confirmed by matriptase immunofluorescence (data not shown). It should be noted that the R258L and R260L HAI-1 mutants did not express well when transfected with matriptase compared with the K385L HAI-1 mutant (Fig. 8). However, this was caused by the defect in intracellular trafficking created by unopposed matriptase activity, and not by poor transfection efficiency, as determined by immunofluorescence staining (data not shown). These results suggest that matriptase proteolytic activity, which could result from spontaneous activation in the absence of HAI-1, generally interferes with the trafficking of transmembrane proteins when transfected in the absence of HAI-1.
|
| DISCUSSION |
|---|
|
|
|---|
Reduced expression of HAI-1 by siRNA resulted in spontaneous activation of matriptase. This suggests that maintenance of a high HAI-1-to-matriptase ratio is necessary to prevent uncontrolled spontaneous matriptase activation. We have estimated that 184 A1N4 mammary epithelial cells express 10 times as much HAI-1 as matriptase (13). During S1P-induced matriptase activation, decreased levels of bioavailable HAI-1, achieved either by siRNA technology or by interference of HAI-1 function by anti-HAI-1 MAb M19, could result in a less efficient inhibition of active matriptase. This could result in the enhanced activation of latent matriptase by active matriptase, due to the perfect match between its cleavage site preference and the flanking sequences of the activation motif of matriptase. Thus there may be two different mechanisms at work to activate matriptase: latent matriptase activating latent matriptase and active matriptase activating latent matriptase. The former occurs to create the initial active matriptase molecules, and only occurs when the active site triad of matriptase is intact (24). The latter could serve to extend the activation level, and is regulated by the level or accessibility of HAI-1.
It seems paradoxical that matriptase activation requires its cognate inhibitor, HAI-1. This function of HAI-1 in matriptase activation requires its LDL receptor class A domain (24). In contrast, the Kunitz domain I of HAI-1 is essential for matriptase expression and inhibition (12). The participation of HAI-1 in matriptase activation allows HAI-1 to have direct access to active matriptase. This would ensure that HAI-1 is present at the site of matriptase activation, ready to inhibit the active protease. This close connection between matriptase activation and inhibition could allow the active protease only a very short period of time to act on its substrates, thus maintaining tight control of the enzyme. It is plausible that matriptase substrates may also be involved in matriptase activation, in a similar fashion to the inhibitor. This would allow matriptase to activate its substrates before HAI-1 inhibited the protease.
In our previous studies (1), activation of matriptase was followed by the shedding of matriptase and HAI-1 from the cell surface. The membrane-bound 120-kDa matriptase-HAI-1 complex contains the full-length HAI-1 and the 70-kDa matriptase. Cleavage at HAI-1 to release its ectodomains from the transmembrane domain is required for shedding of the matriptase-HAI-1 complex. In light of the connection between matriptase activation and shedding of matriptase-HAI-1 complex (1), the protease(s) responsible for the shedding may be one (or more) of the substrates of matriptase.
In conclusion, HAI-1 is not only the cognate inhibitor of matriptase, but also is involved in almost every aspect of matriptase functionality and regulation. We now show that HAI-1 is essential for preventing spontaneous activation of matriptase. This function is important for the intracellular trafficking and proper expression of the protease. This also prevents uncontrolled activation of the protease. HAI-1 seems to simultaneously participate in autoproteolytic activation and inhibition of matriptase, and has a role in subsequent shedding of the protease. The regulation of matriptase by HAI-1 from its biosynthesis to its removal from the cell surface may ensure that this potentially hazardous enzyme functions properly, thus avoiding harmful effects.
| GRANTS |
|---|
|
|
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Benaud C, Oberst M, Hobson JP, Spiegel S, Dickson RB, and Lin CY. Sphingosine 1-phosphate, present in serum-derived lipoproteins, activates matriptase. J Biol Chem 277: 1053910546, 2002.
3. Benaud CM, Oberst M, Dickson RB, and Lin CY. Deregulated activation of matriptase in breast cancer cells. Clin Exp Metastasis 19: 639649, 2002.[CrossRef][Web of Science][Medline]
4. Bode W and Huber R. Natural protein proteinase inhibitors and their interaction with proteinases. Eur J Biochem 204: 433451, 1992.[Web of Science][Medline]
5. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, and Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411: 494498, 2001.[CrossRef][Medline]
6. Friedrich R, Fuentes-Prior P, Ong E, Coombs G, Hunter M, Oehler R, Pierson D, Gonzalez R, Huber R, Bode W, and Madison EL. Catalytic domain structures of MT-SP1/matriptase, a matrix-degrading transmembrane serine proteinase. J Biol Chem 277: 21602168, 2002.
7. Galkin AV, Mullen L, Fox WD, Brown J, Duncan D, Moreno O, Madison EL, and Agus DB. CVS-3983, a selective matriptase inhibitor, suppresses the growth of androgen independent prostate tumor xenografts. Prostate 61: 228235, 2004.[CrossRef][Web of Science][Medline]
8. Hooper JD, Clements JA, Quigley JP, and Antalis TM. Type II transmembrane serine proteases. Insights into an emerging class of cell surface proteolytic enzymes. J Biol Chem 276: 857860, 2001.
9. Hung RJ, Hsu I, Dreiling JL, Lee MJ, Williams CA, Oberst MD, Dickson RB, and Lin CY. Assembly of adherens junctions is required for sphingosine 1-phosphate-induced matriptase accumulation and activation at mammary epithelial cell-cell contacts. Am J Physiol Cell Physiol 286: C1159C1169, 2004.
10. Kataoka H, Suganuma T, Shimomura T, Itoh H, Kitamura N, Nabeshima K, and Koono M. Distribution of hepatocyte growth factor activator inhibitor type 1 (HAI-1) in human tissues. Cellular surface localization of HAI-1 in simple columnar epithelium and its modulated expression in injured and regenerative tissues. J Histochem Cytochem 47: 673682, 1999.
11. Kim MG, Chen C, Lyu MS, Cho EG, Park D, Kozak C, and Schwartz RH. Cloning and chromosomal mapping of a gene isolated from thymic stromal cells encoding a new mouse type II membrane serine protease, epithin, containing four LDL receptor modules and two CUB domains. Immunogenetics 49: 420428, 1999.[CrossRef][Web of Science][Medline]
12. Kirchhofer D, Peek M, Li W, Stamos J, Eigenbrot C, Kadkhodayan S, Elliott JM, Corpuz RT, Lazarus RA, and Moran P. Tissue expression, protease specificity, and Kunitz domain functions of hepatocyte growth factor activator inhibitor-1B (HAI-1B), a new splice variant of HAI-1. J Biol Chem 278: 3634136349, 2003.
13. Lee MS, Kiyomiya K, Benaud C, Dickson RB, and Lin CY. Simultaneous activation and HAI-1-mediated inhibition of matriptase induced at activation foci in immortal human mammary epithelial cells. Am J Physiol Cell Physiol 288: C932C941, 2005.
14. Lee SL, Dickson RB, and Lin CY. Activation of hepatocyte growth factor and urokinase/plasminogen activator by matriptase, an epithelial membrane serine protease. J Biol Chem 275: 3672036725, 2000.
15. Lin CY, Anders J, Johnson M, and Dickson RB. Purification and characterization of a complex containing matriptase and a Kunitz-type serine protease inhibitor from human milk. J Biol Chem 274: 1823718242, 1999.
16. Lin CY, Anders J, Johnson M, Sang QA, and Dickson RB. Molecular cloning of cDNA for matriptase, a matrix-degrading serine protease with trypsin-like activity. J Biol Chem 274: 1823118236, 1999.
17. Lin CY, Wang JK, Torri J, Dou L, Sang QA, and Dickson RB. Characterization of a novel, membrane-bound, 80-kDa matrix-degrading protease from human breast cancer cells. Monoclonal antibody production, isolation, and localization. J Biol Chem 272: 91479152, 1997.
18. List K, Haudenschild CC, Szabo R, Chen W, Wahl SM, Swaim W, Engelholm LH, Behrendt N, and Bugge TH. Matriptase/MT-SP1 is required for postnatal survival, epidermal barrier function, hair follicle development, and thymic homeostasis. Oncogene 21: 37653779, 2002.[CrossRef][Web of Science][Medline]
19. List K, Szabo R, Wertz PW, Segre J, Haudenschild CC, Kim SY, and Bugge TH. Loss of proteolytically processed filaggrin caused by epidermal deletion of matriptase/MT-SP1. J Cell Biol 163: 901910, 2003.
20. Miyazawa K, Shimomura T, Kitamura A, Kondo J, Morimoto Y, and Kitamura N. Molecular cloning and sequence analysis of the cDNA for a human serine protease reponsible for activation of hepatocyte growth factor. Structural similarity of the protease precursor to blood coagulation factor XII. J Biol Chem 268: 1002410028, 1993.
21. Netzel-Arnett S, Hooper JD, Szabo R, Madison EL, Quigley JP, Bugge TH, and Antalis TM. Membrane anchored serine proteases: a rapidly expanding group of cell surface proteolytic enzymes with potential roles in cancer. Cancer Metastasis Rev 22: 237258, 2003.[CrossRef][Web of Science][Medline]
22. Oberst M, Anders J, Xie B, Singh B, Ossandon M, Johnson M, Dickson RB, and Lin CY. Matriptase and HAI-1 are expressed by normal and malignant epithelial cells in vitro and in vivo. Am J Pathol 158: 13011311, 2001.
23. Oberst MD, Singh B, Ossandon M, Dickson RB, Johnson MD, and Lin CY. Characterization of matriptase expression in normal human tissues. J Histochem Cytochem 51: 10171025, 2003.
24. Oberst MD, Williams CA, Dickson RB, Johnson MD, and Lin CY. The activation of matriptase requires its noncatalytic domains, serine protease domain, and its cognate inhibitor. J Biol Chem 278: 2677326779, 2003.
25. Shimomura T, Denda K, Kitamura A, Kawaguchi T, Kito M, Kondo J, Kagaya S, Qin L, Takata H, Miyazawa K, and Kitamura N. Hepatocyte growth factor activator inhibitor, a novel Kunitz-type serine protease inhibitor. J Biol Chem 272: 63706376, 1997.
26. Suzuki M, Kobayashi H, Kanayama N, Saga Y, Suzuki M, Lin CY, Dickson RB, and Terao T. Inhibition of tumor invasion by genomic down-regulation of matriptase through suppression of activation of receptor-bound pro-urokinase. J Biol Chem 279: 1489914908, 2004.
27. Szabo R, Wu Q, Dickson RB, Netzel-Arnett S, Antalis TM, and Bugge TH. Type II transmembrane serine proteases. Thromb Haemost 90: 185193, 2003.[Web of Science][Medline]
28. Takeuchi T, Harris JL, Huang W, Yan KW, Coughlin SR, and Craik CS. Cellular localization of membrane-type serine protease 1 and identification of protease-activated receptor-2 and single-chain urokinase-type plasminogen activator as substrates. J Biol Chem 275: 2633326342, 2000.
29. Takeuchi T, Shuman MA, and Craik CS. Reverse biochemistry: use of macromolecular protease inhibitors to dissect complex biological processes and identify a membrane-type serine protease in epithelial cancer and normal tissue. Proc Natl Acad Sci USA 96: 1105411061, 1999.
30. Tanimoto H, Underwood LJ, Wang Y, Shigemasa K, Parmley TH, and O'Brien TJ. Ovarian tumor cells express a transmembrane serine protease: a potential candidate for early diagnosis and therapeutic intervention. Tumour Biol 22: 104114, 2001.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
Y. Miyake, M. Yasumoto, S. Tsuzuki, T. Fushiki, and K. Inouye Activation of a Membrane-Bound Serine Protease Matriptase on the Cell Surface J. Biochem., August 1, 2009; 146(2): 273 - 282. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Ramsay, J. D. Hooper, A. R. Folgueras, G. Velasco, and C. Lopez-Otin Matriptase-2 (TMPRSS6): a proteolytic regulator of iron homeostasis Haematologica, June 1, 2009; 94(6): 840 - 849. [Abstract] [Full Text] [PDF] |
||||
![]() |
I-C. Tseng, F.-P. Chou, S.-F. Su, M. Oberst, N. Madayiputhiya, M.-S. Lee, J.-K. Wang, D. E. Sloane, M. Johnson, and C.-Y. Lin Purification from human milk of matriptase complexes with secreted serpins: mechanism for inhibition of matriptase other than HAI-1 Am J Physiol Cell Physiol, August 1, 2008; 295(2): C423 - C431. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kojima, S. Tsuzuki, T. Fushiki, and K. Inouye Roles of Functional and Structural Domains of Hepatocyte Growth Factor Activator Inhibitor Type 1 in the Inhibition of Matriptase J. Biol. Chem., February 1, 2008; 283(5): 2478 - 2487. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-S. Lee, I-C. Tseng, Y. Wang, K.-i. Kiyomiya, M. D. Johnson, R. B. Dickson, and C.-Y. Lin Autoactivation of matriptase in vitro: requirement for biomembrane and LDL receptor domain Am J Physiol Cell Physiol, July 1, 2007; 293(1): C95 - C105. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Bhatt, A. Welm, C. J. Farady, M. Vasquez, K. Wilson, and C. S. Craik Coordinate expression and functional profiling identify an extracellular proteolytic signaling pathway PNAS, April 3, 2007; 104(14): 5771 - 5776. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Generali, S. B. Fox, A. Berruti, J. W. Moore, M. P. Brizzi, N. Patel, G. Allevi, S. Bonardi, S. Aguggini, A. Bersiga, et al. Regulation of Hepatocyte Growth Factor Activator Inhibitor 2 by Hypoxia in Breast Cancer Clin. Cancer Res., January 15, 2007; 13(2): 550 - 558. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mori, G. Ishikawa, S.-S. Luo, T. Mishima, T. Goto, J. M. Robinson, S. Matsubara, T. Takeshita, H. Kataoka, and T. Takizawa The Cytotrophoblast Layer of Human Chorionic Villi Becomes Thinner but Maintains Its Structural Integrity During Gestation Biol Reprod, January 1, 2007; 76(1): 164 - 172. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-i. Kiyomiya, M.-S. Lee, I-C. Tseng, H. Zuo, R. J. Barndt, M. D. Johnson, R. B. Dickson, and C.-Y. Lin Matriptase activation and shedding with HAI-1 is induced by steroid sex hormones in human prostate cancer cells, but not in breast cancer cells Am J Physiol Cell Physiol, July 1, 2006; 291(1): C40 - C49. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |