Am J Physiol Cell Physiol Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 289: C437-C443, 2005. First published March 23, 2005; doi:10.1152/ajpcell.00365.2004
0363-6143/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/2/C437    most recent
00365.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kischel, P.
Right arrow Articles by Martial, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kischel, P.
Right arrow Articles by Martial, J.

MUSCLE CELL BIOLOGY AND CELL MOTILITY

Expression and functional properties of four slow skeletal troponin T isoforms in rat muscles

P. Kischel,1,2,* B. Bastide,2,* M. Muller,1 F. Dubail,1 F. Offredi,1 J. P. Jin,3 Y. Mounier,2 and J. Martial1

1Laboratoire de Biologie Moléculaire et Génie Génétique, Université de Liège, Campus du Sart-Tilman, Liege, Belgium; 2Laboratoire de Plasticité Neuromusculaire, Université des Sciences et Technologies de Lille, Institut Fédératif de Recherche 118, Unité Propre de Recherches de l’Enseignement Supérieur Équipe d’Accueil 1032, Villeneuve d’Ascq Cedex, France; and 3Section of Molecular Cardiology, Evanston Hospital, Evanston, Illinois

Submitted 28 July 2004 ; accepted in final form 21 March 2005


    ABSTRACT
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
We investigated the expression and functional properties of slow skeletal troponin T (sTnT) isoforms in rat skeletal muscles. Four sTnT cDNAs were cloned from the slow soleus muscle. Three isoforms were found to be similar to sTnT1, sTnT2, and sTnT3 isoforms described in mouse muscles. A new rat isoform, with a molecular weight slightly higher than that of sTnT3, was discovered. This fourth isoform had never been detected previously in any skeletal muscle and was therefore called sTnTx. From both expression pattern and functional measurements, it appears that sTnT isoforms can be separated into two classes, high-molecular-weight (sTnT1, sTnT2) and low-molecular-weight (sTnTx, sTnT3) isoforms. By comparison to the apparent migration pattern of the four recombinant sTnT isoforms, the newly described low-molecular-weight sTnTx isoform appeared predominantly and typically expressed in fast skeletal muscles, whereas the higher-molecular-weight isoforms were more abundant in slow soleus muscle. The relative proportion of the sTnT isoforms in the soleus was not modified after exposure to hindlimb unloading (HU), known to induce a functional atrophy and a slow-to-fast isoform transition of several myofibrillar proteins. Functional data gathered from replacement of endogenous troponin complexes in skinned muscle fibers showed that the sTnT isoforms modified the Ca2+ activation characteristics of single skeletal muscle fibers, with sTnT2 and sTnT1 conferring a similar increase in Ca2+ affinity higher than that caused by low-molecular-weight isoforms sTnTx and sTnT3. Thus we show for the first time the presence of sTnT in fast muscle fibers, and our data show that the changes in neuromuscular activity on HU are insufficient to alter the sTnT expression pattern.

skinned fibers; skeletal muscle; troponin subunit exchange; hindlimb unloading; atrophy


PLASTICITY OF either motor or regulatory contractile proteins is crucial for adaptation of muscle function in response to exercise, disuse, environmental influence, or pathological processes. This plasticity is based on the polymorphism of these proteins, as they usually exist in several isoforms. In contrast to the extensively studied myosin isoforms (25), little is known about the expression of the slow isoforms of troponin T (TnT), a subunit of the troponin complex. In addition to their structural role, TnT isoforms play a role in the regulation of contraction. This has been shown in vitro (21, 31) as well as in skinned skeletal muscle fibers, in which TnT isoforms differently modulate the intrinsic cooperativity (2, 29), Ca2+ sensitivity (26), and protein-protein interactions within the thin filament (20), leading to a "fine-tuning" effect in the muscular activation process. Three distinct genes encode, respectively, cardiac TnT (cTnT; Ref. 7), slow skeletal TnT (sTnT; Ref. 10), and fast skeletal TnT (fTnT; Ref. 5). Each gene gives rise to several isoforms by alternative mRNA splicing (1). In the rat fTnT gene, the amino-terminal hypervariable region can potentially lead to 64 putative isoforms (6). However, only four fTnT isoforms have been described in rat muscle (2), and three sTnT isoforms were recently detected by standard analytic electrophoresis in mouse or rat (2, 15).

Here we show that the diversity of sTnT isoforms is higher than previously thought, because a fourth sTnT isoform was found in rat muscles. Our goal was to investigate the mRNA and protein expression levels of the different sTnT isoforms in the slow rat soleus muscle as well as in a model of functional atrophy allowing a slow-to-fast phenotype transition, namely, hindlimb unloading (HU). In addition, we studied sTnT expression levels in two fast muscles as well as the functional properties of the different sTnT isoforms by substituting slow troponin complexes for fast troponin subunits in fast skinned muscle fibers.

Our data show a tissue-specific expression pattern of sTnT isoforms that is not modified by HU. Moreover, the four sTnT isoforms can be separated into two classes according to their ability to modulate Ca2+ activation characteristics.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals and Muscle Preparation The experiments as well as the maintenance conditions of the animals received authorization from the Ministry of Agriculture and the Ministry of Education (veterinary service of health and animal protection, authorization no. 03805). The experiments were performed in accordance with the National Research Council Guide for the Care and Use of Laboratory Animals.

Experiments were carried out on two groups of adult male Wistar rats (~300 g) anesthetized with pentobarbital sodium (3 mg/kg). The first group (n = 3) was composed of control animals. The second group (n = 3) was composed of animals submitted to 15 days of HU, an animal model for functional atrophy (22). In the HU experiment, the rats were suspended by the tail to induce hindlimb muscle unloading and atrophy. The two groups of animals were matched for age and weight. The slow soleus muscle and the fast extensor digitorum longus (EDL) and tibialis anterior (TA) muscles were used for sTnT expression.

Analysis of sTnT mRNAs and Cloning of sTnT cDNAs Isolation of mRNA was performed on control muscles with a MicroPolyA Pure kit (Ambion). sTnT cDNAs were then amplified by RT-PCR (Titan One Step RT-PCR kit, Roche). The primer design was based on sTnT sequences available for the mouse (15), assuming a high degree of sequence conservation between the two rodent species. Two different pairs of primers were used. One pair of forward CCAGGATGTCAGACACCGA and reverse GTTCTGAAGCGCTGTTGCTC primers was designed to amplify the 5' alternatively spliced region for subsequent separation of the putative isoforms by gel electrophoresis. The second pair of synthetic oligonucleotides was designed to amplify the whole sTnT coding sequence from the ATG start codon to the TGA stop codon (forward primer: GGGAATTCCATATGTCAGACACCGAAGAACA, reverse primer: CATGCCATGGTCACTTCCAGCGGCCTCCAAC). The PCR products obtained with the second primer pair were cloned with a Topo TA cloning kit (Invitrogen). Sequencing of the cDNAs was performed on a 310 Applied Biosystems sequencing unit.

Recombinant Protein Expression sTnT. The cDNAs coding for the four different rat sTnT isoforms were transferred into a pET30a vector. Because sTnT cDNA contains many arginine codons, synthesis of sTnT was performed in BL21({lambda}DE3) CodonPlus RIL cells (Stratagene). Cells transformed with the pET expression vectors were grown overnight at 37°C. This culture was diluted 1:100 and induced at an optical density at 600 nm of 0.8 with 1 mM isopropyl {beta}-D-1-thiogalactopyranoside for 4–5 h. Bacterial pellets from 600-ml sTnT cultures were resuspended in 30 ml of homogenization buffer (50 mM Tris·HCl pH 8.5 and a cocktail of protease inhibitors from Sigma). The cells were lysed with a French cell press, and the lysate was centrifuged at 25,000 g for 30 min at 4°C. The supernatant was then loaded on an anion exchange column (HiTrap Q HP-Sepharose, Amersham Biosciences). TnT was eluted with an increasing gradient from 0 to 50% buffer containing 1 M NaCl.

Skeletal slow troponin C and troponin I. Rat skeletal slow troponin C (sTnC) and troponin I (sTnI) were cloned and expressed as described for sTnT, except that sTnI was loaded on a cation exchange column.

Troponin complex. Equimolar quantities of each subunit of the troponin complex were mixed in 6 M urea, 1 M NaCl, 50 mM Tris pH 8.0, 3 mM CaCl2, 2.5 mM MgCl2, and 1 mM DTT. After 1 h, the complex was successively dialyzed against decreased urea concentrations (4, 2, and 0 M) and then against decreased NaCl concentrations (0.8, 0.6, 0.3, and 0.1 M). The complex was then loaded on a HiTrap Q HP and eluted with an increasing gradient from 0.1 to 0.3 M NaCl. Only fractions containing equimolar quantities (1:1:1) of purified ternary complexes were pooled and dialyzed against (in mM) 20 MOPS pH 7.0, 180 NaCl, 3 CaCl2, 5 MgCl2, and 0.1 DTT.

Calcium Activation Characteristics of Single Skinned Skeletal Fibers Experimental setup. The experiments were carried out in a thermostatically controlled room (19 ± 1°C) as described previously (17). Briefly, the fibers were randomly removed from EDL muscles, and fibers of ~5 mm were sectioned into two segments. The first segment was dissolved and stored to serve as control for endogenous TnT expression analysis by electrophoresis. The second 2- to 2.5-mm fiber segment was connected to a force transducer (Fort 10, WPI) in an experimental chamber under constant stirring and submitted to TnT exchange.

Solutions. All solutions were described previously (16), and pCa values were calculated with the Fabiato (8) computer program. The calculation was performed with the stability constants listed for Ca2+ (24).

Determination of Ca2+ activation characteristics. The tension (T)-pCa curves were obtained as previously described (16). The steepness of the T-pCa curve was determined by the Hill coefficients nH, either n1 or n2, according to the following equation (4): P/P0 = {([Ca2+]/K)nH/[1 + ([Ca2+]/K)nH]}, where P/P0 is the normalized tension, [Ca2+] is Ca2+ concentration, and K is the apparent dissociation constant (pK = –log K = pCa50); n1 corresponds to P/P0 > 50% and n2 to P/P0 < 50% (23).

Exchange of troponin complexes. After T-pCa relationship determination in the presence of their endogenous troponin complexes, the fibers were put into rigor and were bathed with an excess of 1:1:1 recombinant complexes (sTnT-sTnC-sTnI) as previously described (19), with sTnT1, sTnT2, sTnTx, and sTnT3, at an average concentration of 1.5 mg/ml. Incubation time was 2 h, with slow stirring to ensure optimal displacement of endogenous troponin complexes. After T-pCa relationships were obtained, all fibers were dissolved in SDS sample buffer, heated at 90°C for 3 min, and stored at –80°C until electrophoretic analysis.

Biochemical Analysis at Protein Level For each technique, at least three experiments were carried out to ensure the reproducibility of the results.

SDS-PAGE. Separation of TnT isoforms of whole muscles, single fibers (intact segments and matching reconstituted segments), or recombinant proteins was performed by SDS-PAGE using 10–20% linear gradient gels (32). Proteins were detected by immunoblotting. To assess whether sTnTs were phosphorylated or not, alkaline phosphatase treatment was applied as previously described (13).

Immunoblotting. Electrotransfer to a 0.2-µm-pore size nitrocellulose sheet (Advantec MFS) was performed. The sTnT isoforms were detected with a highly specific monoclonal antibody (CT3-mAb) directed against sTnT (2, 15). Detection of fTnT was performed with a monoclonal antibody (JLT12, Sigma). TnT antibodies were revealed by an extravidin-biotin peroxidase staining kit (Sigma), and TnT isoforms were visualized by chemiluminescence (ECL, Amersham). Signal intensities were measured with a Multi Analyst system (Bio-Rad).

Statistical analysis. All data are reported as means ± SE. The statistical significance of the difference between means was determined with Student’s t-test or paired t-test when data were obtained from the same fiber under different experimental conditions. Differences at or above the 95% confidence level were considered significant.


    RESULTS
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of Rat sTnT cDNAs and mRNA Isoform Expression Using mRNA from rat soleus muscle, we cloned the cDNAs encoding sTnT isoforms, encompassing the complete coding region from the translational start (ATG) to the stop codons (TGA), with primers corresponding to the conserved sequences in the mouse sTnT sequences. In view of the high abundance of clones similar to mouse sTnT1 and sTnT2 (15 of 16), we took advantage of an AvaI restriction site, present in sTnT1 and sTnT2 (position 74–79, see Fig. 1B), but not in mouse sTnT3. We cloned the undigested ~800-bp cDNAs and found clones similar to mouse sTnT3, as well as clones containing three additional base pairs that had no matching equivalent in the mouse. This isoform is therefore referred to as sTnTx. The sequences of sTnT cDNAs were deposited under GenBank accession numbers AY334079, AY334080, AY334081, and AY334082 for sTnT1, sTnT2, sTnTx, and sTnT3, respectively. Protein sequence alignment of the three mouse sTnT isoforms along with the four predicted rat sTnT isoforms is shown in Fig. 1A. The differential splicing occurring in the rat led to four isoforms. sTnT1 is a 786-bp isoform. sTnT2 has only a 3-bp deletion relative to sTnT1 (GAA, encoding glutamic acid) and is thus 783 bp long. sTnTx and sTnT3 cDNAs lack 33 pb relative to sTnT1 and sTnT2 and are constituted of 753 and 750 bp, respectively. sTnTx vs. sTnT3 has the same codon difference as sTnT1 vs. sTnT2 (Fig. 1B).



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 1. A: comparison of the amino acid sequences of the slow skeletal troponin T (sTnT) isoforms of rat and mouse. Nucleotides or amino acids that are identical between isoforms are indicated by a dash. A slash indicates the absence of nucleotides or amino acids compared with mouse sTnT1. B: putative alternative splicing mechanism proposed for the generation of the 4 rat sTnTs, based on the mouse genomic sTnT sequence (14). Exons 5 (light gray) and 6' (dark gray) are highlighted. A slash indicates the absence of nucleotides compared with rat sTnT1.

 
To confirm in a separate experiment that the four mRNA isoforms are indeed expressed in soleus muscle, we assessed the sTnT expression pattern by analyzing the specific RT-PCR fragments generated from total soleus mRNA. To be able to separate the four cDNA isoforms directly on agarose gel, RT-PCR was performed with a primer pair designed to amplify a small 5' fragment covering the alternatively spliced region of sTnT isoforms. Four bands were clearly observed, the faintest band corresponding to sTnTx (Fig. 2).



View larger version (78K):
[in this window]
[in a new window]
 
Fig. 2. RT-PCR amplification of NH2-terminal fragments of rat sTnT. Left lane, DNA ladder (corresponding sizes in bp are indicated at left); center lane, negative control (N–, H2O); right lane, soleus muscle (SOL). Four fragments were obtained by using a forward primer (including the ATG start codon) and an internal reverse primer corresponding to conserved sequences of mouse sTnT. Gel: 3% agarose.

 
Protein Expression Recombinant sTnTs. The sTnT isoforms were bacterially expressed and purified to near homogeneity, and equal amounts of each recombinant sTnT were analyzed by Western blotting with the mouse monoclonal antibody CT3-mAb (15). As illustrated in Fig. 3A (lanes 14), an immunoreactive protein of the expected size was detected in each preparation. Interestingly, a distinct migration was observed between the sTnT1 and sTnT2 isoforms and between sTnTx and sTnT3, although these proteins differ by only a single glutamic acid. The signal intensity was equivalent for each recombinant sTnT, indicating that CT3-mAb recognized the four isoforms equally well.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3. Immunoblot analysis of the expression of sTnT in rat muscles using the monoclonal antibody CT3-mAb. A: recombinant sTnT1 (lane 1), sTnT2 (lane 2), sTnTx (lane 3), sTnT3 (lane 4) and homogenates of control soleus (lane 5) and soleus after hindlimb unloading (HU; lane 6). B: homogenates of tibialis anterior (lane 7), extensor digitorum longus (EDL; lane 8), and soleus (lane 9) muscles. Concentrations were 10 µg protein/lane, except for recombinant sTnT (1 µg/lane). Exposure times were 1 (lanes 16) and 10 (lanes 79) min.

 
Control conditions. We studied the protein expression levels of the four sTnT isoforms in soleus muscles dissected from adult rats. Using the purified sTnT isoforms produced in Escherichia coli as a reference (Fig. 3A, lanes 14), we could assume that the proteins recognized in the rat soleus muscle lysates (Fig. 3A, lane 5) correspond to sTnT1 and sTnT2 (the two upper bands with the highest molecular weight), whereas the faster-migrating band comigrates with the recombinant sTnT3. A band corresponding to sTnTx was detected in only two samples (data not shown). The relative levels of soleus sTnT isoform expression followed the overall scheme sTnT2 {approx} sTnT1 >> sTnT3 > sTnTx (when sTnTx is present; Table 1). It clearly appears that the four isoforms are expressed both at the mRNA and at the protein level, and that the relative amounts for each protein isoform are consistent with those deduced from the transcript expression analysis. We further investigated the expression pattern of sTnT isoforms in two fast rat muscles, EDL and TA, as illustrated in Fig. 3B. A band migrating at the same position as recombinant sTnTx was found to be predominant and specific to these fast muscles. In TA (Fig. 3B, lane 7) and EDL (Fig. 3B, lane 8), similar profiles of sTnT isoform expression were obtained: the two main isoforms corresponded to sTnTx and sTnT1. sTnT3 was present only at low levels. The band corresponding to recombinant sTnT2 was never expressed. It should be noted that the total sTnT expression was lower in all these fast muscles compared with the slow soleus muscle as illustrated in Fig. 3B. Indeed, relative to soleus, the total sTnT signal intensity was about 9- and 10-fold lower in TA and EDL, respectively.


View this table:
[in this window]
[in a new window]
 
Table 1. Mean staining intensity of sTnT immunoblots

 
HU conditions. The soleus muscle is particularly affected by HU and undergoes slow-to-fast phenotypic changes, as illustrated by the observed increase in fast TnT expression (2). The overall expression of sTnT1, sTnT2, and sTnT3 was slightly reduced (by 14 ± 1.5%; n = 3) after HU in the rat soleus. Moreover, sTnTx was never observed after HU, or its expression was too low to be detected. Thus no obvious difference in the relative expression pattern of the different sTnT isoforms was observed between HU and control soleus, the high-molecular-weight sTnTs being the predominant isoforms.

Ca2+ Activation Characteristics of Control and Reconstituted EDL Fibers To investigate the functional properties of the various sTnT isoforms in a physiologically relevant setup, the endogenous fast troponin complexes of skinned EDL fibers were replaced with complexes made of the three slow troponin subunits sTnT, sTnC, and sTnI. EDL fibers were chosen because 1) replacement of the endogenous fast troponin complex with a slow troponin complex was thought to induce noticeable changes in the T-pCa relationship and 2) it is easy to evaluate the disappearance of fTnT and the appearance of sTnT by immunoblotting after displacement of troponin complexes. As illustrated in the inset of Fig. 4, sTnT was not detected in the control EDL fibers (lane 1) and appeared only after the exchange period (lane 2). Conversely, fTnT was only clearly detected in the control segment (lane 3). The band that is observed after replacement (lane 4) is not a residual fTnT but the substituted sTnT migrating at the same level as fTnT2. Indeed, the membrane was not stripped after sTnT detection but directly reprobed with fTnT.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 4. Ca2+ activation characteristics of fast EDL fibers with endogenous fast troponin T (fTnT) complexes ({blacksquare}) or reconstituted (REC) with slow troponin complexes [{triangleup}, high molecular weight (sTnT1, sTnT2); {circ}, low molecular weight (sTnTx, sTnT3)]. All pCa values from 6.8 to 5.8 obtained for low-molecular-weight sTnT are statistically different from those obtained for high-molecular-weight sTnT. Inset: typical example of sTnT and fTnT levels, before and after troponin replacement. Lane 1, no sTnT detected in control EDL segment; lane 2, sTnT is detected after substitution; lane 3, the 3 bands correspond to fTnT1, fTnT2, and fTnT3, respectively. Note that membranes were probed first with sTnT and immediately with fTnT, without stripping. Therefore, the band that is revealed after substitution in lane 4 does not actually correspond to fTnT but corresponds to the sTnT shown in lane 2, which migrates at the fTnT2 level.

 
T-pCa relationships were first determined on control EDL fibers (Fig. 4 and Table 2). The expected values for fast muscle fibers were obtained. When the fast troponin complex was replaced with one of the four possible slow troponin complexes, reconstituted from recombinant sTnC, sTnI, and one of the sTnT isoforms (1, 2, x, or 3), an average of 90 ± 1.7% of the maximal force development before exchange was recovered. With slow troponins, T-pCa relationships of EDL fibers were substantially modified (Fig. 4): threshold and pCa50 were higher, whereas the n1 and n2 Hill coefficients were lower (Table 2). Exchange with complexes containing either the two larger isoforms, sTnT1 and sTnT2, or the two low-molecular-weight isoforms, sTnTx and sTnT3, resulted in very similar threshold, pCa50, and n1 and n2 values for each group, respectively (Table 2). Consequently, because no statistically significant differences were found between the two high-molecular-weight sTnT isoforms, the data from sTnT1 and sTnT2 were pooled, and the resulting T-pCa relationship is reported in Fig. 4. The same procedure was applied for low-molecular-weight sTnTx and sTnT3. Comparison of the physiological parameters of these high- and low-molecular-weight isoform complexes revealed that pCa50 and threshold values were statistically different and that complexes reconstituted with sTnT1 and sTnT2 induced a more pronounced leftward shift of the T-pCa relationships compared with sTnTx and sTnT3 (Table 2).


View this table:
[in this window]
[in a new window]
 
Table 2. Ca2+ activation parameters of fast EDL fibers with endogenous troponin complexes or replaced slow troponin complexes

 

    DISCUSSION
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
This study, focused on the expression and functional role of sTnT, reveals that the heterogeneity of rat sTnT isoforms is higher than suggested by earlier works. Indeed, both transcript and protein analysis provide positive identification of a new low-molecular-weight isoform, here referred to as sTnTx. We isolated the four sTnT cDNA isoforms from rat skeletal muscles, confirmed the presence of the four mRNA isoforms in soleus muscle, and detected four different protein bands in rat muscles. We identified these protein isoforms according to their migration relative to purified recombinant sTnT, although it should be noted that native proteins may display different electrophoretic migration due to posttranslational modifications. Alkaline phosphatase treatment did not affect the migration pattern of sTnTs, indicating that phosphorylation is not involved. Attempts to identify unequivocally the different protein bands by mass spectrometry were unfortunately unsuccessful. However, considering that the four sTnT mRNA isoforms are present in soleus muscle and that their relative amounts correlate well with the observed protein expression levels in this tissue, our data support the identification of the sTnT protein bands.

sTnTx increases to four the number of sTnT isoforms described so far. Previously, the presence of only one sTnT isoform (27) or three sTnT isoforms (2, 30) was described in the soleus muscle of adult rats. In other rodents, two sTnT isoforms were found in guinea pigs (13) and three sTnT isoforms in mice (15). Some studies also suggested a higher diversity for sTnT in adult human muscle (27, 28). Rat sTnT1, sTnT2, and sTnT3 cDNAs showed 96% sequence similarity to the corresponding mouse sTnT isoform cDNAs. In fact, the only "real" difference is a GAG codon missing in rat isoforms at positions 67–70, and thus a deleted glutamic acid in all the rat protein sequences. All the other nucleotide sequence differences are located in the third "wobble" position of the codons, thus encoding identical amino acids (see Fig. 1A). In mouse (14), sTnT1 mRNA results from splicing exon 5 to exon 6' (Fig. 1B), sTnT2 is generated by alternatively splicing exon 5 to exon 6, and sTnT3 results from splicing exon 4 to exon 6. No equivalent to rat sTnTx, corresponding to the insertion of an AAG codon between exon 4 and exon 6 in sTnT3, has been described previously. However, in the mouse genomic sTnT sequence, intron 5 ends with a putative alternative AG splice acceptor site followed by the AAG codon corresponding to exon 6' in mouse or rat sTnT1. This alternative splice site seems to be conserved in the two rodent species. Thus a hypothesis can be put forward for the generation of rat sTnTx. We suggest that alternative splicing of exon 4 to exon 6' or exon 6 generates sTnTx or sTnT3, respectively, whereas splicing of exon 4 to exon 5 followed by splicing of exon 5 to exon 6' or 6 generates sTnT1 or sTnT2 (Fig. 1B). The alternative splicing of exon 6' is therefore responsible for the single amino acid difference between sTnT1 and sTnT2 and between sTnTx and sTnT3. In a similar way, Yonemura et al. (33) found variants of chicken sTnT cDNA differing by only one codon.

Comparison of the deduced amino acid sequences for the different isoforms revealed one very striking feature: the different number of glutamic acids in their amino-terminal region. Indeed, sTnT1 contains 20 glutamic acid residues, whereas sTnT3 is composed of "only" 15 glutamates out of the first 40 amino acids. Very few positively charged amino acids (basic Lys and Arg) are present in the sTnT amino-terminal domain. Thus the density of negatively charged amino acids is very high in the amino-terminal region of the sTnTs. This observation suggests that the number of glutamic acid residues in different sTnTs might play an important physiological role in their Ca2+ activation properties. Our results are in good agreement with this, because differences in Ca2+ affinity were revealed between high- and low-molecular-weight isoforms. The most striking difference observed between the two sTnT classes was that the higher-molecular-weight sTnT isoforms conferred a higher Ca2+ affinity to the skinned skeletal fibers (Fig. 4). Consistent with our results, Gomes et al. (11) demonstrated that the variable amino-terminal region of the four human cTnT isoforms contributed to the determination of the calcium sensitivity of force development in a charge-dependent manner. Although we failed to detect any functional difference, with our functional assay between isoforms differing by only a single amino acid (sTnT1 vs. sTnT2 and sTnTx vs. sTnT3), we cannot rule out that this single amino acid can affect muscle function. Indeed, it is clear from the data gathered on familial hypertrophic cardiomyopathy mutations that even a single amino acid difference can alter muscle functional properties (12). This hypothesis makes sense if we consider that the amino acid involved is a glutamate. Our data showing specific expression in different muscle types provide some additional support for such a functional role. Indeed, we show the presence of almost only high-molecular-weight sTnT in slow muscles, in agreement with the usually higher Ca2+ affinity of these muscle fibers. On the other side, the expression of low-molecular-weight isoforms in the fast EDL and TA muscles, with sTnTx being the main sTnT isoform, is consistent with the typically lower Ca2+ affinity of these muscle fibers.

Moreover, our observations raise a very important issue: we clearly demonstrate that adult fast muscles express sTnT isoforms, although it was previously reported that sTnT expression was restricted to slow muscle fiber-forming regions after late fetal development (18). To further investigate sTnT expression in fast muscles, we analyzed the TnT isoform pattern of soleus muscle in a HU model. Exposure to HU is known to trigger functional atrophy and transformations leading slow postural muscles toward a fast phenotype (9). These transformations are thought to be triggered by alterations of the neuronal firing pattern (3). Because we discovered in the present study that high-molecular-weight sTnTs are specific to slow postural muscles, whereas low-molecular-weight sTnTs are specific to fast muscles, we expected the expression of sTnT isoforms in the soleus muscle to be switched to a faster phenotype. Although an increase in fTnT expression and a slight decrease of total sTnT expression was observed after HU (2, 30), it appears that the sTnT expression pattern is not influenced by 15 days of HU, suggesting that this pattern is not altered by changes in neuromuscular activity, in contrast to other contractile proteins. Nevertheless, the specific expression of one of the two possible exon 6 variants in slow or fast muscles suggests a functional role for the two alternative splice variants. HU does not alter the pattern of sTnT isoforms in soleus muscle. Thus their role might be a more structural one, possibly effective mainly during embryogenesis. At present, it is difficult to attribute a specific function to these specific sTnT isoforms in fast muscles.

To conclude, sTnTx increases the diversity of rat sTnT isoforms described so far. TnT expression has been shown to be highly sensitive to muscle functional demand, probably to ensure a rapid adaptation of the muscle to new conditions (2, 13, 30). The new, low-molecular-weight isoform is predominantly expressed in fast muscles, and both small isoforms conferred lower Ca2+ affinity than the higher-molecular-weight isoforms. The observed heterogeneity in the expression patterns of rat sTnT isoforms between slow and fast muscle fibers may contribute to a fine contractile adaptation to various physiological, structural, or developmental conditions. We show here that the sTnT expression pattern does not switch from slow to fast type in soleus muscle under strong environmental conditions. Further work is required to understand the role of sTnT isoforms in fast muscle fibers and the significance of the predominant expression of specific splicing variants.


    ACKNOWLEDGMENTS
 
This work was supported by the Région Wallonne (MICADO project), the Centre National d’Etudes Spatiales (CNES; no. 3194-2002), and the Région Nord Pas de Calais.


    FOOTNOTES
 

Address for reprint requests and other correspondence: P. Kischel, Laboratoire de Biologie Moléculaire et Génie Génétique, Allée de la Chimie 3, Campus du Sart-Tilman, Bât. B6, 4000 Liège, Belgium (e-mail: Philippe.Kischel{at}ulg.ac.be)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* P. Kischel and B. Bastide contributed equally to this work. Back


    REFERENCES
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Bandman E. Contractile protein isoforms in muscle development. Dev Biol 154: 273–283, 1992.[CrossRef][Web of Science][Medline]

2. Bastide B, Kischel P, Puterflam J, Stevens L, Pette D, Jin JP, and Mounier Y. Expression and functional implications of troponin T isoforms in soleus muscle fibers of rat after unloading. Pflügers Arch 444: 345–352, 2002.[CrossRef][Web of Science][Medline]

3. Blewett C and Elder GC. Quantitative EMG analysis in soleus and plantaris during hindlimb suspension and recovery. J Appl Physiol 74: 2057–2066, 1993.[Abstract/Free Full Text]

4. Brandt PW, Cox RN, Kawai M, and Robinson T. Effect of cross-bridge kinetics on apparent Ca2+ sensitivity. J Gen Physiol 79: 997–1016, 1982.[Abstract/Free Full Text]

5. Breitbart RE and Nadal-Ginard B. Complete nucleotide sequence of the fast skeletal troponin T gene. Alternatively spliced exons exhibit unusual interspecies divergence. J Mol Biol 188: 313–324, 1986.[CrossRef][Web of Science][Medline]

6. Breitbart RE, Nguyen HT, Medford RM, Destree AT, Mahdavi V, and Nadal-Ginard B. Intricate combinatorial patterns of exon splicing generate multiple regulated troponin T isoforms from a single gene. Cell 41: 67–82, 1985.[CrossRef][Web of Science][Medline]

7. Cooper TA and Ordahl CP. A single troponin T gene regulated by different programs in cardiac and skeletal muscle development. Science 226: 979–982, 1984.[Abstract/Free Full Text]

8. Fabiato A. Computer programs for calculating total from specified free or free from specified total ionic concentrations in aqueous solutions containing multiple metals and ligands. Methods Enzymol 157: 378–417, 1988.[Web of Science][Medline]

9. Fitts RH, Riley DR, and Widrick JJ. Microgravity and skeletal muscle. J Appl Physiol 89: 823–839, 2000.[Abstract/Free Full Text]

10. Gahlmann R, Troutt AB, Wade RP, Gunning P, and Kedes L. Alternative splicing generates variants in important functional domains of human slow skeletal troponin T. J Biol Chem 262: 16122–16126, 1987.[Abstract/Free Full Text]

11. Gomes AV, Guzman G, Zhao J, and Potter JD. Cardiac troponin T isoforms affect the Ca2+ sensitivity and inhibition of force development. Insights into the role of troponin T isoforms in the heart. J Biol Chem 277: 35341–35349, 2002.[Abstract/Free Full Text]

12. Gomes AV and Potter JD. Molecular and cellular aspects of troponin cardiomyopathies. Ann NY Acad Sci 1015: 214–224, 2004.[CrossRef][Web of Science][Medline]

13. Hartner KT, Kirschbaum BJ, and Pette D. The multiplicity of troponin T isoforms. Distribution in normal rabbit muscles and effects of chronic stimulation. Eur J Biochem 179: 31–38, 1989.[Web of Science][Medline]

14. Huang QQ, Chen A, and Jin JP. Genomic sequence and structural organization of mouse slow skeletal muscle troponin T gene. Gene 229: 1–10, 1999.[CrossRef][Web of Science][Medline]

15. Jin JP, Chen A, and Huang QQ. Three alternatively spliced mouse slow skeletal muscle troponin T isoforms: conserved primary structure and regulated expression during postnatal development. Gene 214: 121–129, 1998.[CrossRef][Web of Science][Medline]

16. Kischel P, Bastide B, Potter JD, and Mounier Y. The role of the Ca2+ regulatory sites of skeletal troponin C in modulating muscle fibre reactivity to the Ca2+ sensitizer bepridil. Br J Pharmacol 131: 1496–1502, 2000.[CrossRef][Web of Science][Medline]

17. Kischel P, Stevens L, and Mounier Y. Differential effects of bepridil on functional properties of troponin C in slow and fast skeletal muscles. Br J Pharmacol 128: 767–773, 1999.[CrossRef][Web of Science][Medline]

18. Krishan K, Morgan MJ, Zhao W, and Dhoot GK. Slow troponin T mRNA in striated muscles is expressed in both cell type and developmental stage specific manner. J Muscle Res Cell Motil 21: 527–536, 2000.[CrossRef][Web of Science][Medline]

19. Kruger M, Pfitzer G, and Stehle R. Expression and purification of human cardiac troponin subunits and their functional incorporation into isolated cardiac mouse myofibrils. J Chromatogr B Analyt Technol Biomed Life Sci 786: 287–296, 2003.[Web of Science][Medline]

20. Malnic B, Farah CS, and Reinach FC. Regulatory properties of the NH2- and COOH-terminal domains of troponin T. ATPase activation and binding to troponin I and troponin C. J Biol Chem 273: 10594–10601, 1998.[Abstract/Free Full Text]

21. Maytum R, Geeves MA, and Lehrer SS. A modulatory role for the troponin T tail domain in thin filament regulation. J Biol Chem 277: 29774–29780, 2002.[Abstract/Free Full Text]

22. Morey ER. Space flight and bone turnover: correlation with a new model of weightlessness. Bioscience 29: 168–172, 1979.[CrossRef][Web of Science]

23. Moss RL, Swinford AE, and Greaser ML. Alterations in the Ca2+ sensitivity of tension development by single skeletal muscle fibers at stretched lengths. Biophys J 43: 115–119, 1983.[Web of Science][Medline]

24. Orentlicher M, Brandt PW, and Reuben JP. Regulation of tension in skinned muscle fibers: effect of high concentrations of Mg-ATP. Am J Physiol Cell Physiol 233: C127–C134, 1977.[Abstract/Free Full Text]

25. Pette D and Staron RS. Myosin isoforms, muscle fiber types, and transitions. Microsc Res Tech 50: 500–509, 2000.[CrossRef][Web of Science][Medline]

26. Reiser PJ, Greaser ML, and Moss RL. Developmental changes in troponin T isoform expression and tension production in chicken single skeletal muscle fibres. J Physiol 449: 573–588, 1992.[Abstract/Free Full Text]

27. Sabry MA and Dhoot GK. Identification of and pattern of transitions of cardiac, adult slow and slow skeletal muscle-like embryonic isoforms of troponin T in developing rat and human skeletal muscles. J Muscle Res Cell Motil 12: 262–270, 1991.[CrossRef][Web of Science][Medline]

28. Samson F, Mesnard L, Mihovilovic M, Potter TG, Mercadier JJ, Roses AD, and Gilbert JR. A new human slow skeletal troponin T (TnTs) mRNA isoform derived from alternative splicing of a single gene. Biochem Biophys Res Commun 199: 841–847, 1994.[CrossRef][Web of Science][Medline]

29. Schachat FH, Diamond MS, and Brandt PW. Effect of different troponin T-tropomyosin combinations on thin filament activation. J Mol Biol 198: 551–554, 1987.[CrossRef][Web of Science][Medline]

30. Stevens L, Bastide B, Kischel P, Pette D, and Mounier Y. Time-dependent changes in expression of troponin subunit isoforms in unloaded rat soleus muscle. Am J Physiol Cell Physiol 282: C1025–C1030, 2002.[Abstract/Free Full Text]

31. Tobacman LS, Nihli M, Butters C, Heller M, Hatch V, Craig R, Lehman W, and Homsher E. The troponin tail domain promotes a conformational state of the thin filament that suppresses myosin activity. J Biol Chem 277: 27636–27642, 2002.[Abstract/Free Full Text]

32. Toursel T, Bastide B, Stevens L, Rieger F, and Mounier Y. Alterations in contractile properties and expression of myofibrillar proteins in wobbler mouse muscles. Exp Neurol 162: 311–320, 2000.[CrossRef][Web of Science][Medline]

33. Yonemura I, Hirabayashi T, and Miyazaki J. Heterogeneity of chicken slow skeletal muscle troponin T mRNA. J Exp Zool 286: 149–156, 2000.[CrossRef][Web of Science][Medline]




This article has been cited by other articles:


Home page
J. Appl. Physiol.Home page
Y. Mounier, V. Tiffreau, V. Montel, B. Bastide, and L. Stevens
Phenotypical transitions and Ca2+ activation properties in human muscle fibers: effects of a 60-day bed rest and countermeasures
J Appl Physiol, April 1, 2009; 106(4): 1086 - 1099.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. A. Brotto, B. J. Biesiadecki, L. S. Brotto, T. M. Nosek, and J.-P. Jin
Coupled expression of troponin T and troponin I isoforms in single skeletal muscle fibers correlates with contractility
Am J Physiol Cell Physiol, February 1, 2006; 290(2): C567 - C576.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/2/C437    most recent
00365.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kischel, P.
Right arrow Articles by Martial, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kischel, P.
Right arrow Articles by Martial, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.