Am J Physiol Cell Physiol Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 288: C1279-C1286, 2005. First published January 12, 2005; doi:10.1152/ajpcell.00463.2004
0363-6143/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A corrigendum has been published
Right arrow All Versions of this Article:
288/6/C1279    most recent
00463.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Codina, J.
Right arrow Articles by DuBose, T. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Codina, J.
Right arrow Articles by DuBose, T. D., Jr.

MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS

CD63 interacts with the carboxy terminus of the colonic H+-K+-ATPase to increase plasma membrane localization and 86Rb+ uptake

Juan Codina, Jian Li, and Thomas D. DuBose, Jr.

Sections on Nephrology and Molecular Medicine, Department of Internal Medicine, Wake Forest University School of Medicine, Winston-Salem, North Carolina

Submitted 20 September 2004 ; accepted in final form 10 January 2005


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The carboxy terminus (CT) of the colonic H+-K+-ATPase is required for stable assembly with the {beta}-subunit, translocation to the plasma membrane, and efficient function of the transporter. To identify protein-protein interactions involved in the localization and function of HK{alpha}2, we selected 84 amino acids in the CT of the {alpha}-subunit of mouse colonic H+-K+-ATPase (CT-HK{alpha}2) as the bait in a yeast two-hybrid screen of a mouse kidney cDNA library. The longest identified clone was CD63. To characterize the interaction of CT-HK{alpha}2 with CD63, recombinant CT-HK{alpha}2 and CD63 were synthesized in vitro and incubated, and complexes were immunoprecipitated. CT-HK{alpha}2 protein (but not CT-HK{alpha}1) coprecipitated with CD63, confirming stable assembly of HK{alpha}2 with CD63. In HEK-293 transfected with HK{alpha}2 plus {beta}1-Na+-K+-ATPase, suppression of CD63 by RNA interference increased cell surface expression of HK{alpha}2/NK{beta}1 and 86Rb+ uptake. These studies demonstrate that CD63 participates in the regulation of the abundance of the HK{alpha}2-NK{beta}1 complex in the cell membrane.

protein assembly; cell surface localization


SIMILARITIES EXIST BETWEEN the Na+-K+-ATPase and the apical colonic H+-K+-ATPase (HK{alpha}2). Both pumps are partially sensitive to ouabain and insensitive to Sch-28080 (4, 11, 15), use the {beta}1-Na+-K+-ATPase (NK{beta}1) as the {beta}-subunit in complex formation (9, 26), and transport K+ in exchange for Na+ or H+ (12, 14, 19). However, distinct differences in membrane localization are evident: the Na+-pump localizes to the basolateral membrane, whereas the colonic H+-K+-ATPase localizes to the apical membrane (18, 29, 32) (Fig. 1).



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 1. Predicted topology of the {alpha}-subunit of mouse colonic H+-K+-ATPase (HK{alpha}2). The carboxy terminus of HK{alpha}2 (CT-HK{alpha}2) used to screen the mouse kidney cDNA library is represented by a dashed line and extends from the EcoRI site of HK{alpha}2 to the stop codon (84 carboxy-terminal amino acids). The bold line between transmembrane M7 and M8 of HK{alpha}2 represents the binding site to the {beta}-subunit. N, amino terminus; C, carboxy terminus; M1–M10, predicted transmembrane regions.

 
We have previously determined that the 84-amino acid region at the carboxy terminus of HK{alpha}2 is critical for {alpha}-/{beta}-complex translocation to the cell surface. A deletion mutation lacking this region ({Delta}HK{alpha}2) appears poorly protected by NK{beta}1, and complexes composed of {Delta}HK{alpha}2 and NK{beta}1 are retained in the endoplasmic reticulum (ER). Moreover, despite assembly with NK{beta}1, {Delta}HK{alpha}2 also fails to function as evidenced by a marked decline in 86Rb+ uptake, Na+-dependent K+-ATPase, and cell surface localization (28).

In an attempt to identify additional proteins capable of interacting with and mediating distribution or trafficking of HK{alpha}2, we used the carboxy terminus of mouse HK{alpha}2 as bait and the yeast two-hybrid method to screen a mouse cDNA library. We determined that the tetraspanin protein CD63 associates with the carboxy terminus of HK{alpha}2, but not with the carboxy terminus of other X+-K+-ATPase {alpha}-subunits. The biological relevance of these findings was confirmed by establishing stable assembly of the carboxy terminus of HK{alpha}2 with CD63 in vitro and by demonstrating that selective suppression of CD63 expression by RNA interference increases both cell surface localization of the HK{alpha}2/NK{beta}1 complex and 86Rb+ uptake in human embryonic kidney (HEK)-293 cells. Collectively, these findings suggest that CD63 functions as a negative regulator of the colonic H+-K+-ATPase.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Construct generation. Total RNA was purified from rat kidney, brain, distal colon, or stomach and used to synthesize cDNA with random primers in a reverse transcriptase system (Fisher, Madison, WI). DNA encoding the carboxy terminus of rat NK{alpha}1, NK{alpha}2, NK{alpha}3, HK{alpha}1, HK{alpha}2, and mouse HK{alpha}2 was subsequently amplified by performing PCR using primers described in Table 1 and cloned into pGBKT7 containing a cassette for an amino-terminal c-myc epitope tag. Similarly, DNA encoding rat NK{beta}1 from L64 to S304 was amplified by performing PCR using the sense primer 5'-ACGTCCATGGCACTGAAACCCACGT ACCAGGACCGT-3' (underlined sequence represents the NcoI site) and antisense primer 5'-ACGTGAATTCTCAGCTCTTAACTT CAATTTTTAC-3' (underlined sequence represents the EcoRI site), and the resultant product was cloned into NcoI/EcoRI-digested pGADT7 plasmid containing an amino-terminal hemagglutinin-tagged epitope cassette. To enable synthesis of m-CD63 in vitro (as described below), DNA encoding m-CD63 in pACT2 (identified in the two-hybrid screen) was excised with SfiI/XhoI and cloned into pGADT7. Generation of small interfering RNA (siRNA)-expressing constructs is described below. Orientation of all cloned inserts was verified using restriction mapping, and sequences were verified by sequencing of both strands. All plasmids were amplified using standard protocols (16).


View this table:
[in this window]
[in a new window]
 
Table 1. Sense and antisense oligonucleotides used to amplify, by PCR, the carboxy terminus of r-NK{alpha}1, r-NK{alpha}2, r-NK{alpha}3, r-HK{alpha}1, and rat or mouse HK{alpha}2 (r- or m-HK{alpha}2)

 
Transfection of yeast AH109 with the carboxy terminus of mouse HK{alpha}2. Yeast (Saccharomyces cerevisiae) AH109 was grown in 300 ml of yeast extract, peptone, and dextrose solution containing 15 µg/ml kanamycin (Clontech, Palo Alto, CA) to an optical density of 0.4–0.5 at 600 nm and then centrifuged at 1,000 g for 5 min at room temperature. The pellet was rinsed with 30 ml of sterile water, centrifuged again, and resuspended in 1.5 ml of 10 mM Tris·HCl, 1 mM EDTA, and 100 mM LiAc, pH 7.5. One hundred microliters of the yeast suspension were added first to 10 µg of m-CT-HK{alpha}2-pGBKT7 and 100 µg of carrier herring sperm DNA (Clontech) and then to 600 µl of 40% PEG-4000 in 10 mM Tris·HCl, 1 mM EDTA, and 100 mM LiAc, pH 7.5. The mixture was incubated for 30 min at 30°C. After addition of 70 µl of dimethyl sulfoxide (DMSO), the yeast was incubated at 42°C for 15 min, chilled in ice, and centrifuged. The resultant pellet was resuspended in 500 µl of 10 mM Tris·HCl and 1 mM EDTA, pH 7.5. The transfected yeast was plated on 2% agar in synthetic dropout (SD; Fisher, Madison, WI) medium supplemented with all nutrients except tryptophan. The dishes were incubated for 3–4 days at 30°C.

Screening of a mouse kidney cDNA library in pACT2 vector. A cDNA library made from total RNA purified from mouse kidney was purchased from Clontech. For screening, one colony expressing m-CT-HK{alpha}2 protein fused to GAL4-BD was amplified in 300 ml of SD medium in the absence of tryptophan until the optical density reached 0.4–0.5. All subsequent steps were as described above, except that competent yeast (1,500 µl) was mixed with 200 µg of mouse kidney cDNA library in pACT2 and 1,500 µg of herring sperm carrier DNA. The transformed yeast was plated on 20 petri dishes (15 cm in diameter) containing 2% agar in SD supplemented with all amino acids except tryptophan, leucine, histidine, and adenine. The dishes were incubated at 30°C for 3–4 days, and visible colonies were transferred to 5 ml of SD lacking the same amino acids and incubated for 2 days at 30°C. Plasmid DNA was purified as described by Hoffman (22). Briefly, the yeast was centrifuged at 1,000 g for 5 min at room temperature and then digested with 100 units of lyticase (Sigma, St. Louis, MO) for 1 h at 37°C in 100 µl of 10 mM Tris·HCl and 1 mM EDTA, pH 8.0. Twenty microliters of 10% SDS were then added, and the samples were frozen at –70°C. One hundred microliters of breaking buffer (4% Triton X-100, 1% SDS, 200 mM NaCl, 10 mM Tris·HCl, and 1 mM EDTA, pH 8.0) and 300 mg of glass beads (Sigma) were added to thawed samples and vortexed for 2 min. The proteins were extracted with 200 µl of H2O-saturated phenol/chloroform/isoamyl alcohol (24:24:1). The aqueous phase was retained, and the RNA was digested with 1 mg/ml RNAse A. The samples were diluted to a final volume of 1 ml, and the DNA was precipitated with 400 µl of 40% PEG-8000/1.5 M NaCl and resuspended. The isolated DNA was used to transform XL1blue MR Escherichia coli by electroporation, and the transfected E. coli were plated on petri dishes containing 100 µg/ml ampicillin. Colonies from these dishes were used to purify and sequence the insert (prey) in the mouse kidney library that interacted with m-CT-HK{alpha}2.

Assessment of m-CT-HK{alpha}2 and m-CD63 interaction in vitro. m-CT-HK{alpha}2 in pGBKT7 and m-CD63 in pGADT7 plasmids were used to synthesize [35S]methionine-labeled m-CT-HK{alpha}2 and m-CD63 proteins using the TnT T7-coupled reticulocyte lysate system (Promega, Madison, WI) according to the manufacturer's instructions. After synthesis, the proteins were mixed and incubated for 1 h at room temperature. The m-CT-HK{alpha}2/m-CD63 complex was immunoprecipitated for 1 h at room temperature by the addition of 10 µl of rabbit anti-hemagglutinin polyclonal antibody (Clontech). The reaction was diluted with 400 µl of buffer (10 mM Tris·HCl, pH, 8.0, 150 mM NaCl, 1 mM PMSF, 3 mM benzamidine, and 1 µg/ml soybean trypsin inhibitor). Five microliters of packed agarose A (Santa Cruz Biotechnology, Santa Cruz, CA) were added and incubated for an additional 1 h at room temperature with continuous shaking. The resin was washed four times with 1 ml of 10 mM Tris·HCl, 150 mM NaCl, 1 mM PMSF, 3 mM benzamidine, 1 µg/ml soybean trypsin inhibitor, and 1% egg albumin, followed by two additional washes with the same buffer without egg albumin. Proteins were extracted with Laemmli sample buffer (27) and resolved using 10% SDS-PAGE that had been prerun for 4 h at 100 V to increase the resolution of low molecular weight proteins. The gel was fixed with 50% methanol, washed extensively with DMSO, submerged in a solution of 20% PPO in DMSO for 45 min, dried, and exposed to film for 3 days at –70°C.

Northern blot analysis. Northern blot analysis was performed as described previously by our laboratory (16) using a 32P-labeled probe based on the mouse CD63 sequence identified in the yeast two-hybrid screen.

Specific suppression of CD63 protein synthesis in HEK-293 cells by siRNA. A sense oligonucleotide 5'-TCGAGGTTCTT GCTCTACGTCCTCCTAGTACTGAGGAGGACGTAGA GCAAGAACTTTTT-3' containing an XhoI site, a 20-nucleotide sequence (GTTCTTGCTCTACGTC CTCC) corresponding to nucleotides 33–52 of the open reading frame of the human CD63 (GenBank accession no. BT008095), a nonrelevant sequence (TAGTACTGA), followed by a reverse complementary sequence of human CD63 (GGAGGACGTAGAGCAAGAAC) and a polyT (TTTTT) tail, were synthesized. The reverse oligonucleotide (5'-CTAGAAAAAGTTCTTGCTCT ACGTCCTCCTCA GTACTAGGAGGACGTAGAGCAAGAACC-3') containing the 5'-overhanging end of the XbaI site (CTAGA) was also synthesized. The two oligonucleotides were purified, annealed as described previously (1), and cloned into the plasmid pSuppressorNeo (Imgenex, San Diego, CA). The sequence of the insert was verified by performing double-stranded DNA sequencing. The construct was linearized with BamHI and used (9 µg/10-cm dish) to stably transfect HEK-293 cells according to the instructions of the manufacturer. Colonies were selected using 250 µg/ml G418 (Invitrogen, Carlsbad, CA) and screened by immunolocalization of CD63 protein in the intracellular compartments with anti-human CD63 monoclonal antibody (Jackson ImmunoResearch, West Grove, PA) as described below.

Intracellular localization of CD63 in HEK-293 cells. HEK-293 cells were washed twice with PBS, fixed with 3.7% formaldehyde in PBS, washed twice with PBS, and incubated in 1% BSA plus 0.1% saponin in PBS for 10 min at room temperature. Anti-human CD63 monoclonal antibody (Jackson ImmunoResearch), diluted 1:100, was added to the cells for 30 min at room temperature. Cells were washed three times with PBS, after which rhodamine-conjugated goat anti-mouse IgG (1:1,000 dilution; Jackson ImmunoResearch) was added for 30 min at room temperature. Cells were viewed using a Zeiss Axioplan 2 fluorescence microscope equipped with rhodamine filters and recorded using a Zeiss Axiocam charge-coupled device camera. Control experiments were performed by omitting the primary antibody. Colonies growing in presence of G418 that did not express CD63 proteins were designated the experimental group (CD63 knockdown). Colonies growing in the presence of G418 but expressing levels of CD63 protein similar to those of nontransfected cells were used as controls.

Subcellular localization of HK{alpha}2/NK{beta}1 complex in control and CD63-knockdown HEK-293 cells. Whole cell lysate protein was fractionated by discontinuous sucrose gradients as described previously (28) to investigate subcellular localization of HK{alpha}2/NK{beta}1 in transfected control and CD63-knockdown HEK-293 cells. The top fraction (lower sucrose concentration) containing the plasma membrane fraction (28, 34) was diluted 10-fold with 10 mM Tris·HCl, pH 8.0, 1 mM EDTA, 1 mM PMSF, 3 mM benzamidine, and 1 µg/ml soybean trypsin inhibitor and concentrated by centrifugation for 30 min at 4°C at 30,000 g. The pellet was resuspended, protein concentration was determined, and 50 µg of protein were deglycosylated with glycosidase F for 1 h at 37°C in the presence of 1% 3-([3-cholamidopropyl]dimethylammonio)-1-propanesulfonate. Proteins were resolved on a 10% SDS-PAGE gel and transferred to a nitrocellulose membrane. The upper half of the membrane was probed with the anti-HK{alpha}2 polyclonal antibody, and the lower half was probed with a polyclonal antibody against rat NK{beta}1. Equal loading of the SDS-PAGE was monitored by staining the nitrocellulose membranes with Ponceau red S.

Miscellaneous methods. HEK-293 cells were grown at 37°C in DMEM containing 10% newborn calf serum (20). 86Rb+ uptake was performed at 37°C for 15 min in presence of KCl (1 mM) and 86Rb+ (3–4 x 106 cpm) (8). Immunoblot analysis was performed as described previously, with the intensity of bands quantified using the Image Tools software program (10).


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
m-CD63 interacts with m-CT-HK{alpha}2 in a yeast two-hybrid screen. Yeast AH109 was transfected with pGBKT7 containing an insert encoding the 84 carboxy-terminal amino acids of HK{alpha}2. The yeast was plated on agar dishes depleted of tryptophan (Fig. 1). Four days later, one colony was amplified and transfected with a mouse kidney cDNA mouse library in pACT2 and plated on 2% agar in SD supplemented with all nutrients except methionine, tryptophan, histidine, and adenine. Four days later, 24 individual yeast colonies were isolated and expanded in SD liquid supplemented with all amino acids except tryptophan, leucine, histidine, and adenine. Plasmid DNA was purified and used to electroporate XL1blue MR E. coli. The transformed bacteria were plated on 1% agar dishes containing 100 µg/ml ampicillin and used to isolate the cDNA encoding the prey protein that interacted with m-CT-HK{alpha}2. Double-stranded DNA sequencing of the longest insert (colony 3) demonstrated that the open reading frame of GAL4 AD protein continued into the linker A ATT CGC GGC CGC GTG GAC, which was added to the 5'-end of the cDNA when the library was synthesized, and continued into the insert. The insert coded for 238 amino acids followed by a stop codon and three noncoding sequences ending with a 30 base polyA sequence followed by an XhoI site that was added when the library was synthesized. A BLAST search revealed the sequence to encode all but the first five amino acids of mouse CD63 (GenBank accession no. S43511). The remaining 23 inserts, all shorter in size, had strong cross reactivity with colony 3 in Southern blot analysis and therefore were not characterized.

HK{alpha}2 is the only X+-K+-ATPase {alpha}-subunit that assembles with CD63. All experiments described above were performed using m-CT-HK{alpha}2 and m-CD63. Results were similar when the rat carboxy terminus of HK{alpha}2 was used as bait (not shown). Additional two-hybrid screens testing whether the carboxy termini of the different {alpha}-subunits from other X+-K+-ATPases (NK{alpha}1, NK{alpha}2, NK{alpha}3, and HK{alpha}1) interacted with m-CD63 revealed that the interaction between the carboxy terminus of HK{alpha}2 and CD63 is specific and did not extend to any other members of the X+-K+-ATPase family (data not shown).

Interaction between bait and prey is required for AH109 growth in the absence of tryptophan, leucine, histidine, and adenine. To further test the specificity of the HK{alpha}2-CD63 interaction, yeast was transfected with m-CT-HK{alpha}2 in pGBKT7 and plated on SD dishes supplemented with all the nutrients, SD dishes deficient in tryptophan, SD dishes deficient in leucine, or SD dishes deficient in tryptophan, leucine, histidine, and adenine. The results presented in Table 2 demonstrate that yeast grew when all nutrients were present or when tryptophan was omitted (Table 2, lane 1). Yeast transfected with m-CD63 in pACT2 grew when all the nutrients were added or when leucine was omitted (Table 2, lane 2). Yeast cotransfected with m-CT-HK{alpha}2 in pGBKT7 and m-CD63 in pACT2 grew under all four conditions (Table 2, lane 3) as expected when bait and prey interact. Yeast cotransfected with m-M7M8 in pGBKT7 and m-CD63 in pACT2 grew in the presence of all the nutrients or when tryptophan or leucine was omitted. However, they did not grow when all four nutrients were omitted (Table 2, lane 4), demonstrating that CD63 did not interact with the {beta}-subunit binding sequence of HK{alpha}2. As a positive control, yeast cotransfected with m-M7M8 in pGBKT7 and the extracellular domain of rat NK{beta}1 in pGADT7 grew under all four conditions (Table 2, lane 5), demonstrating that a region of HK{alpha}2 including transmembranes 7 and 8 interacted with the carboxy terminus of NK{beta}1 as previously demonstrated by Colonna et al. (13).


View this table:
[in this window]
[in a new window]
 
Table 2. Summary of protein-protein interactions suggested by yeast two-hybrid analysis

 
m-CT-HK{alpha}2 and m-CD63 form a complex in vitro. m-CD63 from the plasmid pACT2 was cloned into plasmid pGADT7 as described in MATERIALS AND METHODS to enable synthesis of both proteins using the rabbit reticulocyte system in the presence of [35S]methionine. In vitro-translated m-CT-HK{alpha}2 and m-CD63 proteins were incubated together in vitro, m-CD63 was subsequently immunoprecipitated with anti-hemagglutinin antibody, and immunoprecipitated complexes were analyzed using autoradiography. Figure 2 shows the results of a representative experiment. In the absence of m-CD63, immunoprecipitation with anti-hemagglutinin antibody coprecipitated a small amount of m-CT-HK{alpha}2, reflecting the nonspecific binding of the recombinant m-CT-HK{alpha}2 to protein A/G PLUS agarose bits (Fig. 2A, lane 1). In the absence of m-CT-HK{alpha}2, immunoprecipitation of m-CD63 was observed, while m-CT-HK{alpha}2 was not (Fig. 2A, lane 2). For incubations including both m-CT-HK{alpha}2 and m-CD63, m-CT-HK{alpha}2 coprecipitated with m-CD63 (Fig. 2A, lane 3) such that the intensity of the band representing m-CT-HK{alpha}2 was three- to fivefold that observed in the control (Fig. 2A, lane 1). This finding demonstrates the capacity of m-CT-HK{alpha}2 and m-CD63 to form a complex in vitro.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 2. CD63 interacts with the carboxy terminus of HK{alpha}2: hemagglutinin-tagged m-CD63, m-CT-HK{alpha}2, and r-CT-NK{alpha}1 were synthesized and incubated, and immune complexes were precipitated using an anti-hemagglutinin polyclonal antibody as described in MATERIALS AND METHODS. A: lane 1, m-CT-HK{alpha}2 incubated alone; lane 2, m-CD63 incubated alone; lane 3, m-CT-HK{alpha}2 incubated with m-CD63. B: lane 1, r-CT-NK{alpha}1 incubated alone; lane 2, m-CD63 incubated alone; lane 3, r-CT-NK{alpha}1 incubated with m-CD63. The molecular masses of the different proteins are expressed in kilodaltons. The experiment was repeated three times with similar results.

 
Additional experiments were performed to assess the capacity of the carboxy terminus of other {alpha}-subunits of the X+-K+-ATPase to associate with m-CD63 in vitro. The results depicted in Fig. 2B demonstrate that unlike the carboxy terminus of HK{alpha}2, the carboxy terminus of NK{alpha}1 protein fails to complex with m-CD63. Coprecipitation of r-CT-NK{alpha}1 with m-CD63 (Fig. 2B, lane 3) was not significantly greater than that observed for immunoprecipitates obtained in the absence of m-CD63 (Fig. 2B, lane 1). These findings are consistent with the results of our yeast two-hybrid experiments described above and further suggest that CD63 interacts specifically with the carboxy terminus of HK{alpha}2.

CD63 mRNA is expressed in distal colon, renal medulla, and HEK-293 cells. If CD63 functions as a chaperone for HK{alpha}2, CD63 should be expressed in mouse inner medullary collecting duct (mIMCD3) and mouse outer medullary collecting duct (mOMCD) cells in culture and in distal colon (31). Total RNA was purified from mIMCD3, mOMCD, distal colon, and HEK-293 cells; resolved on agarose gel; transferred to a nylon membrane; and probed with the m-CD63 identified using the yeast two-hybrid system. The results displayed in Fig. 3 demonstrate that CD63 mRNA is highly expressed in mIMCD, mOMCD, and HEK-293 cells in culture and distal colon. CD63 mRNA displays the expected mobility corresponding to 1.2 kb in the four samples tested in our studies. However, one larger band was detected in mRNA isolated from mIMCD-3 or mOMCD. This larger band could represent an alternative splice variant that is expressed at low levels, a CD63 pre-mRNA species, or a cross reaction with mRNA of other homologous tetraspanin proteins.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 3. CD63 mRNA is expressed in distal colon, renal medulla, and human embryonic kidney (HEK)-293 cells. Total RNA (10 µg) from mouse distal colon, mouse inner medullary collecting duct (mIMCD3) cells, mouse outer medullary collecting duct (mOMCD) cells, and HEK-293 cells was probed with m-CD63 cDNA. The film was exposed overnight at –70°C. The molecular weight of the mRNA is expressed kb. The experiment was repeated three times with similar results.

 
Endogenous CD63 protein expressed in HEK-293 cells is abolished by siRNA. Cellular localization of CD63 protein was determined by performing immunocytochemistry using a monoclonal antibody against human CD63 (Fig. 4). CD63 is observed at the cell surface (Fig. 4A). However, large quantities of CD63 are also detected in intracellular compartments. Transfection of siRNA targeting CD63 resulted in successful suppression of CD63 expression in numerous cloned lines established by selection with G418 (Fig. 4B). Figure 4 shows that CD63 was not detected when the primary antibody was omitted in the control cells and demonstrates that CD63 was not detected in CD63-knockdown HEK-293.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 4. CD63 protein expression is abolished in HEK-293 cells using small interfering RNA (siRNA). A: immunocytochemical localization of endogenous CD63 protein in a G418 selected HEK-293 cell line that expresses CD63. The experiment was performed at room temperature in the presence of saponin. B: CD63 expression in a clonal line of HEK-293 cells transfected with siRNA targeting CD63 and then selected with G418 CD63-knockdown cells. C: same as A but with primary antibody omitted. D: same as B but with primary antibody omitted. The anti-CD63 monoclonal antibody (primary antibody) was diluted 1:100. The immunocytochemical localization of CD63 shown in AD was repeated 10 times with similar results.

 
HK{alpha}2 protein localization, but not expression, is altered in CD63-specific knockdown HEK-293 cells. HEK-293 cells (control or CD63 knockdown) were transiently transfected with HK{alpha}2 plus NK{beta}1 in pcDNA3.1(+)-Neo. Forty-eight hours later the cells were scraped, washed with PBS, and lysed as described in MATERIALS AND METHODS. One hundred micrograms of protein were deglycosylated with glycosidase F as described previously (3, 9), separated on a 10% SDS-PAGE gel, and transferred to a nitrocellulose membrane. The top half of the membrane was probed with anti-HK{alpha}2 antibody (10), and the bottom half was probed with anti-NK{beta}1 antibody. The immunoblot analysis depicted in Fig. 5 demonstrates that HK{alpha}2 (top) as well as of NK{beta}1 (bottom) were expressed at similar levels in control and CD63-knockdown cells.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 5. Expression of HK{alpha}2 and NK{beta}1 protein is not altered by knocking down expression of CD63 with siRNA: Control HEK-293 cells or CD63-knockdown HEK-293 cells were cotransfected with HK{alpha}2 plus NK{beta}1. Forty-eight hours later, the cells were lysed, 100 µg of protein were deglycosylated with glycosidase F and resolved on a 10% SDS-PAGE, and the proteins were transferred to a nitrocellulose membrane and then stained with Ponceau red S to verify equal protein loading of the lanes. The immunoblot analyses were performed using an anti-HK{alpha}2 antibody (1:1,000 dilution) (10) or an anti-NK{beta}1 antibody (1:1,000 dilution) (29). For these experiments, controls were HEK-293 cells transfected with CD63 siRNA using the plasmid pSuppressorNeo and selected with G418, but expression of CD63 protein was not different from that determined in wild-type HEK-293 cells. The experiment was repeated four times with similar results, and the difference between control and CD63 knockdown is not statistically significant.

 
Suppression of CD63 increases plasma membrane localization of HK{alpha}2/NK{beta}1 but not of NK{alpha}1/NK{beta}1. Subcellular localization of HK{alpha}2/NK{beta}1 in controls and CD63-knockdown HEK-293 cells was defined using a discontinuous sucrose gradient as described by Tamarappoo et al. (34) and our laboratory (28). The results of a representative experiment are displayed in Fig. 6. Figure 6A demonstrates that HK{alpha}2 migrated to the cell surface (low sucrose concentration represented by fractions 1 and 2) or to the bottom of the tube (fraction 6) when control HEK-293 cells were cotransfected with HK{alpha}2/NK{beta}1. Figure 6B demonstrates that when CD63 expression was suppressed selectively, a large proportion of HK{alpha}2 migrated to the plasma membrane, while only a minor proportion of the protein migrated to the high sucrose concentration. Figure 6C demonstrates a large proportion of NK{beta}1 accumulates in fraction 3 and some in fraction 2. The proportion of NK{beta}1 accumulated in fraction 2 increased when the transfection was performed using CD63-knockdown cells (Fig. 6D). Figure 6, D and F, demonstrates that the intracellular distribution of NK{alpha}1 was independent of the presence or absence of CD63 expression in HEK-293 cells. Immunoblots performed with anti-calnexin demonstrated that the ER migrated to the high sucrose concentration (fraction 6) in all the conditions (results not shown).



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 6. Plasma membrane expression of HK{alpha}2 increases in CD63-knockdown HEK-293 cells. Control HEK-293 cells were cotransfected with HK{alpha}2 plus NK{beta}1. Forty-eight hours later, the cells were lysed as described in MATERIALS AND METHODS. The membranes were fractionated using a discontinuous sucrose gradient (28, 34). The proteins of the different fractions were processed as described in MATERIALS AND METHODS and probed with anti-HK{alpha}2 antibody (A) or anti-NK{beta}1 antibody (C). The results demonstrated that HK{alpha}2 and NK{beta}1 migrate to the plasma membrane (fractions 1 and 2) or remain in the heavy sucrose fraction (fraction 6). B and D: same as A and C, but the experiment was performed in CD63-knockdown HEK-293 cells. E and F: presence or absence of CD63 did not alter the pattern of migration of NK{alpha}1 in the sucrose gradient when the cells were cotransfected with NK{alpha}1/NK{beta}1. Immunoblot analysis performed with anti-calnexin (antibody commercially available from Santa Cruz Biotechnology) demonstrated that the endoplasmic reticulum components accumulated in fraction 6. The experiment was performed three times with similar results. The quantity of HK{alpha}2 and NK{beta}1 that accumulated in the top of the gradient was statistically greater in CD63-knockdown HEK-293 cells than in controls. P < 0.05.

 
Suppression of CD63 increases 86Rb+ uptake by HK{alpha}2/NK{beta}1 but not by NK{alpha}1/NK{beta}1. To determine whether the effect of reduced CD63 protein expression on HK{alpha}2/NK{beta}1 plasma membrane localization was associated with alterations in complex function, control and CD63-knockdown HEK-293 cells were cotransfected with HK{alpha}2/NK{beta}1, NK{alpha}1/NK{beta}1, or pcDNA/NK{beta}1, and assays of 86Rb+ uptake were performed. The results displayed in Fig. 7 demonstrate that 86Rb+ uptake mediated by coexpressed HK{alpha}2 and NK{beta}1 was significantly increased by suppression of CD63. Conversely, 86Rb+ uptake, sensitive to 2 mM ouabain, in cells coexpressing NK{alpha}1 and NK{beta}1 was not significantly different between control and CD63-knockdown cell lines. In addition, suppression of CD63 protein expression did not alter 86Rb+ uptake sensitive to low concentrations (10 µM) of ouabain, supporting our view that CD63 does not interact with NK{alpha}1. Collectively, these data suggest that the increase in HK{alpha}2/NK{beta}1 expression at the plasma membrane conferred by a reduction in CD63 expression translates into increased transporter activity.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 7. 86Rb+ uptake by HK{alpha}2/NK{beta}1 complex but not by NK{alpha}1/NK{beta}1 complex is increased in CD63-knockdown cells. Control HEK-293 cells (open bars) or CD63-knockdown HEK-293 cells (closed bars) were cotransfected with HK{alpha}2 plus NK{beta}1, NK{alpha}1 plus NK{beta}1, or pcDNA vector plus NK{beta}1. Ouabain (10 µM) was used to block endogenous Na+-K+-ATPase of HEK-293 cells, and 2 mM ouabain was used to block the transport activity of the transfected rat HK{alpha}2 or rat NK{alpha}1. The results (means ± SE) represent the difference in 86Rb+ uptake when the experiments were performed with 10 µM ouabain vs. 2 mM ouabain. **P < 0.01, 86Rb+ uptake in control HEK-293 cells statistically different from that in CD63-knockdown cells for HK{alpha}2/NK-{beta}1-transfected cells. No statistical difference was observed between control and CD63-knockdown cells when the cells were cotransfected with NK{alpha}1/NK{beta}1 or pcDNA plus NK{beta}1. The experiment was repeated three times with similar results.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Our results demonstrate that CD63 interacts in a specific manner with the carboxy terminus of HK{alpha}2. Association between CD63 and HK{alpha}2 was indicated by four independent lines of investigation: 1) the yeast two-hybrid system (Table 2); 2) coimmunoprecipitation of proteins synthesized in vitro using rabbit reticulocyte lysate (Fig. 2); 3) immunoblot analysis in membrane fractions to localize the HK{alpha}2/NK{beta}1 complex in HEK-293 cells, when expression of CD63 was suppressed selectively by RNA interference (Fig. 6); and 4) 86Rb+(K+) uptake in control and CD63-knockdown HEK-293 transfectants (Fig. 7).

CD63, a member of the tetraspanin superfamily of proteins, contains four hydrophobic transmembrane sequences, a large extracellular region of 95 amino acids between transmembrane segments 3 and 4, and is heavily glycosylated. This protein is expressed in numerous tissues and cells in culture (24, 30). In the present study, we have shown that CD63 is expressed in established cell lines of renal medullary origin known to express HK{alpha}2 (31). In endothelial cells, CD63 has been shown to traffic from the plasma membrane to late endosomes and then to Weibel-Palade bodies to recycle to the plasma membrane (25, 35). CD63 also has been proposed as a molecular modulator of transporter function (5, 6, 36). Therefore, one implication of the CD63-HK{alpha}2 interaction revealed by our study is that CD63 may participate importantly in the internalization of HK{alpha}2 from the apical membrane. Nevertheless, a complete understanding of the participation of CD63 in the intracellular trafficking of HK{alpha}2 requires further studies.

Several recent studies have suggested that interacting proteins may play a key role in the migration of ion transporters to or from the plasma membrane. Staub et al. (33) demonstrated that Nedd4 is required for the internalization and proteasomal degradation of the amiloride-sensitive epithelial Na+ channel. Hebert (21) demonstrated that Bartter syndrome was required for migration of ClC-Ka and ClC-Kb channels to the plasma membrane in the thick ascending limb and in marginal cells of the inner ear. Na+/H+ exchanger NHE3 requires glycophorin A to migrate successfully to the apical membrane of the {beta}-intercalated cell in the renal medulla (2, 23). AE1 interacts with kanadaptin (7). Finally, mutations in these interacting proteins can manifest abnormalities in transport function. Therefore, the growing appreciation of such protein-protein interactions suggests a widespread phenomenon in transport physiology.

Our studies are consistent with the possibility that CD63, by interacting with the carboxy terminus of HK{alpha}2, facilitates internalization of the HK{alpha}2/NK{beta}1 complex from the cell surface. Specifically, when CD63 expression is inhibited by siRNA in transfected cells, the accumulation of HK{alpha}2/NK{beta}1 protein at the cell surface and 86Rb+ uptake are both increased. A somewhat analogous mechanism of interaction has been advanced in the studies of Duffield et al. (17). These investigators demonstrated that CD63 association with the {beta}-subunit of the gastric H+-K+-ATPase (HK-{beta}G) facilitated internalization of the gastric H+-K+-ATPase heterodimer. In the present study, however, we demonstrate that CD63 does not interact with the carboxy terminus of HK{alpha}1. The biological implications of CD63 interacting with NK{beta}G or HK{alpha}2 is not yet fully appreciated.

Our studies demonstrate that the interaction of CD63 with the carboxy terminus of HK{alpha}2 regulates membrane expression of CD63 and transport function as monitored by 86Rb+ uptake. Because all members of the tetraspanin protein share a large number of common properties (30), it is logical to speculate that other tetraspanin proteins may interact with HK{alpha}2 or other {alpha}-subunits of the X+-K+-ATPase family. It is also possible that HK{alpha}2 affects the function of CD63. If CD63 is regulated by HK{alpha}2, such regulation may occur in the distal colon, where both HK{alpha}2 (10) and CD63 are expressed abundantly (see Fig. 3). In the renal medulla, HK{alpha}2 is expressed at low levels in animals with a normal plasma K+ concentration. In contrast, HK{alpha}2 is upregulated robustly by chronic K+ depletion (10). Therefore, if HK{alpha}2 regulates the activity of CD63 in the renal medulla, it seems likely that this phenomenon would be observed during chronic hypokalemia.

In conclusion, our results are in agreement with and extend recent findings indicating that CD63 participates in the internalization of certain members of the H+-K+-ATPase family. We have found that CD63 specifically interacts with the carboxy terminus of HK{alpha}2, but not with other members of the X+-K+-ATPase family of membrane transport proteins. This interaction serves to reduce plasma membrane expression of the HK{alpha}2/NK{beta}1 complex, suggesting a mechanism by which CD63 functions as a negative modulator of H+-K+-ATPase.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported in part by National Institute of Diabetes and Digestive and Kidney Diseases Grant R01 DK-30603 (to T. D. DuBose, Jr.).


    ACKNOWLEDGMENTS
 
We thank Dr. Mark C. Willingham (Wake Forest University School of Medicine) for valued suggestions on the microscopy and immunolocalization experiments using anti-CD63 monoclonal antibody and Dr. Raymond Penn (Wake Forest University School of Medicine) for advice during the preparation of the manuscript.


    FOOTNOTES
 

Address for reprint requests and other correspondence: T. D. DuBose, Jr., Dept. of Internal Medicine, Wake Forest Univ. School of Medicine, Medical Center Blvd., Winston-Salem, NC 27157 (E-mail: tdubose{at}wfubmc.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Abramowitz J, Mattera R, Liao CF, Olate J, Perez-Ripoll E, Birnbaumer L, and Codina J. Screening of cDNA libraries with oligonucleotides as applied to signal transducing G proteins, receptors and effectors. J Recept Res 8: 561–588, 1988.[Web of Science][Medline]

2. Alper SL. Genetic diseases of acid-base transporters. Annu Rev Physiol 64: 899–923, 2002.[CrossRef][Web of Science][Medline]

3. Arystarkhova E and Sweadner KJ. Tissue-specific expression of the Na+,K+-ATPase {beta}3-subunit: the presence of {beta}3 in lung and liver addresses the problem of the missing subunit. J Biol Chem 272: 22405–22408, 1997.[Abstract/Free Full Text]

4. Asano S, Hoshina S, Nakaie Y, Watanabe T, Sato M, Suzuki Y, and Takeguchi N. Functional expression of putative H+-K+-ATPase from guinea pig distal colon. Am J Physiol Cell Physiol 275: C669–C674, 1998.[Abstract/Free Full Text]

5. Berditchevski F, Gilbert E, Griffiths MR, Fitter S, Ashman L, and Jenner SJ. Analysis of the CD151-{alpha}3{beta}1 integrin and CD151-tetraspanin interactions by mutagenesis. J Biol Chem 276: 41165–41174, 2001.[Abstract/Free Full Text]

6. Berditchevski F, Tolias KF, Wong K, Carpenter CL, and Hemler ME. A novel link between integrins, transmembrane-4 superfamily proteins (CD63 and CD81), and phosphatidylinositol 4-kinase. J Biol Chem 272: 2595–2598, 1997.[Abstract/Free Full Text]

7. Chen J, Vijayakumar S, Li X, and Al-Awqati Q. Kanadaptin is a protein that interacts with the kidney but not the erythroid form of band 3. J Biol Chem 273: 1038–1043, 1998.[Abstract/Free Full Text]

8. Codina J, Cardwell J, Gitomer JJ, Cui Y, Kone BC, and DuBose TD Jr. Sch-28080 depletes intracellular ATP selectively in mIMCD-3 cells. Am J Physiol Cell Physiol 279: C1319–C1326, 2000.[Abstract/Free Full Text]

9. Codina J, Delmas-Mata JT, and DuBose TD Jr. The {alpha}-subunit of the colonic H+,K+-ATPase assembles with {beta}1-Na+,K+-ATPase in kidney and distal colon. J Biol Chem 273: 7894–7899, 1998.[Abstract/Free Full Text]

10. Codina J, Delmas-Mata JT, and DuBose TD Jr. Expression of HK{alpha}2 protein is increased selectively in renal medulla by chronic hypokalemia. Am J Physiol Renal Physiol 275: F433–F440, 1998.[Abstract/Free Full Text]

11. Codina J, Kone BC, Delmas-Mata JT, and DuBose TD Jr. Functional expression of the colonic H+,K+-ATPase {alpha}-subunit: pharmacologic properties and assembly with X+,K+-ATPase {beta}-subunits. J Biol Chem 271: 29759–29763, 1996.[Abstract/Free Full Text]

12. Codina J, Pressley TA, and DuBose TD Jr. The colonic H+,K+-ATPase functions as a Na+-dependent K+(NH4+)-ATPase in apical membranes from rat distal colon. J Biol Chem 274: 19693–19698, 1999.[Abstract/Free Full Text]

13. Colonna TE, Huynh L, and Fambrough DM. Subunit interactions in the Na+,K+-ATPase explored with the yeast two-hybrid system. J Biol Chem 272: 12366–12372, 1997.[Abstract/Free Full Text]

14. Cougnon M, Bouyer P, Planelles G, and Jaisser F. Does the colonic H+,K+-ATPase also act as an Na+,K+-ATPase? Proc Natl Acad Sci USA 95: 6516–6520, 1998.[Abstract/Free Full Text]

15. Cougnon M, Planelles G, Crowson MS, Shull GE, Rossier BC, and Jaisser F. The rat distal colon P-ATPase {alpha}-subunit encodes a ouabain-sensitive H+,K+-ATPase. J Biol Chem 271: 7277–7280, 1996.[Abstract/Free Full Text]

16. DuBose TD Jr, Codina J, Burges A, and Pressley TA. Regulation of H+-K+-ATPase expression in kidney. Am J Physiol Renal Fluid Electrolyte Physiol 269: F500–F507, 1995.[Abstract/Free Full Text]

17. Duffield A, Kamsteeg EJ, Brown AN, Pagel P, and Caplan MJ. The tetraspanin CD63 enhances the internalization of the H+,K+-ATPase {beta}-subunit. Proc Natl Acad Sci USA 100: 15560–15565, 2003.[Abstract/Free Full Text]

18. Gallardo P, Cid LP, Vio CP, and Sepúlveda FV. Aquaporin-2, a regulated water channel, is expressed in apical membranes of rat distal colon epithelium. Am J Physiol Gastrointest Liver Physiol 281: G856–G863, 2001.[Abstract/Free Full Text]

19. Grishin AV and Caplan MJ. ATP1AL1, a member of the non-gastric H+,K+-ATPase family, functions as a sodium pump. J Biol Chem 273: 27772–27778, 1998.[Abstract/Free Full Text]

20. Guntupalli J, Onuigbo M, Wall S, Alpern RJ, and DuBose TD Jr. Adaptation to low-K+ media increases H+-K+-ATPase but not H+-ATPase-mediated pHi recovery in OMCD1 cells. Am J Physiol Cell Physiol 273: C558–C571, 1997.[Abstract/Free Full Text]

21. Hebert SC. Bartter syndrome. Curr Opin Nephrol Hypertens 12: 527–532, 2003.[Web of Science][Medline]

22. Hoffman CS. Current Protocols in Molecular Biology. New York: Wiley, 1997, 13.11.11–13.11.14.

23. Karet FE, Gainza FJ, Györy AZ, Unwin RJ, Wrong O, Tanner MJA, Nayir A, Alpay H, Santos F, Hulton SA, Bakkaloglu A, Ozen S, Cunningham MJ, di Pietro A, Walker WG, and Lifton RP. Mutations in the chloride-bicarbonate exchanger gene AE1 cause autosomal dominant but not autosomal recessive distal renal tubular acidosis. Proc Natl Acad Sci USA 95: 6337–6342, 1998.[Abstract/Free Full Text]

24. Kennel SJ, Lankford PK, Foote LJ, and Davis IA. Monoclonal antibody to rat CD63 detects different molecular forms in rat tissue. Hybridoma 17: 509–515, 1998.[Web of Science][Medline]

25. Kobayashi T, Vischer UM, Rosnoblet C, Lebrand C, Lindsay M, Parton RG, Kruithof EKO, and Gruenberg J. The tetraspanin CD63/lamp3 cycles between endocytic and secretory compartments in human endothelial cells. Mol Biol Cell 11: 1829–1843, 2000.[Abstract/Free Full Text]

26. Kraut JA, Hiura J, Shin JM, Smolka A, Sachs G, and Scott D. The Na+,K+-ATPase {beta}1-subunit is associated with the HK{alpha}2 protein in the rat kidney. Kidney Int 53: 958–962, 1998.[CrossRef][Web of Science][Medline]

27. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680–685, 1970.[CrossRef][Medline]

28. Li J, Codina J, Petroske E, Werle MJ, and DuBose TD Jr. The carboxy terminus of the colonic H+,K+-ATPase {alpha}-subunit is required for stable {beta} subunit assembly and function. Kidney Int 65: 1301–1310, 2004.[CrossRef][Web of Science][Medline]

29. Li J, Codina J, Petroske E, Werle MJ, Willingham MC, and DuBose TD Jr. The effect of {beta}-subunit assembly on function and localization of the colonic H+,K+-ATPase {alpha}-subunit. Kidney Int 66: 1068–1075, 2004.[CrossRef][Web of Science][Medline]

30. Maecker HT, Todd SC, and Levy S. The tetraspanin superfamily: molecular facilitators. FASEB J 11: 428–442, 1997.[Abstract]

31. Ono S, Guntupalli J, and DuBose TD Jr. Role of H+-K+-ATPase in pHi regulation in inner medullary collecting duct cells in culture. Am J Physiol Renal Fluid Electrolyte Physiol 270: F852–F861, 1996.[Abstract/Free Full Text]

32. Sangan P, Rajendran VM, Mann AS, Kashgarian M, and Binder HJ. Regulation of colonic H-K-ATPase in large intestine and kidney by dietary Na depletion and dietary K depletion. Am J Physiol Cell Physiol 272: C685–C696, 1997.[Abstract/Free Full Text]

33. Staub O, Dho S, Henry P, Correa J, Ishikawa T, McGlade J, and Rotin D. WW domains of Nedd4 bind to the proline-rich PY motifs in the epithelial Na+ channel deleted in Liddle's syndrome. EMBO J 15: 2371–2380, 1996.[Web of Science][Medline]

34. Tamarappoo BK and Verkman AS. Defective aquaporin-2 trafficking in nephrogenic diabetes insipidus and correction by chemical chaperones. J Clin Invest 101: 2257–2267, 1998.[Web of Science][Medline]

35. Vischer UM and Wagner DD. CD63 is a component of Weibel-Palade bodies of human endothelial cells. Blood 82: 1184–1191, 1993.[Abstract/Free Full Text]

36. Yauch RL and Hemler ME. Specific interactions among transmembrane 4 superfamily (TM4SF) proteins and phosphoinositide 4-kinase. Biochem J 351: 629–637, 2000.[Medline]




This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
J. Schroder, R. Lullmann-Rauch, N. Himmerkus, I. Pleines, B. Nieswandt, Z. Orinska, F. Koch-Nolte, B. Schroder, M. Bleich, and P. Saftig
Deficiency of the Tetraspanin CD63 Associated with Kidney Pathology but Normal Lysosomal Function
Mol. Cell. Biol., February 15, 2009; 29(4): 1083 - 1094.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Kallquist, M. Hansson, A.-M. Persson, H. Janssen, J. Calafat, H. Tapper, and I. Olsson
The tetraspanin CD63 is involved in granule targeting of neutrophil elastase
Blood, October 15, 2008; 112(8): 3444 - 3454.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. Ruiz-Mateos, A. Pelchen-Matthews, M. Deneka, and M. Marsh
CD63 Is Not Required for Production of Infectious Human Immunodeficiency Virus Type 1 in Human Macrophages
J. Virol., May 15, 2008; 82(10): 4751 - 4761.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
J. Codina, J. Liu, A. J. Bleyer, R. B. Penn, and T. D. DuBose Jr.
Phosphorylation of S955 at the Protein Kinase A Consensus Promotes Maturation of the {alpha} Subunit of the Colonic H+,K+-ATPase
J. Am. Soc. Nephrol., July 1, 2006; 17(7): 1833 - 1840.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A corrigendum has been published
Right arrow All Versions of this Article:
288/6/C1279    most recent
00463.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Codina, J.
Right arrow Articles by DuBose, T. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Codina, J.
Right arrow Articles by DuBose, T. D., Jr.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.