|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
PROTEIN AND VESICLE TRAFFICKING, CYTOSKELETON
1Department of Molecular and Cell Biology, University of California, Berkeley, California; and 2Department of Pathology, University of Oklahoma Health Science Center, Oklahoma City, Oklahoma
Submitted 26 October 2004 ; accepted in final form 25 January 2005
| ABSTRACT |
|---|
|
|
|---|
fluorescence resonance energy transfer; acid secretion; radixin; moesin; cytoskeleton; ERM family
2-adrenergic receptor (9) and therefore could also mediate possible indirect interactions between these proteins and ezrin. The N-ERMAD and C-ERMAD can also bind to each other. With the use of bacterially expressed glutathione-S-transferase (GST)-ezrin fusion proteins and various ezrin NH2- and COOH-terminal truncated GST-ezrin fusion constructs in blot overlay experiments, specific binding between N-ERMAD and C-ERMAD was demonstrated (16). With the use of the same technique, the full-length ezrin fusion protein was shown to have a masked C-ERMAD, and the reasonable assumption was drawn that ezrin monomer has an intramolecular NH2- and COOH-terminal association domain (N-C) binding conformation. The binding of N- and C-ERMAD to each other is supported by several other observations. First, stable ezrin dimer was obtained together with monomer from human placental extraction, and these two forms are not readily interconvertible in vitro, as observed in gel filtration analysis (7). Second, with the use of labeled ezrin as a probe, ezrin-ezrin interactions were shown in blot overlay experiments (4, 15). It is important to note that ezrin on the blot is denatured, because otherwise the native ezrin monomer usually takes a dormant form that could not bind another ezrin molecule. Nonetheless, the results indicate the ability of ezrin to form oligomers. However, direct evidence of ezrin N-C binding has not been shown in in vivo experiments.
Ezrin is a major cytoskeleton-membrane linker protein in the gastric parietal cell, being especially prominent at the apical plasma membrane in association with microvilli at the secretory surface. Ezrin and its phosphorylation have been shown to be functionally important for acid secretion by parietal cells and for the major membrane transformations that accompany secretory activity. An understanding of the role of ezrin in organizing cell surface structures is vital to appreciating parietal cell function. On the other hand, because of the dramatic morphological and functional transitions between the resting and stimulated states of parietal cells, this model system is a very useful one in which to study ezrin. In the present study, we used parietal and HeLa cells to study the oligomerization of ezrin because the switching between monomer and oligomer is thought to regulate the function of this protein and already has been shown to affect the morphology of LLC-PK1 epithelial cells (4, 18). To obtain direct in vivo information, we created several fusion constructs with cyan fluorescent protein (CFP) and/or yellow fluorescent protein (YFP) tags inserted at the NH2 terminus or the COOH terminus of ezrin. The intermolecular and intramolecular N-C binding of ezrin was visualized using fluorescence resonance energy transfer (FRET) between the CFP and YFP tags, as well as by performing immunoprecipitation among molecules. A shift of ezrin oligomer to monomer was observed to be coincident with the functional stimulation of acid secretion by gastric parietal cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Recombinant adenoviruses. Ezrin cDNA was excised from the plasmid enhanced GFP (pEGFP)-N1/ezrin (45) and inserted into pECFP-N1 using the restriction enzymes SalI and EcoRI. From the resulting pECFP-N1/ezrin, the whole open reading frame, together with the upstream promoter and downstream transcriptional termination sequences, was then amplified by performing PCRs with the following primers: sense primer, TAAAGGCCTTACCGCCATGCATTAG, and antisense primer, TTTAGGCCTACCACAACTAGAATGC. The PCR products were digested with StuI and inserted into similarly digested shuttle vector pDC311 (Microbix Biosystems, Toronto, ON, Canada), resulting in pDC311/Ez-C. For pDC311/Y-Ez-C, the YFP sequence was amplified from pEYFP-C1 (BD Biosciences Clontech) using the following primers: sense primer, GCCGAATTCTAGTTATTAATAGTAATC; antisense primer, CTGAGCTCGAGCTTGTACAGCTCGTCC. The PCR product was then digested with XhoI and EcoRI and inserted into similarly digested pDC311/Ez-C, generating pDC311/Y-Ez-C. To obtain pDC311/Y-Ez, the ezrin sequence was amplified with the following primers: sense primer, AGGTGTGGCATGCGGAACACCGTGGGATGC; antisense primer containing a stop codon, GGCCCGCGGTGCGGCCGCTTACAGGGCCTCGAACTCG. The resulting PCR products (ezrin sequence) were used to replace the ezrin and CFP sequence in pDC311/Y-Ez-C with the enzymes SphI and NotI, resulting in pDC311/Y-Ez. All PCRs were performed with Vent polymerase (New England BioLabs, Boston, MA) and verified by sequencing.
Recombinant adenovirus (rAD) rAD/Ez-C was generated by cotransfection of human embryonic kidney (HEK)-293 cells with pDC311/Ez-C and pBHGlox
E1,3Cre (Microbix Biosystems) containing modified adenovirus type 5 genome using the CellPhect transfection kit (Amersham Biosciences, Little Chalfont, UK). A single viral colony was isolated, amplified, and titrated. Aliquots of virus were stored at 80°C. Viruses rAD/Y-Ez-C and rAD/Y-Ez were similarly generated. A schematic of the recombinant adenoviral constructs is shown in Fig. 1A.
|
Cell culture and gastric gland and parietal cell isolation. HeLa cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum in a humid 37°C incubator with 5% CO2. Gastric glands and parietal cells were isolated from rabbit stomach as previously described (23). Isolated parietal cells were plated onto Matrigel (BD Biosciences)-coated coverslips in 12-well plates and incubated at 37°C in culture medium composed of DMEM/Ham's F-12 medium (GIBCO-BRL, Grand Island, NY) supplemented with 20 mM HEPES; 0.2% BSA; 10 mM glucose; 8 nM epidermal growth factor; 1x sodium selenite, insulin, transferrin, ethanolamine (SITE) medium (Sigma S4920); 1 mM glutamine; 100 U/ml penicillin/streptomycin; and 400 µg/ml gentamicin sulfate. Cells or glands were infected with recombinant adenovirus at the multiplicity of infection of 10 infectious units (IU)/cell for 48 h.
The [14C]aminopyrine (AP) uptake assay was used as previously described (42) to evaluate functional secretory activity of isolated gastric glands. Glands were either stimulated via the cAMP pathway with 100 µM histamine supplemented with 50 µM IBMX for maximal H+ secretory activity or maintained at the resting state using a histamine receptor antagonist (100 µM cimetidine).
Fluorescent staining and confocal microscopy. To double-stain F-actin and fluorescent protein-tagged ezrin, parietal cells were grown on Matrigel-coated coverslips and infected with rADs. After 3648 h, the cells were fixed with 3.7% formaldehyde, permeabilized with 0.1% Triton X-100, and then incubated with rabbit anti-GFP, followed by incubation with rhodamine-conjugated goat anti-rabbit IgG and Alexa 488-phalloidin. Images were obtained using a Zeiss 510 META confocal microscope. Alexa 488 fluorescence was collected at 494548 nm with a 488-nm laser. Rhodamine fluorescence was collected at 590687 nm with a 543-nm laser.
FRET measurement using spectrofluorometry. To measure the FRET of cell-free samples, the cells or glands expressing fluorescent proteins were lysed in lysis buffer containing 1% Triton X-100, 150 mM NaCl, 2 mM EDTA, 50 mM Tris, pH 7.0, and 2 mM 4-(2-aminoethyl)benzenesulfonyl fluoride. The lysate was cleared by performing centrifugation at 16,000 g for 10 min at 4°C. The fluorescence emission was measured on a Spex spectrofluorometer. For CFP, excitation was set at 425 nm and emission was scanned from 450 to 550 nm. For YFP, excitation was set at 485 nm and emission was scanned from 500 to 550 nm. The emission scan spectra were corrected for background using lysates from noninfected cells or glands.
Calpain I treatment. For experiments involving calpain I, infected cells or glands were sonicated in cold calpain I buffer containing 1 mM CaCl2 and 1 mM dithiothreitol in Tris-buffered saline. The lysate was cleared by performing ultracentrifugation at 100,000 g for 20 min at 4°C before calpain I was added (3 U/ml; Sigma) and incubated at room temperature for 1 h. The reaction was then stopped by adding EDTA to a final concentration of 5 mM. Samples were stored frozen or immediately assessed using spectrofluorometry and Western blot analysis.
FRET measurement using confocal microscopy. Infected HeLa or parietal cells grown on coverslips were mounted on glass slides without fixation. Cells were immediately examined under a Zeiss 510 META confocal microscope. CFP images were collected using a 462- to 483-nm emission filter and an excitation laser of 458 nm; YFP images were collected using a 526- to 537-nm emission filter and an excitation laser of 514 nm; and FRET images were collected using a 526- to 537-nm emission filter and an excitation laser of 458 nm. Laser strength, pinhole, detector gain, and amplifier gain were fixed for all samples. Because the expressed fluorescence protein is located all over the cell, quantitation of FRET was performed with whole individual cells. Measurement of FRET signals, correction of bleed-through, and normalization of the FRET data were all performed as previously described (40). The norms for the percentage of CFP or YFP bleed-through under the microscope settings specified above were determined to be 0.38 (a, CFP) and 0.15 (b, YFP) using cells expressing pure CFP and pure YFP, respectively. No bleed-through signal from CFP under the YFP filter setting was observed, and vice versa. Net FRET (nF) was calculated as nF = (IFRET) (ICFP x a) (IYFP x b), where ICFP, IYFP, and IFRET are the respective intensities of CFP, YFP, and FRET signals in each cell, and a and b are the corrections for CFP and YFP bleed-through, respectively. The net FRET signal was normalized on the basis of relative CFP and YFP intensities according to the method described previously by Xia and Liu (40). Thus normalized FRET (NFRET) was calculated as NFRET = nF (IYFP x ICFP)1/2.
Immunoprecipitation, Western blot analysis, and mass spectrometry. Gastric glands or HeLa cells infected or not infected with rADs were lysed with lysis buffer, adjusted to 1 mg/ml of total protein concentration using the Bradford assay for protein quantitation, followed by preclearing with protein G-agarose. The precleared lysates were then added to rabbit anti-GFP or mouse anti-ezrin, immobilized on protein G-agarose, and rotated end over end at 4°C for 2 h. After the captured protein was washed with lysis buffer, we released it by boiling the agarose beads with SDS-PAGE loading buffer for 5 min. Immunoprecipitation samples were then separated on 12.5% SDS-PAGE gel for Western blot analysis or mass spectrometry. For Western blot analysis, proteins were transferred onto nitrocellulose membrane and separately probed with polyclonal anti-GFP and monoclonal anti-ezrin. The results were visualized using the Western Lightning chemiluminescence substrate (PerkinElmer Life Sciences, Boston, MA). For mass spectrometry, gels were stained with Coomassie blue. In-gel digestion of the proteins with trypsin was performed as previously described (46). The peptides were analyzed using liquid chromatography-tandem mass spectrometry on a QSTAR pulsar tandem mass spectrometer (Applied Biosystems, Foster City, CA) at the mass spectrometry facility at the University of California, San Francisco. Results were analyzed with Mascot software (available at: http://www.matrixscience.com/; Matrix Science, Boston, MA) and confirmed manually.
Gel filtration chromatography. Superose 6 prep grade (Amersham Biosciences, Sweden) was used to pack a column with a total volume of 22 ml. The void volume was 8.5 ml as determined using blue dextran 2000. The column was also characterized with protein standards consisting of thyroglobulin (669 kDa) and BSA (67 kDa). Resting or stimulated gastric glands were homogenized in PBS. The postnuclear supernatant obtained after centrifugation at 600 g for 5 min at 4°C was subjected to 100,000 g ultracentrifugation at 4°C for 20 min. The supernatant from each sample (200 µl) was loaded into the gel filtration column and run at a flow rate of 0.3 ml/min. Fractions of 0.17 or 0.34 ml were collected as specified in the figure legends. Fractions were subjected to Western blot analysis (anti-ezrin) or to fluorescence measurement using spectrofluorometry.
| RESULTS |
|---|
|
|
|---|
|
1080 Å (37, 41). CFP and YFP have frequently been used as a respective donor and acceptor pair to monitor FRET and evaluate molecular associations both within (intra-) and between (inter-) biological molecules. To visualize the N-C binding of ezrin, FRET analysis was first performed in HeLa cells expressing ezrin with various fluorescent protein tags, including YFP-Ez, Ez-CFP, and double-tagged ezrin with YFP at the NH2 terminus and CFP at the COOH terminus (Y-Ez-C) according to the schema shown in Fig. 1. Fluorescence emission spectra from lysates of HeLa cells expressing fluorescent proteins are displayed in Fig. 3. By using the CFP excitation peak of 425 nm, lysed HeLa cells transfected with pECFP-N1 (to express CFP alone) showed a typical CFP emission spectrum comprising a major emission peak at 477 nm with a minor peak at
503 nm (Fig. 3A); no significant emission was observed with the YFP excitation peak of 485 nm (Fig. 3B). Lysed cells transfected with pEYFP-C1 (to express YFP alone) showed a typical YFP emission spectrum that peaked at 526 nm when excited at 485 nm (Fig. 3D) but negligible emission signal when excited at 425 nm (Fig. 3C). A negative control for FRET was developed by cotransfecting HeLa cells with equal amounts of pECFP-N1 and pEYFP-C1 (to coexpress CFP and YFP). This sample had combined features of a CFP sample and a YFP sample. At excitation of 425 nm, a CFP emission spectrum was observed with a 477-nm major peak and a 503-nm minor peak (Fig. 3E), and a typical YFP emission spectrum also was observed at 485-nm excitation (Fig. 3F). No significant FRET was detected, because the 425-nm excitation has a shape similar to that of the pure CFP sample. If FRET were present, we should have observed a FRET peak (or increased emission) at 526 nm with 425-nm excitation as demonstrated with the positive control sample (Fig. 3I), which is a construct of CFP and YFP linked by 37 amino acids. Figure 3J shows the emission spectrum of the positive control sample at excitation of 485 nm. Importantly, the emission spectrum of cells expressing Y-Ez-C at excitation 425 nm exhibited some FRET signal; compared with cells expressing CFP and YFP, there was a significant elevation of emission at 526 nm (Fig. 3G). As expected, a normal YFP emission spectrum was also observed with the Y-Ez-C sample (Fig. 3H). However, we wondered whether any protein with CFP and YFP at the NH2 and COOH termini would show some FRET signal. To address this question, a construct with CFP and YFP linked by a much smaller protein molecule was used as an additional control. One of the soluble N-ethylmaleimide-sensitive factor attachment protein receptor proteins, vesicle-associated membrane protein VAMP2, is a small protein of 116 amino acids compared with 586 amino acids for ezrin. As shown in Fig. 3K, the residual FRET signal from the Y-VAMP2-C sample was negligible compared with the Y-Ez-C sample.
|
|
|
0.05), consistent with the spectral data and suggesting close localization of a population of the two fluorescent proteins. A second method to evaluate FRET is to look for an enhancement of the donor signal when the acceptor fluorophore is eliminated by bleaching. Accordingly, the FRET-positive cells were bleached with a 514-nm laser and the signal from the YFP channel was significantly decreased, which was accompanied by an elevated CFP signal (Fig. 5B). Similar results were observed with rabbit gastric parietal cells expressing Y-Ez-C (Fig. 5C). The mean NFRET for eight parietal cells was 0.26 ± 0.04 (P
0.05); and the signal from the CFP channel was significantly increased after the YFP fluorescence was bleached. Intermolecular N-C binding of ezrin. We also wished to know whether the observed N-C binding revealed by FRET analysis with the Y-Ez-C construct is from intra- or inter-molecular ezrin interactions. Thus HeLa cells expressing both the Ez-CFP and YFP-Ez ezrin species were studied using confocal microscopy. Normalized FRET data showed that specific FRET occurred in HeLa cells expressing both Ez-CFP and YFP-Ez (Fig. 6A), although the measured FRET was lower than that obtained for the double-labeled Y-Ez-C protein. The mean NFRET measured for eight cells was 0.18 ± 0.02 (mean ± SE), significantly less than that measured for HeLa cells expressing Y-Ez-C (P < 0.05) and significantly greater than control cells double transfected with CFP and YFP. When the cells were bleached with the 514-nm laser, the YFP signal decreased, accompanied by a small but consistent elevation of the CFP signal (Fig. 6A). However, when the same experiment was performed with rabbit gastric parietal cells, no FRET was detected. NFRET was close to zero, and no elevation of CFP was observed after it was bleached with a 514-nm laser (data not shown). The reason for this lack of FRET could be the sensitivity of the technique or competition from nonfluorescent endogenous ezrin because the gastric parietal cell has a very high level of ezrin expression. Thus another approach to this problem was used.
|
Intramolecular ezrin N-C binding. Because intermolecular N-C binding was clearly shown by the FRET and coimmunoprecipitation results, uncertainty emerged regarding whether there is indeed intramolecular N-C self-association of ezrin. The Y-Ez-C construct was used to clarify this question. Y-Ez-C expressed in HeLa cells was extracted and applied to a gel filtration chromatography column. Fluorescent protein-tagged ezrins with different apparent molecular masses were separated (Fig. 7A) and analyzed using spectrofluorometry. Not surprisingly, the fractions eluted earlier corresponding to higher molecular mass ezrin compounds, represented by fraction 17, showed a FRET emission peak at 526 nm in addition to the CFP peak when excited with a 425-nm source (Fig. 7B). In the later eluting fractions corresponding to ezrin monomer, represented by fraction 22, a similar FRET peak was observed (Fig. 7C). The specificity of the FRET signal was shown by adding SDS to the samples, which separated the ezrin N-C binding while leaving the fluorescent proteins intact. Addition of 2% SDS resulted in diminished FRET peaks and slightly increased CFP signals (Fig. 7, B and C). When the proteins were completely denatured by boiling the sample for 5 min, most of the fluorescence disappeared (Fig. 7, B and C). Because ezrin monomer is expected to be the dominant form in the more slowly eluting fractions, the FRET signal of ezrin monomer is not likely to represent contamination by ezrin oligomer. Thus we have demonstrated intramolecular ezrin N-C binding in a native system.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Oligomer is a dormant form of ezrin. In vitro data suggest that dormant ezrin monomer takes an N-C binding conformation, masking some functional domains on N-ERMAD and C-ERMAD (16, 26, 27). In the present study, the FRET data suggest that dormant ezrin monomer and ezrin oligomers share a structural similarity of N-C binding, indicating a functional similarity between ezrin oligomers and dormant ezrin monomer (i.e., ezrin oligomer is a dormant form of ezrin). The hypothesis that ezrin oligomers are a dormant form of ezrin was supported by an earlier study of ezrin dimers obtained from placental extraction in which ezrin dimers were found to have a masked C-ERMAD domain (7). Consistent with this notion is that the transition from ezrin oligomers to monomers correlated with the formation of lamellipodia, membrane ruffles, and tufts of microvilli on LLC-PK1 epithelial cell membranes (18). An extension of this result is shown in gastric parietal cells in the present study: upon stimulation monitored by AP uptake analysis, ezrin shifted from oligomeric to monomeric form (Fig. 8). These results suggest that ezrin oligomers are dormant forms of this cellular organizer. However, when human epidermoid carcinoma A431 cells were treated with EGF, the shift from ezrin monomer to oligomer (mostly dimers) correlated with ezrin tyrosine phosphorylation in a previous study (5). On the basis of this observation, the authors of that study proposed a model in which ezrin oligomers would represent an active form of ezrin. This assumption is in conflict with their earlier observation that the ezrin dimer has a masked C-ERMAD. Also, in their EGF experiment with A431 cells, the cross-linked ezrin dimer had a molecular mass considerably greater than the observed cross-linked 160-kDa ezrin dimer from placental cells described in the same study.
These discrepancies in the observations regarding ezrin oligomers in different cells may reflect the different mechanisms of ezrin activation. In serum-starved Swiss 3T3 cells, stimulation with lysophosphatidic acid (LPA) leads to phosphorylation of radixin on threonine T564. (The corresponding conserved threonine is T567 in ezrin and T558 in moesin.) In vitro analysis demonstrated that phosphorylation of radixin T564 significantly suppressed the binding between N-ERMAD and C-ERMAD (28). Similarly, in vitro binding experiments demonstrated that phosphorylation of T567 on ezrin or T558 on moesin by protein kinase C (PKC)-
activates the F-actin and EBP50 binding activities of both proteins (35). On the basis of experiments comparing ezrin T567 mutants with wild-type ezrin in LLC-PK1 epithelial cells, phosphorylation of the conserved threonine residue (T567) was suggested to disrupt the ezrin N-C binding and thus break ezrin oligomers into monomers (18). Ezrin T567 phosphorylation was also suggested to play roles in the early development of the mouse embryo (11). In contrast, in A431 cells in which the ezrin oligomer was thought to be an active form of ezrin, tyrosine and serine phosphorylation were observed and correlated with the remodeling of the cell surface upon EGF stimulation (6). The tyrosine phosphorylation sites were mapped as Y145 and Y353 (24). Research with NIH-3T3 fibroblasts also implicated the tyrosine phosphorylation of ezrin (13). Complicating the issue, tyrosine phosphorylation of ezrin also was observed in the LLC-PK1 epithelial cells under conditions, with ezrin being a substrate of hepatocyte growth factor (HGF) receptor. Site-directed mutagenesis of ezrin codons Y145 and Y353 to phenylalanine did not affect the localization of ezrin at microvilli but did perturb the motogenic and morphogenic responses to HGF (10). While it is still not clear whether these tyrosine phosphorylation events are related to the activation of ezrin itself, evidence suggests that Y353 phosphorylation is part of the mechanism of ezrin participation in signal transduction (17). The gastric parietal cell also may have a distinct pathway for the phosphorylation of ezrin, the latter being highly correlated with stimulation of acid secretion mediated by the PKA pathway. Analysis of phospho-amino acids from ezrin radiolabeled in situ revealed that only serine residues were phosphorylated; phosphorylation was not detected on tyrosine or threonine residues (39). In preliminary phosphopeptide analysis using mass spectrometry, none of the above-mentioned threonines or tyrosines were found to be phosphorylated; instead, S66 was found to be a substrate of PKA stimulation (45).
Different binding domains on ezrin N-ERMAD. The localization of NH2 terminus-tagged ezrin was shown to be mainly cytosolic (Figs. 2 and 5), consistent with previous observations in fluorescent protein-tagged ERM proteins (3, 21). However, these NH2 terminus-tagged N-ERMADs are still able to bind to C-ERMADs as shown by FRET experiments using Y-Ez-C and YFP-Ez. This result supports an earlier model proposed by Gary and Bretscher (16), in which two binding domains were depicted on N-ERMAD, with one being responsible for membrane binding and the other being responsible for C-ERMAD binding. The in vivo results presented herein, along with previous in vitro evidence, indicate that dormant ezrin molecules with N-ERMAD and C-ERMAD intramolecular binding can still bind to membranes.
Our observations made using confocal microscopy confirm the earlier result that dormant ezrin sits on or near plasma membranes, especially the apical membrane. Similarly to endogenous ezrin, Ez-CFP is localized to plasma membranes in both HeLa and parietal cells, while NH2 terminus-tagged YFP-Ez has a much more diffuse distribution in both cell types, with only residual membrane association. If the membrane-associated ezrin were the active form, which binds to membranes via the N-ERMAD and to F-actin via the C-ERMAD, one would expect the association of Ez-CFP with the membrane to be very stable. However, this does not seem to be the case, because when Ez-CFP was expressed together with YFP-Ez, the CFP came off the membrane as indicated by diffuse localization (Fig. 2). Particularly in parietal cells, the data indicate that those Ez-CFP molecules were not active on the apical membrane.
Because ezrin plays an important role in acid secretion in parietal cells, its membrane localization, especially the apical location of dormant ezrin, seems reasonable for ezrin to perform its cellular function. When parietal cells are stimulated via the PKA-mediated pathway, the apical membrane is dramatically expanded. One might expect that more ezrin would be recruited to its functional site of action. There is no evidence to suggest that there is any stimulation-associated relocation of ezrin from the cytoplasm or from any other cellular site. However, the data presented herein suggest an alternate way for cells to meet their need: by activation of the dormant ezrin oligomers that are weakly retained in the apical membrane pool. Gel filtration analysis with the ezrin prepared from resting and stimulated gastric glands has demonstrated a shift from oligomers to monomers associated with the stimulation.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Algrain M, Turunen O, Vaheri A, Louvard D, and Arpin M. Ezrin contains cytoskeleton and membrane binding domains accounting for its proposed role as a membrane-cytoskeletal linker. J Cell Biol 120: 129139, 1993.
3. Amieva MR, Litman P, Huang L, Ichimaru E, and Furthmayr H. Disruption of dynamic cell surface architecture of NIH3T3 fibroblasts by the N-terminal domains of moesin and ezrin: in vivo imaging with GFP fusion proteins. J Cell Sci 112: 111125, 1999.[Abstract]
4. Andréoli C, Martin M, Le Borgne R, Reggio H, and Mangeat P. Ezrin has properties to self-associate at the plasma membrane. J Cell Sci 107: 25092521, 1994.[Abstract]
5. Berryman M, Gary R, and Bretscher A. Ezrin oligomers are major cytoskeletal components of placental microvilli: a proposal for their involvement in cortical morphogenesis. J Cell Biol 131: 12311242, 1995.
6. Bretscher A. Rapid phosphorylation and reorganization of ezrin and spectrin accompany morphological changes induced in A-431 cells by epidermal growth factor. J Cell Biol 108: 921930, 1989.
7. Bretscher A, Gary R, and Berryman M. Soluble ezrin purified from placenta exists as stable monomers and elongated dimers with masked C-terminal ezrin-radixin-moesin association domains. Biochemistry 34: 1683016837, 1995.[CrossRef][Medline]
8. Bretscher A. Regulation of cortical structure by the ezrin-radixin-moesin protein family. Curr Opin Cell Biol 11: 109116, 1999.[CrossRef][Web of Science][Medline]
9. Cao TT, Deacon HW, Reczek D, Bretscher A, and von Zastrow M. A kinase-regulated PDZ-domain interaction controls endocytic sorting of the
2-adrenergic receptor. Nature 401: 286290, 1999.[CrossRef][Medline]
10. Crepaldi T, Gautreau A, Comoglio PM, Louvard D, and Arpin M. Ezrin is an effector of hepatocyte growth factor-mediated migration and morphogenesis in epithelial cells. J Cell Biol 138: 423434, 1997.
11. Dard N, Louvet-Vallée S, Santa-Maria A, and Maro B. Phosphorylation of ezrin on threonine T567 plays a crucial role during compaction in the mouse early embryo. Dev Biol 271: 8797, 2004.[CrossRef][Web of Science][Medline]
12. Duman JG, Pathak NJ, Ladinsky MS, McDonald KL, and Forte JG. Three-dimensional reconstruction of cytoplasmic membrane networks in parietal cells. J Cell Sci 115: 12511258, 2002.
13. Fazioli F, Wong WT, Ullrich SJ, Sakaguchi K, Appella E, and Di Fiore PP. The ezrin-like family of tyrosine kinase substrates: receptor-specific pattern of tyrosine phosphorylation and relationship to malignant transformation. Oncogene 8: 13351345, 1993.[Web of Science][Medline]
14. Forte JG, Black JA, Forte TM, Machen TE, and Wolosin JM. Ultrastructural changes related to functional activity in gastric oxyntic cells. Am J Physiol Gastrointest Liver Physiol 241: G349G358, 1981.
15. Gary R and Bretscher A. Heterotypic and homotypic associations between ezrin and moesin, two putative membrane-cytoskeletal linking proteins. Proc Natl Acad Sci USA 90: 1084610850, 1993.
16. Gary R and Bretscher A. Ezrin self-association involves binding of an N-terminal domain to a normally masked C-terminal domain that includes the F-actin binding site. Mol Biol Cell 6: 10611075, 1995.[Abstract]
17. Gautreau A, Poullet P, Louvard D, and Arpin M. Ezrin, a plasma membrane-microfilament linker, signals cell survival through the phosphatidylinositol 3-kinase/Akt pathway. Proc Natl Acad Sci USA 96: 73007305, 1999.
18. Gautreau A, Louvard D, and Arpin M. Morphogenic effects of ezrin require a phosphorylation-induced transition from oligomers to monomers at the plasma membrane. J Cell Biol 150: 193203, 2000.
19. Gentzsch M, Cui L, Mengos A, Chang XB, Chen JH, and Riordan JR. The PDZ-binding chloride channel ClC-3B localizes to the Golgi and associates with cystic fibrosis transmembrane conductance regulator-interacting PDZ proteins. J Biol Chem 278: 64406449, 2003.
20. Heiska L, Alfthan K, Grönholm M, Vilja P, Vaheri A, and Carpén O. Association of ezrin with intercellular adhesion molecule-1 and -2 (ICAM-1 and ICAM-2): regulation by phosphatidylinositol 4,5-bisphosphate. J Biol Chem 273: 2189321900, 1998.
21. Henry MD, Gonzalez Agosti C, and Solomon F. Molecular dissection of radixin: distinct and interdependent functions of the amino- and carboxy-terminal domains. J Cell Biol 129: 10071022, 1995.
22. Ivetic A and Ridley AJ. Ezrin/radixin/moesin proteins and Rho GTPase signalling in leucocytes. Immunology 112: 165176, 2004.[CrossRef][Web of Science][Medline]
23. Karvar S, Yao X, Duman JG, Hybiske K, Liu Y, and Forte JG. Intracellular distribution and functional importance of vesicle-associated membrane protein 2 in gastric parietal cells. Gastroenterology 123: 281290, 2002.[CrossRef][Web of Science][Medline]
24. Krieg J and Hunter T. Identification of the two major epidermal growth factor-induced tyrosine phosphorylation sites in the microvillar core protein ezrin. J Biol Chem 267: 1925819265, 1992.
25. Mahon MJ, Donowitz M, Yun CC, and Segre GV. Na+/H+ exchanger regulatory factor 2 directs parathyroid hormone 1 receptor signalling. Nature 417: 858861, 2002.[CrossRef][Medline]
26. Martin M, Andréoli C, Sahuquet A, Montcourrier P, Algrain M, and Mangeat P. Ezrin NH2-terminal domain inhibits the cell extension activity of the COOH-terminal domain. J Cell Biol 128: 10811093, 1995.
27. Martin M, Roy C, Montcourrier P, Sahuquet A, and Mangeat P. Three determinants in ezrin are responsible for cell extension activity. Mol Biol Cell 8: 15431557, 1997.[Abstract]
28. Matsui T, Maeda M, Doi Y, Yonemura S, Amano M, Kaibuchi K, and Tsukita S. Rho-kinase phosphorylates COOH-terminal threonines of ezrin/radixin/moesin (ERM) proteins and regulates their head-to-tail association. J Cell Biol 140: 647657, 1998.
29. Maudsley S, Zamah AM, Rahman N, Blitzer JT, Luttrell LM, Lefkowitz RJ, and Hall RA. Platelet-derived growth factor receptor association with Na+/H+ exchanger regulatory factor potentiates receptor activity. Mol Cell Biol 20: 83528363, 2000.
30. Reczek D, Berryman M, and Bretscher A. Identification of EBP50: A PDZ-containing phosphoprotein that associates with members of the ezrin-radixin-moesin family. J Cell Biol 139: 169179, 1997.
31. Reczek D and Bretscher A. The carboxyl-terminal region of EBP50 binds to a site in the amino-terminal domain of ezrin that is masked in the dormant molecule. J Biol Chem 273: 1845218458, 1998.
32. Sawaguchi A, McDonald KL, Karvar S, and Forte JG. A new approach for high-pressure freezing of primary culture cells: the fine structure and stimulation-associated transformation of cultured rabbit gastric parietal cells. J Microsc 208: 158166, 2002.[Web of Science][Medline]
33. Serrador JM, Vicente-Manzanares M, Calvo J, Barreiro O, Montoya MC, Schwartz-Albiez R, Furthmayr H, Lozano F, and Sanchez-Madrid F. A novel serine-rich motif in the intercellular adhesion molecule 3 is critical for its ezrin/radixin/moesin-directed subcellular targeting. J Biol Chem 277: 1040010409, 2002.
34. Short DB, Trotter KW, Reczek D, Kreda SM, Bretscher A, Boucher RC, Stutts MJ, and Milgram SL. An apical PDZ protein anchors the cystic fibrosis transmembrane conductance regulator to the cytoskeleton. J Biol Chem 273: 1979719801, 1998.
35. Simons PC, Pietromonaco SF, Reczek D, Bretscher A, and Elias L. C-terminal threonine phosphorylation activates ERM proteins to link the cell's cortical lipid bilayer to the cytoskeleton. Biochem Biophys Res Commun 253: 561565, 1998.[CrossRef][Web of Science][Medline]
36. Sun F, Hug MJ, Lewarchik CM, Yun CHC, Bradbury NA, and Frizzell RA. E3KARP mediates the association of ezrin and protein kinase A with the cystic fibrosis transmembrane conductance regulator in airway cells. J Biol Chem 275: 2953929546, 2000.
37. Tsien RY. The green fluorescent protein. Annu Rev Biochem 67: 509544, 1998.[CrossRef][Web of Science][Medline]
38. Turunen O, Wahlström T, and Vaheri A. Ezrin has a COOH-terminal actin-binding site that is conserved in the ezrin protein family. J Cell Biol 126: 14451453, 1994.
39. Urushidani T, Hanzel DK, and Forte JG. Characterization of an 80-kDa phosphoprotein involved in parietal cell stimulation. Am J Physiol Gastrointest Liver Physiol 256: G1070G1081, 1989.
40. Xia Z and Liu Y. Reliable and global measurement of fluorescence resonance energy transfer using fluorescence microscopes. Biophys J 81: 23952402, 2001.[Web of Science][Medline]
41. Xu Y, Kanauchi A, von Arnim AG, Piston DW, and Johnson CH. Bioluminescence resonance energy transfer: monitoring protein-protein interactions in living cells. Methods Enzymol 360: 289301, 2003.[Web of Science][Medline]
42. Yao X, Thibodeau A, and Forte JG. Ezrin-calpain I interactions in gastric parietal cells. Am J Physiol Cell Physiol 265: C36C46, 1993.
43. Yonemura S, Hirao M, Doi Y, Takahashi N, Kondo T, and Tsukita S. Ezrin/radixin/moesin (ERM) proteins bind to a positively charged amino acid cluster in the juxta-membrane cytoplasmic domain of CD44, CD43, and ICAM-2. J Cell Biol 140: 885895, 1998.
44. Yun CHC, Lamprecht G, Forster DV, and Sidor A. NHE3 kinase A regulatory protein E3KARP binds the epithelial brush border Na+/H+ exchanger NHE3 and the cytoskeletal protein ezrin. J Biol Chem 273: 2585625863, 1998.
45. Zhou R, Cao X, Watson C, Miao Y, Guo Z, Forte JG, and Yao X. Characterization of protein kinase A-mediated phosphorylation of ezrin in gastric parietal cell activation. J Biol Chem 278: 3565135659, 2003.
46. Zhou R, Watson C, Fu C, Yao X, and Forte JG. Myosin II is present in gastric parietal cells and required for lamellipodial dynamics associated with cell activation. Am J Physiol Cell Physiol 285: C662C673, 2003.
This article has been cited by other articles:
![]() |
R. F. Hennigan, L. A. Foster, M. F. Chaiken, T. Mani, M. M. Gomes, A. B. Herr, and W. Ip Fluorescence Resonance Energy Transfer Analysis of Merlin Conformational Changes Mol. Cell. Biol., January 1, 2010; 30(1): 54 - 67. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lee, S. Choi, G. Hallden, S. J. Yo, D. Schichnes, and G. W. Aponte P2Y5 is a G{alpha}i, G{alpha}12/13 G protein-coupled receptor activated by lysophosphatidic acid that reduces intestinal cell adhesion Am J Physiol Gastrointest Liver Physiol, October 1, 2009; 297(4): G641 - G654. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pagliocca, P. Hegyi, V. Venglovecz, S. A. Rackstraw, Z. Khan, G. Burdyga, T. C. Wang, R. Dimaline, A. Varro, and G. J. Dockray Identification of ezrin as a target of gastrin in immature mouse gastric parietal cells Exp Physiol, November 1, 2008; 93(11): 1174 - 1189. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhu, J. Hatakeyama, C. Chen, A. Shastri, K. Poon, and J. G. Forte Comparative study of ezrin phosphorylation among different tissues: more is good; too much is bad Am J Physiol Cell Physiol, July 1, 2008; 295(1): C192 - C202. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhu, R. Zhou, S. Mettler, T. Wu, A. Abbas, J. Delaney, and J. G. Forte High turnover of ezrin T567 phosphorylation: conformation, activity, and cellular function Am J Physiol Cell Physiol, September 1, 2007; 293(3): C874 - C884. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Tamma, G. Procino, M. Svelto, and G. Valenti Hypotonicity causes actin reorganization and recruitment of the actin-binding ERM protein moesin in membrane protrusions in collecting duct principal cells Am J Physiol Cell Physiol, April 1, 2007; 292(4): C1476 - C1484. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Mazzochi, D. J. Benos, and P. R. Smith Interaction of epithelial ion channels with the actin-based cytoskeleton Am J Physiol Renal Physiol, December 1, 2006; 291(6): F1113 - F1122. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |