Am J Physiol Cell Physiol Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 288: C1242-C1254, 2005. First published March 23, 2005; doi:10.1152/ajpcell.00521.2004
0363-6143/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/6/C1242    most recent
00521.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhu, L.
Right arrow Articles by Forte, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhu, L.
Right arrow Articles by Forte, J. G.

PROTEIN AND VESICLE TRAFFICKING, CYTOSKELETON

Ezrin oligomers are the membrane-bound dormant form in gastric parietal cells

Lixin Zhu,1 Yuechueng Liu,2 and John G. Forte1

1Department of Molecular and Cell Biology, University of California, Berkeley, California; and 2Department of Pathology, University of Oklahoma Health Science Center, Oklahoma City, Oklahoma

Submitted 26 October 2004 ; accepted in final form 25 January 2005


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Ezrin is a member of ezrin, radixin, moesin (ERM) protein family that links F-actin to membranes. The NH2- and COOH-terminal association domains of ERM proteins, known respectively as N-ERMAD and C-ERMAD, participate in interactions with membrane proteins and F-actin, and intramolecular and intermolecular interactions within and among ERM proteins. In gastric parietal cells, ezrin is heavily represented on the apical membrane and is associated with cell activation. Ezrin-ezrin interactions are presumably involved in functional regulation of ezrin and thus became a subject of our study. Fluorescence resonance energy transfer (FRET) was examined with cyan fluorescent protein (CFP)- and yellow fluorescent protein (YFP)-tagged ezrin incorporated into HeLa cells and primary cultures of parietal cells. Constructs included YFP at the NH2 terminus of ezrin (YFP-Ez), CFP at the COOH terminus of ezrin (Ez-CFP), and double-labeled ezrin (N-YFP-ezrin-CFP-C). FRET was probed using fluorescence microscopy and spectrofluorometry. Evidence of ezrin oligomer formation was found using FRET in cells coexpressing Ez-CFP and YFP-Ez and by performing coimmunoprecipitation of endogenous ezrin with fluorescent protein-tagged ezrin. Thus intermolecular NH2- and COOH-terminal association domain (N-C) binding in vivo is consistent with the findings of earlier in vitro studies. After the ezrin oligomers were separated from monomers, FRET was observed in both forms, indicating intramolecular and intermolecular N-C binding. When the distribution of native ezrin as oligomers vs. monomers was examined in resting and maximally stimulated parietal cells, a shift of ezrin oligomers to the monomeric form was correlated with stimulation, suggesting that ezrin oligomers are the membrane-bound dormant form in gastric parietal cells.

fluorescence resonance energy transfer; acid secretion; radixin; moesin; cytoskeleton; ERM family


AS A MEMBER OF THE EZRIN, RADIXIN, MOESIN (ERM) protein family, ezrin plays a role in mediating the binding of F-actin to the plasma membrane and thus is involved in many cellular functions, such as membrane trafficking, cell polarization, and motility. Ezrin also has been suggested as a participant in signal transduction through its tyrosine phosphorylation and association with Rho GTPases (reviewed in Refs. 8 and 22). All ERM proteins contain two ERM association domains (ERMADs): the N-ERMAD at the NH2 terminus is homologous to the membrane binding domain of the Band 4.1 protein family, and the C-ERMAD at the COOH terminus has an F-actin binding domain as previously demonstrated nicely in vivo and in vitro (2, 38). The binding of the N-ERMAD to membrane has proved a bit more complicated. Ezrin binds directly to some membrane proteins such as CD44, CD43, and several intercellular adhesion molecule isoforms (20, 33, 43). Ezrin also binds to membrane indirectly via adaptor molecules such as ezrin binding protein 50 (EBP50), also called Na+/H+ exchanger (NHE) regulatory factor (NHERF)-1 (30, 31), or NHE type 3 (NHE3) kinase A-regulatory protein (E3KARP), also called NHERF-2 (36, 44). Both adaptor proteins have two postsynaptic density protein-95/Drosophila disk large, Dlg-1/zonula occludens-1 (PDZ) domains that bind to membrane proteins such as NHE3 (44) and cystic fibrosis transmembrane conductance regulator (CFTR) (34), thus connecting ezrin to these transmembrane proteins. EBP50 and E3KARP also bind to other membrane proteins, such as platelet-derived growth factor receptor (29), parathyroid hormone 1 receptor (25), Cl channel 3 (19), and {beta}2-adrenergic receptor (9) and therefore could also mediate possible indirect interactions between these proteins and ezrin.

The N-ERMAD and C-ERMAD can also bind to each other. With the use of bacterially expressed glutathione-S-transferase (GST)-ezrin fusion proteins and various ezrin NH2- and COOH-terminal truncated GST-ezrin fusion constructs in blot overlay experiments, specific binding between N-ERMAD and C-ERMAD was demonstrated (16). With the use of the same technique, the full-length ezrin fusion protein was shown to have a masked C-ERMAD, and the reasonable assumption was drawn that ezrin monomer has an intramolecular NH2- and COOH-terminal association domain (N-C) binding conformation. The binding of N- and C-ERMAD to each other is supported by several other observations. First, stable ezrin dimer was obtained together with monomer from human placental extraction, and these two forms are not readily interconvertible in vitro, as observed in gel filtration analysis (7). Second, with the use of labeled ezrin as a probe, ezrin-ezrin interactions were shown in blot overlay experiments (4, 15). It is important to note that ezrin on the blot is denatured, because otherwise the native ezrin monomer usually takes a dormant form that could not bind another ezrin molecule. Nonetheless, the results indicate the ability of ezrin to form oligomers. However, direct evidence of ezrin N-C binding has not been shown in in vivo experiments.

Ezrin is a major cytoskeleton-membrane linker protein in the gastric parietal cell, being especially prominent at the apical plasma membrane in association with microvilli at the secretory surface. Ezrin and its phosphorylation have been shown to be functionally important for acid secretion by parietal cells and for the major membrane transformations that accompany secretory activity. An understanding of the role of ezrin in organizing cell surface structures is vital to appreciating parietal cell function. On the other hand, because of the dramatic morphological and functional transitions between the resting and stimulated states of parietal cells, this model system is a very useful one in which to study ezrin. In the present study, we used parietal and HeLa cells to study the oligomerization of ezrin because the switching between monomer and oligomer is thought to regulate the function of this protein and already has been shown to affect the morphology of LLC-PK1 epithelial cells (4, 18). To obtain direct in vivo information, we created several fusion constructs with cyan fluorescent protein (CFP) and/or yellow fluorescent protein (YFP) tags inserted at the NH2 terminus or the COOH terminus of ezrin. The intermolecular and intramolecular N-C binding of ezrin was visualized using fluorescence resonance energy transfer (FRET) between the CFP and YFP tags, as well as by performing immunoprecipitation among molecules. A shift of ezrin oligomer to monomer was observed to be coincident with the functional stimulation of acid secretion by gastric parietal cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Reagents. The monoclonal anti-ezrin (4A5) antibody used in this study was purchased from Covance (Berkeley, CA). Rabbit anti-green fluorescent protein (GFP; Immunology Consultants Laboratory, Newberg, OR), rhodamine-conjugated goat anti-rabbit (Jackson ImmunoResearch Laboratories, West Grove, PA), horseradish peroxidase (HRP)-conjugated goat anti-mouse (Kirkegaard & Perry Laboratories, Gaithersburg, MD), HRP-conjugated goat anti-rabbit (Kirkegaard & Perry), rabbit and mouse anti-FLAG (Sigma), and protein G-agarose (Sigma) were used according to the instructions provided by their respective manufacturers. Alexa 488-phalloidin was purchased from Molecular Probes (Eugene, OR). Vectors for enhanced cyan fluorescent protein (ECFP) and enhanced yellow fluorescent protein (EYFP) were obtained from BD Biosciences Clontech (Palo Alto, CA) and were used to provide the fluorescence tags for ezrin. For convenience, we use the simplified acronyms CFP and YFP, respectively, throughout the text to refer to these fluorescent tags.

Recombinant adenoviruses. Ezrin cDNA was excised from the plasmid enhanced GFP (pEGFP)-N1/ezrin (45) and inserted into pECFP-N1 using the restriction enzymes SalI and EcoRI. From the resulting pECFP-N1/ezrin, the whole open reading frame, together with the upstream promoter and downstream transcriptional termination sequences, was then amplified by performing PCRs with the following primers: sense primer, TAAAGGCCTTACCGCCATGCATTAG, and antisense primer, TTTAGGCCTACCACAACTAGAATGC. The PCR products were digested with StuI and inserted into similarly digested shuttle vector pDC311 (Microbix Biosystems, Toronto, ON, Canada), resulting in pDC311/Ez-C. For pDC311/Y-Ez-C, the YFP sequence was amplified from pEYFP-C1 (BD Biosciences Clontech) using the following primers: sense primer, GCCGAATTCTAGTTATTAATAGTAATC; antisense primer, CTGAGCTCGAGCTTGTACAGCTCGTCC. The PCR product was then digested with XhoI and EcoRI and inserted into similarly digested pDC311/Ez-C, generating pDC311/Y-Ez-C. To obtain pDC311/Y-Ez, the ezrin sequence was amplified with the following primers: sense primer, AGGTGTGGCATGCGGAACACCGTGGGATGC; antisense primer containing a stop codon, GGCCCGCGGTGCGGCCGCTTACAGGGCCTCGAACTCG. The resulting PCR products (ezrin sequence) were used to replace the ezrin and CFP sequence in pDC311/Y-Ez-C with the enzymes SphI and NotI, resulting in pDC311/Y-Ez. All PCRs were performed with Vent polymerase (New England BioLabs, Boston, MA) and verified by sequencing.

Recombinant adenovirus (rAD) rAD/Ez-C was generated by cotransfection of human embryonic kidney (HEK)-293 cells with pDC311/Ez-C and pBHGlox{Delta}E1,3Cre (Microbix Biosystems) containing modified adenovirus type 5 genome using the CellPhect transfection kit (Amersham Biosciences, Little Chalfont, UK). A single viral colony was isolated, amplified, and titrated. Aliquots of virus were stored at –80°C. Viruses rAD/Y-Ez-C and rAD/Y-Ez were similarly generated. A schematic of the recombinant adenoviral constructs is shown in Fig. 1A.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 1. Expression of ezrin tagged with fluorescent proteins. A: schematic showing recombinant adenoviruses (rADs) rAD/cyan fluorescent protein (CFP) at the COOH terminus of ezrin (Ez-CFP; rAD/Ez-CFP), rAD/yellow fluorescent protein (YFP) at the NH2 terminus of ezrin (YFP-Ez; rAD/Y-Ez), and rAD/double-tagged ezrin with YFP at the NH2 terminus and CFP at the COOH terminus (rAD/Y-Ez-C). Foreign DNA fragments containing fluorescence protein-tagged, full-length ezrin open reading frame, together with human cytomegalovirus promoter, were inserted at the E1 deletion site of the adenoviral genome. B: Western blot analysis of HeLa cell lysates infected with rADs and probed with anti-ezrin. C: Western blot analysis of rAD-infected HeLa cell lysates and probed with anti-green fluorescent protein (anti-GFP). HeLa cells infected with rAD/Ez-CFP (lane 2), rAD/YFP-Ez (lane 3), or rAD/Y-Ez-C (lane 4) were analyzed together with mock-infected HeLa cells (lane 1).

 
Expression of fluorescence protein-tagged ezrin was confirmed by performing Western blot analysis of rAD-infected HeLa cells. The full-length product was the only detected band for every construct probed with anti-GFP (Fig. 1C), which recognizes CFP and YFP as well as GFP. The expressed fluorescent protein-tagged ezrin fusion proteins also were detected with anti-ezrin (Fig. 1B).

Cell culture and gastric gland and parietal cell isolation. HeLa cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum in a humid 37°C incubator with 5% CO2. Gastric glands and parietal cells were isolated from rabbit stomach as previously described (23). Isolated parietal cells were plated onto Matrigel (BD Biosciences)-coated coverslips in 12-well plates and incubated at 37°C in culture medium composed of DMEM/Ham's F-12 medium (GIBCO-BRL, Grand Island, NY) supplemented with 20 mM HEPES; 0.2% BSA; 10 mM glucose; 8 nM epidermal growth factor; 1x sodium selenite, insulin, transferrin, ethanolamine (SITE) medium (Sigma S4920); 1 mM glutamine; 100 U/ml penicillin/streptomycin; and 400 µg/ml gentamicin sulfate. Cells or glands were infected with recombinant adenovirus at the multiplicity of infection of 10 infectious units (IU)/cell for 48 h.

The [14C]aminopyrine (AP) uptake assay was used as previously described (42) to evaluate functional secretory activity of isolated gastric glands. Glands were either stimulated via the cAMP pathway with 100 µM histamine supplemented with 50 µM IBMX for maximal H+ secretory activity or maintained at the resting state using a histamine receptor antagonist (100 µM cimetidine).

Fluorescent staining and confocal microscopy. To double-stain F-actin and fluorescent protein-tagged ezrin, parietal cells were grown on Matrigel-coated coverslips and infected with rADs. After 36–48 h, the cells were fixed with 3.7% formaldehyde, permeabilized with 0.1% Triton X-100, and then incubated with rabbit anti-GFP, followed by incubation with rhodamine-conjugated goat anti-rabbit IgG and Alexa 488-phalloidin. Images were obtained using a Zeiss 510 META confocal microscope. Alexa 488 fluorescence was collected at 494–548 nm with a 488-nm laser. Rhodamine fluorescence was collected at 590–687 nm with a 543-nm laser.

FRET measurement using spectrofluorometry. To measure the FRET of cell-free samples, the cells or glands expressing fluorescent proteins were lysed in lysis buffer containing 1% Triton X-100, 150 mM NaCl, 2 mM EDTA, 50 mM Tris, pH 7.0, and 2 mM 4-(2-aminoethyl)benzenesulfonyl fluoride. The lysate was cleared by performing centrifugation at 16,000 g for 10 min at 4°C. The fluorescence emission was measured on a Spex spectrofluorometer. For CFP, excitation was set at 425 nm and emission was scanned from 450 to 550 nm. For YFP, excitation was set at 485 nm and emission was scanned from 500 to 550 nm. The emission scan spectra were corrected for background using lysates from noninfected cells or glands.

Calpain I treatment. For experiments involving calpain I, infected cells or glands were sonicated in cold calpain I buffer containing 1 mM CaCl2 and 1 mM dithiothreitol in Tris-buffered saline. The lysate was cleared by performing ultracentrifugation at 100,000 g for 20 min at 4°C before calpain I was added (3 U/ml; Sigma) and incubated at room temperature for 1 h. The reaction was then stopped by adding EDTA to a final concentration of 5 mM. Samples were stored frozen or immediately assessed using spectrofluorometry and Western blot analysis.

FRET measurement using confocal microscopy. Infected HeLa or parietal cells grown on coverslips were mounted on glass slides without fixation. Cells were immediately examined under a Zeiss 510 META confocal microscope. CFP images were collected using a 462- to 483-nm emission filter and an excitation laser of 458 nm; YFP images were collected using a 526- to 537-nm emission filter and an excitation laser of 514 nm; and FRET images were collected using a 526- to 537-nm emission filter and an excitation laser of 458 nm. Laser strength, pinhole, detector gain, and amplifier gain were fixed for all samples. Because the expressed fluorescence protein is located all over the cell, quantitation of FRET was performed with whole individual cells. Measurement of FRET signals, correction of bleed-through, and normalization of the FRET data were all performed as previously described (40). The norms for the percentage of CFP or YFP bleed-through under the microscope settings specified above were determined to be 0.38 (a, CFP) and 0.15 (b, YFP) using cells expressing pure CFP and pure YFP, respectively. No bleed-through signal from CFP under the YFP filter setting was observed, and vice versa. Net FRET (nF) was calculated as nF = (IFRET) – (ICFP x a) – (IYFP x b), where ICFP, IYFP, and IFRET are the respective intensities of CFP, YFP, and FRET signals in each cell, and a and b are the corrections for CFP and YFP bleed-through, respectively. The net FRET signal was normalized on the basis of relative CFP and YFP intensities according to the method described previously by Xia and Liu (40). Thus normalized FRET (NFRET) was calculated as NFRET = nF (IYFP x ICFP)–1/2.

Immunoprecipitation, Western blot analysis, and mass spectrometry. Gastric glands or HeLa cells infected or not infected with rADs were lysed with lysis buffer, adjusted to 1 mg/ml of total protein concentration using the Bradford assay for protein quantitation, followed by preclearing with protein G-agarose. The precleared lysates were then added to rabbit anti-GFP or mouse anti-ezrin, immobilized on protein G-agarose, and rotated end over end at 4°C for 2 h. After the captured protein was washed with lysis buffer, we released it by boiling the agarose beads with SDS-PAGE loading buffer for 5 min. Immunoprecipitation samples were then separated on 12.5% SDS-PAGE gel for Western blot analysis or mass spectrometry. For Western blot analysis, proteins were transferred onto nitrocellulose membrane and separately probed with polyclonal anti-GFP and monoclonal anti-ezrin. The results were visualized using the Western Lightning chemiluminescence substrate (PerkinElmer Life Sciences, Boston, MA). For mass spectrometry, gels were stained with Coomassie blue. In-gel digestion of the proteins with trypsin was performed as previously described (46). The peptides were analyzed using liquid chromatography-tandem mass spectrometry on a QSTAR pulsar tandem mass spectrometer (Applied Biosystems, Foster City, CA) at the mass spectrometry facility at the University of California, San Francisco. Results were analyzed with Mascot software (available at: http://www.matrixscience.com/; Matrix Science, Boston, MA) and confirmed manually.

Gel filtration chromatography. Superose 6 prep grade (Amersham Biosciences, Sweden) was used to pack a column with a total volume of 22 ml. The void volume was 8.5 ml as determined using blue dextran 2000. The column was also characterized with protein standards consisting of thyroglobulin (669 kDa) and BSA (67 kDa). Resting or stimulated gastric glands were homogenized in PBS. The postnuclear supernatant obtained after centrifugation at 600 g for 5 min at 4°C was subjected to 100,000 g ultracentrifugation at 4°C for 20 min. The supernatant from each sample (200 µl) was loaded into the gel filtration column and run at a flow rate of 0.3 ml/min. Fractions of 0.17 or 0.34 ml were collected as specified in the figure legends. Fractions were subjected to Western blot analysis (anti-ezrin) or to fluorescence measurement using spectrofluorometry.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Localization of NH2 and COOH terminus-tagged ezrin. Consistent with previous observations made at several laboratories (3, 21), the expression of Ez-CFP is markedly different from that of YFP-Ez. For HeLa cells expressing Ez-CFP, the fluorescent signal is prominently displayed at the plasma membrane, with much less fluorescence from intracellular structures (Fig. 2A). On the other hand, for HeLa cells expressing YFP-Ez, the fluorescence was distributed pretty much throughout the cytosol (Fig. 2B). Interestingly, when YFP-Ez and Ez-CFP were coexpressed in the same cell, Ez-CFP tended to redistribute to a predominantly cytosolic location (Fig. 2C). This same general pattern of tagged ezrin expression was exhibited by cultured parietal cells, but the polarization of plasma membranes had a different appearance. The parietal cell is a polarized epithelial cell that, in situ, has a greatly expanded apical membrane surface in the form of invaginated canaliculi (12, 14). When placed in primary culture, the apical membrane is sequestered in the cell in the form of numerous vacuoles (apical membrane vacuoles), and the basolateral membrane surrounds the cell. Cultured parietal cells are still capable of responding to physiological stimuli with striking morphological and functional secretory responses (1, 32, 45). Expression of Ez-CFP in cultured parietal cells is very much like that of endogenous ezrin, with Ez-CFP highly localized to the apical membrane vacuoles, somewhat less to the basolateral membrane, and virtually nonexistent in the cytosol (Fig. 2D). On the other hand, YFP-Ez appears to be spread more generally throughout the cell body (Fig. 2E). Although there is some remnant localization of YFP-Ez on membranes, it is different from that observed in HeLa cells (Fig. 2E). Similar to observations in HeLa cells, when Ez-CFP and YFP-Ez are coexpressed in parietal cells, Ez-CFP clearly comes off membranes and tends to be colocalized more generally with YFP-Ez (Fig. 2F). One reasonable explanation is that YFP-Ez, which binds poorly to membranes, pulls Ez-CFP off the membrane through N-C binding. As a further test of the mistargeting of NH2 terminus-tagged YFP-ezrin, parietal cells expressing YFP-Ez were evaluated with respect to F-actin staining. In this case, parietal cells infected with rAd-YFP-ezrin were fixed and then stained for F-actin (using Alexa 488-labeled phalloidin) and fluorescent protein (using an antibody against GFP that also recognizes YFP). The results in Fig. 2G show typical F-actin localization at the apical membrane vacuoles and the basolateral membrane of parietal cells, whereas YFP-Ez staining is found throughout the cells, with relatively minor staining at the membrane surfaces. Thus the membrane binding site of ezrin is clearly compromised by NH2-terminal fluorescent protein tagging, but because the membrane binding domain of ezrin was suggested to be independent from those domains involved in N-C binding (16), it seemed reasonable that ezrin with an NH2-terminal tag may be useful for an N-C binding study.



View larger version (78K):
[in this window]
[in a new window]
 
Fig. 2. Intracellular localization of fluorescent protein-tagged ezrin. AF: cells infected with rADs were rinsed and mounted on slides for confocal microscopic imaging. CFP and YFP fluorescence images were obtained as described in MATERIALS AND METHODS, together with phase-contrast images. A: HeLa cells expressing Ez-CFP. B: HeLa cells expressing YFP-Ez. C: HeLa cells expressing YFP-Ez and Ez-CFP. D: parietal cells expressing Ez-CFP. E: parietal cells expressing YFP-Ez. F: parietal cells expressing YFP-Ez and Ez-CFP. G: cells expressing YFP-Ez were fixed, permeabilized, and double-stained for F-actin and YFP-Ez using an anti-GFP antibody as described in MATERIALS AND METHODS. Bar, 10 µm.

 
Ezrin N-C binding visualized using FRET in a cell-free system. Although clear results from in vitro experiments have suggested the intramolecular and intermolecular self-association of ezrin via N-C binding (16), in vivo evidence was not easy to obtain, so we thought that FRET might provide one such approach. FRET occurs when two different chromophores (donor and acceptor) with overlapping absorption and/or emission spectra are closely and suitably oriented over a distance of ~10–80 Å (37, 41). CFP and YFP have frequently been used as a respective donor and acceptor pair to monitor FRET and evaluate molecular associations both within (intra-) and between (inter-) biological molecules. To visualize the N-C binding of ezrin, FRET analysis was first performed in HeLa cells expressing ezrin with various fluorescent protein tags, including YFP-Ez, Ez-CFP, and double-tagged ezrin with YFP at the NH2 terminus and CFP at the COOH terminus (Y-Ez-C) according to the schema shown in Fig. 1. Fluorescence emission spectra from lysates of HeLa cells expressing fluorescent proteins are displayed in Fig. 3. By using the CFP excitation peak of 425 nm, lysed HeLa cells transfected with pECFP-N1 (to express CFP alone) showed a typical CFP emission spectrum comprising a major emission peak at 477 nm with a minor peak at ~503 nm (Fig. 3A); no significant emission was observed with the YFP excitation peak of 485 nm (Fig. 3B). Lysed cells transfected with pEYFP-C1 (to express YFP alone) showed a typical YFP emission spectrum that peaked at 526 nm when excited at 485 nm (Fig. 3D) but negligible emission signal when excited at 425 nm (Fig. 3C). A negative control for FRET was developed by cotransfecting HeLa cells with equal amounts of pECFP-N1 and pEYFP-C1 (to coexpress CFP and YFP). This sample had combined features of a CFP sample and a YFP sample. At excitation of 425 nm, a CFP emission spectrum was observed with a 477-nm major peak and a 503-nm minor peak (Fig. 3E), and a typical YFP emission spectrum also was observed at 485-nm excitation (Fig. 3F). No significant FRET was detected, because the 425-nm excitation has a shape similar to that of the pure CFP sample. If FRET were present, we should have observed a FRET peak (or increased emission) at 526 nm with 425-nm excitation as demonstrated with the positive control sample (Fig. 3I), which is a construct of CFP and YFP linked by 37 amino acids. Figure 3J shows the emission spectrum of the positive control sample at excitation of 485 nm. Importantly, the emission spectrum of cells expressing Y-Ez-C at excitation 425 nm exhibited some FRET signal; compared with cells expressing CFP and YFP, there was a significant elevation of emission at 526 nm (Fig. 3G). As expected, a normal YFP emission spectrum was also observed with the Y-Ez-C sample (Fig. 3H). However, we wondered whether any protein with CFP and YFP at the NH2 and COOH termini would show some FRET signal. To address this question, a construct with CFP and YFP linked by a much smaller protein molecule was used as an additional control. One of the soluble N-ethylmaleimide-sensitive factor attachment protein receptor proteins, vesicle-associated membrane protein VAMP2, is a small protein of 116 amino acids compared with 586 amino acids for ezrin. As shown in Fig. 3K, the residual FRET signal from the Y-VAMP2-C sample was negligible compared with the Y-Ez-C sample.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3. Spectrofluorometric measurement of Y-Ez-C fluorescence resonance energy transfer (FRET). HeLa cells expressing CFP (A and B), YFP (C and D), CFP together with YFP (E and F), Y-Ez-C (G and H), CY37 (I and J), and a construct with CFP and YFP linked by a much smaller protein molecule (vesicle-associated membrane protein VAMP2) used as an additional control, Y-VAMP2-C (K and L), were lysed, cleared by performing centrifugation, and analyzed using a Spex spectrofluorometer. For each sample, the emission scan from 450 to 550 nm was performed at excitation of 425 nm; the emission scan from 500 to 550 nm was performed at excitation of 485 nm. For all samples, similar amounts of cells were used to prepare the lysate, and the final spectrum was corrected by subtracting the emission recorded from a blank HeLa cell sample. Data shown are representative of three independent experiments.

 
One way to confirm FRET is to break the interaction of the energy donor and acceptor so that the energy transfer no longer exists, resulting in a diminished FRET peak and an elevated CFP peak because activated CFP retains more energy for its own emission. Thus calpain I was recruited to digest the Y-Ez-C sample because, as we observed earlier, ezrin is a substrate of calpain I (42). After calpain I treatment, endogenous ezrin was no longer detectable, demonstrating efficient destruction of full-length ezrin by calpain (Fig. 4A). It seems that most of the small breakdown products of ezrin are not recognized by the ezrin antibody. Most of the Y-Ez-C molecules were also fragmented. Obviously, on the basis of the spectral data shown in Fig. 4, B and C, the CFP and YFP sequences were not affected by calpain treatment, because the fluorescence signals are comparable to the mock treatment sample. Although not recognized by anti-ezrin, multiple breakdown products of Y-Ez-C were revealed using anti-GFP, indicating multiple cutting sites on ezrin by calpain I. The FRET emission peak (526 nm) at excitation 425 nm completely disappeared after calpain I treatment, while a modest elevation of CFP peak (477 nm) was observed (Fig. 4B). Similar FRET data were also observed with rabbit gastric glands expressing Y-Ez-C (data not shown). Together these results demonstrate that FRET occurs in Y-Ez-C expressed from mammalian cells. We next sought to discover whether FRET or ezrin N-C binding could be observed in a live cell system.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 4. The effects of calpain I on Y-Ez-C FRET. The Y-Ez-C extracted from rAD/Y-Ez-C-infected HeLa cells was incubated with calpain I for 1 h. The digested sample and the mock-digested sample from Y-Ez-C-expressing cells and control uninfected HeLa cells were then assayed using Western blot analysis and spectrofluorometry. A: Western blot analysis performed to monitor the breakdown of ezrin by calpain I. Uninfected HeLa cells (lane 1), mock-digested HeLa-expressing Y-Ez-C (lane 2), and calpain I-treated HeLa-expressing Y-Ez-C (lane 3) samples were separated using 12.5% SDS-PAGE, transferred to nitrocellulose membrane, and separately probed with both anti-ezrin and anti-GFP. Note that the degraded product from Y-Ez-C, putative YFP-N-ezrin, has the same molecular mass as full-length ezrin (80 kDa). B: emission scans of Y-Ez-C before and after treatment with calpain I at excitation of 425 nm. Final spectra were corrected by subtracting the emission data from blank HeLa cells. C: emission scans of samples similar to those shown in B, but with excitation of 485 nm. As in B, the final spectra of were corrected with the emission of blank HeLa cells.

 
Ezrin N-C binding revealed by FRET in live cell imaging. With the confocal microscope, fluorescence signals from the CFP channel (CFP excitation and emission), the YFP channel (YFP excitation and emission) and the FRET channel (CFP excitation and YFP emission) were measured as specified in MATERIALS AND METHODS. We first transfected HeLa cells with only the CFP plasmid or the YFP plasmid to determine the bleed-through, or crossover, of CFP and YFP, respectively, into the FRET channel. Both of these fluorescent proteins were distributed broadly and randomly throughout the cells, consistent with a soluble cytoplasmic protein distribution. The norms of the bleed-through under the specific settings described in MATERIALS AND METHODS were used to quantitate the FRET signal for all the imaging experiments. When HeLa cells were cotransfected with plasmids for both CFP and YFP, there was some signal in the FRET channel, but this was very small, and after correction for the bleed-through of CFP and YFP, the net FRET signal fluctuated around zero (Fig. 5A). The calculated mean normalized FRET (NFRET) for nine cells was 0.002 ± 0.01 (mean ± SE).



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 5. Fluorescence images showing FRET from cells expressing Y-Ez-C. Images were collected from YFP, CFP, and FRET channels. Normalized FRET (NFRET) data were calculated as described in MATERIALS AND METHODS. In cells showing FRET, the YFP was photobleached with a 514-nm laser, and the channels were recorded again. NFRET and intensity of CFP signal (ICFP) are shown at bottom. A: HeLa cells cotransfected with enhanced CFP (ECFP) and enhanced YFP (EYFP) plasmids. There is no observable NFRET. B: HeLa cells infected with rAD/Y-Ez-C. Reasonable levels of NFRET were observed (0.44 ± 0.03 for 6 cells), and ICFP was increased after photobleaching YFP. C: rabbit parietal cells infected with rAD/Y-Ez-C. NFRET = 0.26 ± 0.04 for eight cells. ICFP increased after YFP was bleached. Bar, 10 µm.

 
For HeLa cells (Fig. 5B) or parietal cells (Fig. 5C) expressing Y-Ez-C, the fluorescence signals were located throughout the cell, and they were not highly localized to plasma membranes as is the case for endogenous ezrin or for ezrin tagged with fluorescent protein exclusively at the COOH terminus. This finding is thus consistent with earlier observations that NH2 terminus-tagged ezrin is not directed to sites at the plasma membrane surfaces (3, 21). However, FRET was clearly observed in both cell types expressing the double-tagged ezrin. In the case of HeLa cells expressing Y-Ez-C, a bright FRET channel was often observed (Fig. 5B). The mean normalized FRET (NFRET) for six cells was 0.44 ± 0.03 (P ≤ 0.05), consistent with the spectral data and suggesting close localization of a population of the two fluorescent proteins. A second method to evaluate FRET is to look for an enhancement of the donor signal when the acceptor fluorophore is eliminated by bleaching. Accordingly, the FRET-positive cells were bleached with a 514-nm laser and the signal from the YFP channel was significantly decreased, which was accompanied by an elevated CFP signal (Fig. 5B). Similar results were observed with rabbit gastric parietal cells expressing Y-Ez-C (Fig. 5C). The mean NFRET for eight parietal cells was 0.26 ± 0.04 (P ≤ 0.05); and the signal from the CFP channel was significantly increased after the YFP fluorescence was bleached.

Intermolecular N-C binding of ezrin. We also wished to know whether the observed N-C binding revealed by FRET analysis with the Y-Ez-C construct is from intra- or inter-molecular ezrin interactions. Thus HeLa cells expressing both the Ez-CFP and YFP-Ez ezrin species were studied using confocal microscopy. Normalized FRET data showed that specific FRET occurred in HeLa cells expressing both Ez-CFP and YFP-Ez (Fig. 6A), although the measured FRET was lower than that obtained for the double-labeled Y-Ez-C protein. The mean NFRET measured for eight cells was 0.18 ± 0.02 (mean ± SE), significantly less than that measured for HeLa cells expressing Y-Ez-C (P < 0.05) and significantly greater than control cells double transfected with CFP and YFP. When the cells were bleached with the 514-nm laser, the YFP signal decreased, accompanied by a small but consistent elevation of the CFP signal (Fig. 6A). However, when the same experiment was performed with rabbit gastric parietal cells, no FRET was detected. NFRET was close to zero, and no elevation of CFP was observed after it was bleached with a 514-nm laser (data not shown). The reason for this lack of FRET could be the sensitivity of the technique or competition from nonfluorescent endogenous ezrin because the gastric parietal cell has a very high level of ezrin expression. Thus another approach to this problem was used.



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 6. Intermolecular NH2- and COOH-terminal association domain (N-C) binding of ezrin. A: fluorescence images showing FRET of Ez-CFP and YFP-Ez expressed in HeLa cells. Images also were obtained after bleaching with a 514-nm laser. NFRET and ICFP are shown at bottom. Bar, 10 µm. B: immunoprecipitation of fluorescent protein-tagged ezrin with anti-GFP antibody. Lysates from rabbit gastric glands infected with rAD/Ez-CFP, Y-Ez-C, and YFP-Ez were separately immunoprecipitated with anti-GFP (lanes 38). Anti-FLAG antibody (lanes 1 and 2) was used as an immunoprecipitation control. The loading proteins (lanes 1, 3, 5, and 7) and precipitated proteins eluted from agarose beads (lanes 2, 4, 6, and 8) were assessed using Western blot analysis with anti-GFP (top) and anti-ezrin (bottom). Endogenous ezrin was found to be coprecipitated with all of the fluorescent protein-tagged ezrin, but with somewhat different efficiencies. Separate experiments showed that anti-GFP does not precipitate endogenous ezrin from uninfected gastric glands.

 
Gastric glands were infected with adenoviruses constructed to carry the cDNA of fluorescent protein-tagged ezrin, including rAD/Ez-CFP, rAD/YFP-Ez, or the double-tagged construct rAD/YFP-Ez-C. Cell lysates were then prepared and immunoprecipitated with anti-GFP antibody. A negative control immunoprecipitation was performed using an anti-FLAG antibody. As shown in Fig. 6B, fluorescent protein-tagged ezrin was readily precipitated using anti-GFP. Importantly, sizable amounts of endogenous ezrin also were detected in the precipitates from the Ez-CFP-expressing cells, indicating the binding of endogenous ezrin with Ez-C and supporting intermolecular ezrin-ezrin binding. The immunoprecipitation efficiency was lower with the YFP-Ez-expressing cells, and considerably lower in the case of the Y-Ez-C expressing cells, but some degree of binding was apparent between endogenous ezrin and fluorescent protein-tagged ezrin in all of the samples. Thus the binding efficiency is lower when the NH2 terminus of ezrin is tagged, but the data do generally support the oligomeric association of ezrin molecules. No endogenous ezrin could be pulled down from uninfected glands using anti-GFP (data not shown).

Intramolecular ezrin N-C binding. Because intermolecular N-C binding was clearly shown by the FRET and coimmunoprecipitation results, uncertainty emerged regarding whether there is indeed intramolecular N-C self-association of ezrin. The Y-Ez-C construct was used to clarify this question. Y-Ez-C expressed in HeLa cells was extracted and applied to a gel filtration chromatography column. Fluorescent protein-tagged ezrins with different apparent molecular masses were separated (Fig. 7A) and analyzed using spectrofluorometry. Not surprisingly, the fractions eluted earlier corresponding to higher molecular mass ezrin compounds, represented by fraction 17, showed a FRET emission peak at 526 nm in addition to the CFP peak when excited with a 425-nm source (Fig. 7B). In the later eluting fractions corresponding to ezrin monomer, represented by fraction 22, a similar FRET peak was observed (Fig. 7C). The specificity of the FRET signal was shown by adding SDS to the samples, which separated the ezrin N-C binding while leaving the fluorescent proteins intact. Addition of 2% SDS resulted in diminished FRET peaks and slightly increased CFP signals (Fig. 7, B and C). When the proteins were completely denatured by boiling the sample for 5 min, most of the fluorescence disappeared (Fig. 7, B and C). Because ezrin monomer is expected to be the dominant form in the more slowly eluting fractions, the FRET signal of ezrin monomer is not likely to represent contamination by ezrin oligomer. Thus we have demonstrated intramolecular ezrin N-C binding in a native system.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 7. FRET of Y-Ez-C fractions separated using gel filtration chromatography. Y-Ez-C expressed in HeLa cells were separated by molecular mass with a Superose gel filtration column. Sequential fractions of 0.34 ml were collected. Fractions were assayed using spectrofluorometry. Emission scanning from 450 to 550 nm was performed with a 425-nm source; emission scanning from 500 to 550 nm was performed with a 485-nm source. A: 477-nm emission (excitation, 425 nm) is shown for each fraction. A major peak was observed at fraction 22 (monomer) with a definitive shoulder observed at fraction 17 (oligomer). Calibration of the column revealed that thyroglobulin (669 kDa) peaked at fraction 14, while BSA (67 kDa) peaked at fraction 22. B: emission scans of fraction 17 at two excitation wavelengths (425 and 485 nm). Scans shown were obtained before and after addition of SDS to a final concentration of 2% and incubation for 5 min at room temperature (RT) and finally after 5-min boiling of the fraction (with 2% SDS). C: emission scans similar to those shown in B obtained for fraction 22.

 
Shift of ezrin oligomer to monomer in gastric glands upon stimulation. To probe for a functional difference of ezrin in gastric glands, we studied the distribution of different forms of endogenous ezrin under resting and maximally stimulated conditions. Resting and stimulated glands, as indicated by the measured AP uptake ratios (Fig. 8A), were separately lysed and applied to the gel filtration column. Fractions were analyzed using Western blot analysis with ezrin antibody as the probe. In the resting sample, although there was no clear separation, two ezrin peaks were observed (Fig. 8B). One peak at fraction 29 was close to the peak of thyroglobulin; the other peak was very broad and centered at fraction 41, which is also the peak of BSA. In the stimulated sample, however, the first peak was significantly diminished (Fig. 8B). This experiment was repeated a total of three times with separately produced gland preparations, each being performed with an AP uptake measurement and parallel extraction procedure. All experiments produced the same qualitative result: a shift from high to low molecular mass associated with stimulation. The probed ezrin bands associated with the high molecular mass peak were compared with the ezrin bands associated with the low molecular mass peak, and the ratio of densities was obtained for each of three separate experiments using the resting and stimulated gastric gland model. For resting preparations, the mean ratio [high molecular mass/total = high molecular mass/(high molecular mass + low molecular mass)] was 0.27 ± 0.06, and for the stimulated preparations, it was 0.14 ± 0.04 (P = 0.02). The first peak (high molecular mass) was generally recognized as ezrin oligomer in earlier studies (7, 18). However, it is possible that the high molecular mass peak could represent ezrin complexation with other binding partners. To evaluate the latter possibility, we purified endogenous ezrin from resting gastric glands by immunoprecipitation using conditions similar to those used for gel filtration. The immunoprecipitate was resolved by performing SDS-PAGE, which showed a very clean Coomassie blue-stained ezrin band, together with IgG heavy and light chains (Fig. 9). Because there were no bands other than IgG at the intensity of the ezrin band, these data indicate that the high molecular mass peak of ezrin is primarily a self-complexation of ezrin oligomers, consistent with earlier studies (7, 18), and that there is a shift of ezrin oligomer to monomer under conditions of physiological stimulation. The result is also consistent with ezrin oligomer as a dormant form of ezrin.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 8. Decreased ezrin oligomers in gastric glands after stimulation. Gastric glands isolated from rabbit were divided into halves. Cimetidine (resting) or histamine together with IBMX (stimulated) were added to each half, and incubated for 30 min at 37°C. A: aliquot of each sample (resting and stimulated) was used to perform aminopyrine (AP) uptake assay. Stimulated acid secretion was measured on the basis of the retention of 14C-labeled AP in the glands. This figure shows the ratio of intracellular-to-extracellular AP. B: lysates from resting and stimulated samples were applied to a Superose column, and successive fractions of 0.17 ml were collected. Separated fractions were assessed using Western blot analysis with anti-ezrin as the probe. Two ezrin peaks were observed in the resting sample; however, the peak with higher molecular mass was diminished in the stimulated sample. Thyroglobulin (669 kDa) peaked at fraction 25, while BSA (67 kDa) peaked at fraction 41 in a previous run.

 


View larger version (47K):
[in this window]
[in a new window]
 
Fig. 9. Purification of ezrin by immunoprecipitation with anti-ezrin. Ezrin from gastric glands pretreated with cimetidine (monitored by parallel AP uptake analysis) was immunoprecipitated with protein G-agarose coupled to anti-ezrin. We eluted the immunoprecipitate by boiling it in SDS-PAGE loading buffer and separating it on a 12.5% SDS-PAGE gel. A control lane (lane 1) was run using mouse monoclonal antibody against FLAG. Ezrin, together with IgG heavy chain (IgG h.c.) and light chain (IgG l.c.) from the immunoprecipitating anti-ezrin, was revealed using Coomassie blue staining (lane 2). The identities of these three bands were confirmed using mass spectrometry. The results indicate that ezrin-binding proteins were not present in a significant amount.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Ezrin N-C binding. FRET was observed with the Y-Ez-C construct, although ezrin with an NH2-terminal tag drastically altered the localization of the ezrin fusion proteins. The FRET results, obtained either in a cell-free system (Figs. 3 and 4) or in live cells (Fig. 5), provide in vivo evidence of N-C binding among ezrin molecules, with ECFP at the COOH terminus of ezrin representing the energy donor and EYFP at the NH2 terminus representing the energy acceptor. This result, however, cannot distinguish whether the N-C binding was intra- or intermolecular. In further pursuing this question, FRET was observed with cells coexpressing Ez-C and Y-Ez (Fig. 6A). This observed intermolecular N-C binding was further confirmed by coimmunoprecipitation experiments in which endogenous ezrin was found to coprecipitate with fluorescent protein-tagged ezrin molecules (Fig. 6B). The results provide direct evidence that ezrin oligomers were formed via N-C head-to-tail binding. After we separated the oligomeric and monomeric forms of Y-Ez-C by performing gel filtration, the persistence of FRET in the monomeric Y-Ez-C peak showed evidence of intramolecular N-C binding (Fig. 7).

Oligomer is a dormant form of ezrin. In vitro data suggest that dormant ezrin monomer takes an N-C binding conformation, masking some functional domains on N-ERMAD and C-ERMAD (16, 26, 27). In the present study, the FRET data suggest that dormant ezrin monomer and ezrin oligomers share a structural similarity of N-C binding, indicating a functional similarity between ezrin oligomers and dormant ezrin monomer (i.e., ezrin oligomer is a dormant form of ezrin). The hypothesis that ezrin oligomers are a dormant form of ezrin was supported by an earlier study of ezrin dimers obtained from placental extraction in which ezrin dimers were found to have a masked C-ERMAD domain (7). Consistent with this notion is that the transition from ezrin oligomers to monomers correlated with the formation of lamellipodia, membrane ruffles, and tufts of microvilli on LLC-PK1 epithelial cell membranes (18). An extension of this result is shown in gastric parietal cells in the present study: upon stimulation monitored by AP uptake analysis, ezrin shifted from oligomeric to monomeric form (Fig. 8). These results suggest that ezrin oligomers are dormant forms of this cellular organizer. However, when human epidermoid carcinoma A431 cells were treated with EGF, the shift from ezrin monomer to oligomer (mostly dimers) correlated with ezrin tyrosine phosphorylation in a previous study (5). On the basis of this observation, the authors of that study proposed a model in which ezrin oligomers would represent an active form of ezrin. This assumption is in conflict with their earlier observation that the ezrin dimer has a masked C-ERMAD. Also, in their EGF experiment with A431 cells, the cross-linked ezrin dimer had a molecular mass considerably greater than the observed cross-linked 160-kDa ezrin dimer from placental cells described in the same study.

These discrepancies in the observations regarding ezrin oligomers in different cells may reflect the different mechanisms of ezrin activation. In serum-starved Swiss 3T3 cells, stimulation with lysophosphatidic acid (LPA) leads to phosphorylation of radixin on threonine T564. (The corresponding conserved threonine is T567 in ezrin and T558 in moesin.) In vitro analysis demonstrated that phosphorylation of radixin T564 significantly suppressed the binding between N-ERMAD and C-ERMAD (28). Similarly, in vitro binding experiments demonstrated that phosphorylation of T567 on ezrin or T558 on moesin by protein kinase C (PKC)-{theta} activates the F-actin and EBP50 binding activities of both proteins (35). On the basis of experiments comparing ezrin T567 mutants with wild-type ezrin in LLC-PK1 epithelial cells, phosphorylation of the conserved threonine residue (T567) was suggested to disrupt the ezrin N-C binding and thus break ezrin oligomers into monomers (18). Ezrin T567 phosphorylation was also suggested to play roles in the early development of the mouse embryo (11). In contrast, in A431 cells in which the ezrin oligomer was thought to be an active form of ezrin, tyrosine and serine phosphorylation were observed and correlated with the remodeling of the cell surface upon EGF stimulation (6). The tyrosine phosphorylation sites were mapped as Y145 and Y353 (24). Research with NIH-3T3 fibroblasts also implicated the tyrosine phosphorylation of ezrin (13). Complicating the issue, tyrosine phosphorylation of ezrin also was observed in the LLC-PK1 epithelial cells under conditions, with ezrin being a substrate of hepatocyte growth factor (HGF) receptor. Site-directed mutagenesis of ezrin codons Y145 and Y353 to phenylalanine did not affect the localization of ezrin at microvilli but did perturb the motogenic and morphogenic responses to HGF (10). While it is still not clear whether these tyrosine phosphorylation events are related to the activation of ezrin itself, evidence suggests that Y353 phosphorylation is part of the mechanism of ezrin participation in signal transduction (17). The gastric parietal cell also may have a distinct pathway for the phosphorylation of ezrin, the latter being highly correlated with stimulation of acid secretion mediated by the PKA pathway. Analysis of phospho-amino acids from ezrin radiolabeled in situ revealed that only serine residues were phosphorylated; phosphorylation was not detected on tyrosine or threonine residues (39). In preliminary phosphopeptide analysis using mass spectrometry, none of the above-mentioned threonines or tyrosines were found to be phosphorylated; instead, S66 was found to be a substrate of PKA stimulation (45).

Different binding domains on ezrin N-ERMAD. The localization of NH2 terminus-tagged ezrin was shown to be mainly cytosolic (Figs. 2 and 5), consistent with previous observations in fluorescent protein-tagged ERM proteins (3, 21). However, these NH2 terminus-tagged N-ERMADs are still able to bind to C-ERMADs as shown by FRET experiments using Y-Ez-C and YFP-Ez. This result supports an earlier model proposed by Gary and Bretscher (16), in which two binding domains were depicted on N-ERMAD, with one being responsible for membrane binding and the other being responsible for C-ERMAD binding. The in vivo results presented herein, along with previous in vitro evidence, indicate that dormant ezrin molecules with N-ERMAD and C-ERMAD intramolecular binding can still bind to membranes.

Our observations made using confocal microscopy confirm the earlier result that dormant ezrin sits on or near plasma membranes, especially the apical membrane. Similarly to endogenous ezrin, Ez-CFP is localized to plasma membranes in both HeLa and parietal cells, while NH2 terminus-tagged YFP-Ez has a much more diffuse distribution in both cell types, with only residual membrane association. If the membrane-associated ezrin were the active form, which binds to membranes via the N-ERMAD and to F-actin via the C-ERMAD, one would expect the association of Ez-CFP with the membrane to be very stable. However, this does not seem to be the case, because when Ez-CFP was expressed together with YFP-Ez, the CFP came off the membrane as indicated by diffuse localization (Fig. 2). Particularly in parietal cells, the data indicate that those Ez-CFP molecules were not active on the apical membrane.

Because ezrin plays an important role in acid secretion in parietal cells, its membrane localization, especially the apical location of dormant ezrin, seems reasonable for ezrin to perform its cellular function. When parietal cells are stimulated via the PKA-mediated pathway, the apical membrane is dramatically expanded. One might expect that more ezrin would be recruited to its functional site of action. There is no evidence to suggest that there is any stimulation-associated relocation of ezrin from the cytoplasm or from any other cellular site. However, the data presented herein suggest an alternate way for cells to meet their need: by activation of the dormant ezrin oligomers that are weakly retained in the apical membrane pool. Gel filtration analysis with the ezrin prepared from resting and stimulated gastric glands has demonstrated a shift from oligomers to monomers associated with the stimulation.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The mass spectral data were provided by the University of California San Francisco Mass Spectrometry Facility (A. L. Burlingame, director), which is supported by the Biomedical Research Technology Program of the National Center for Research Resources under Grants RR01614 and RR12961. This study also was supported in part by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-10141 and DK-38972.


    ACKNOWLEDGMENTS
 
We thank Dr. C. Watson (University of California, Berkeley) and Dr. A. L. Burlingame (University of California, San Francisco) for help with mass spectrometry. We thank Dr. M. Arpin (Institut Curie, Paris, France) for the ezrin cDNA construct and Dr. X. Yao (Dept. of Physiology, Morehouse School of Medicine, Atlanta, GA) for the pEGFP-N1/ezrin construct.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J. G. Forte, Dept. of Molecular and Cell Biology, Univ. of California, 245 Life Sciences Addition, MC 3200, Berkeley, CA 94720-3200 (e-mail: jforte{at}berkeley.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Agnew BJ, Duman JG, Watson CL, Coling DE, and Forte JG. Cytological transformations associated with parietal cell stimulation: critical steps in the activation cascade. J Cell Sci 112: 2639–2646, 1999.[Abstract]

2. Algrain M, Turunen O, Vaheri A, Louvard D, and Arpin M. Ezrin contains cytoskeleton and membrane binding domains accounting for its proposed role as a membrane-cytoskeletal linker. J Cell Biol 120: 129–139, 1993.[Abstract/Free Full Text]

3. Amieva MR, Litman P, Huang L, Ichimaru E, and Furthmayr H. Disruption of dynamic cell surface architecture of NIH3T3 fibroblasts by the N-terminal domains of moesin and ezrin: in vivo imaging with GFP fusion proteins. J Cell Sci 112: 111–125, 1999.[Abstract]

4. Andréoli C, Martin M, Le Borgne R, Reggio H, and Mangeat P. Ezrin has properties to self-associate at the plasma membrane. J Cell Sci 107: 2509–2521, 1994.[Abstract]

5. Berryman M, Gary R, and Bretscher A. Ezrin oligomers are major cytoskeletal components of placental microvilli: a proposal for their involvement in cortical morphogenesis. J Cell Biol 131: 1231–1242, 1995.[Abstract/Free Full Text]

6. Bretscher A. Rapid phosphorylation and reorganization of ezrin and spectrin accompany morphological changes induced in A-431 cells by epidermal growth factor. J Cell Biol 108: 921–930, 1989.[Abstract/Free Full Text]

7. Bretscher A, Gary R, and Berryman M. Soluble ezrin purified from placenta exists as stable monomers and elongated dimers with masked C-terminal ezrin-radixin-moesin association domains. Biochemistry 34: 16830–16837, 1995.[CrossRef][Medline]

8. Bretscher A. Regulation of cortical structure by the ezrin-radixin-moesin protein family. Curr Opin Cell Biol 11: 109–116, 1999.[CrossRef][Web of Science][Medline]

9. Cao TT, Deacon HW, Reczek D, Bretscher A, and von Zastrow M. A kinase-regulated PDZ-domain interaction controls endocytic sorting of the {beta}2-adrenergic receptor. Nature 401: 286–290, 1999.[CrossRef][Medline]

10. Crepaldi T, Gautreau A, Comoglio PM, Louvard D, and Arpin M. Ezrin is an effector of hepatocyte growth factor-mediated migration and morphogenesis in epithelial cells. J Cell Biol 138: 423–434, 1997.[Abstract/Free Full Text]

11. Dard N, Louvet-Vallée S, Santa-Maria A, and Maro B. Phosphorylation of ezrin on threonine T567 plays a crucial role during compaction in the mouse early embryo. Dev Biol 271: 87–97, 2004.[CrossRef][Web of Science][Medline]

12. Duman JG, Pathak NJ, Ladinsky MS, McDonald KL, and Forte JG. Three-dimensional reconstruction of cytoplasmic membrane networks in parietal cells. J Cell Sci 115: 1251–1258, 2002.[Abstract/Free Full Text]

13. Fazioli F, Wong WT, Ullrich SJ, Sakaguchi K, Appella E, and Di Fiore PP. The ezrin-like family of tyrosine kinase substrates: receptor-specific pattern of tyrosine phosphorylation and relationship to malignant transformation. Oncogene 8: 1335–1345, 1993.[Web of Science][Medline]

14. Forte JG, Black JA, Forte TM, Machen TE, and Wolosin JM. Ultrastructural changes related to functional activity in gastric oxyntic cells. Am J Physiol Gastrointest Liver Physiol 241: G349–G358, 1981.[Abstract/Free Full Text]

15. Gary R and Bretscher A. Heterotypic and homotypic associations between ezrin and moesin, two putative membrane-cytoskeletal linking proteins. Proc Natl Acad Sci USA 90: 10846–10850, 1993.[Abstract/Free Full Text]

16. Gary R and Bretscher A. Ezrin self-association involves binding of an N-terminal domain to a normally masked C-terminal domain that includes the F-actin binding site. Mol Biol Cell 6: 1061–1075, 1995.[Abstract]

17. Gautreau A, Poullet P, Louvard D, and Arpin M. Ezrin, a plasma membrane-microfilament linker, signals cell survival through the phosphatidylinositol 3-kinase/Akt pathway. Proc Natl Acad Sci USA 96: 7300–7305, 1999.[Abstract/Free Full Text]

18. Gautreau A, Louvard D, and Arpin M. Morphogenic effects of ezrin require a phosphorylation-induced transition from oligomers to monomers at the plasma membrane. J Cell Biol 150: 193–203, 2000.[Abstract/Free Full Text]

19. Gentzsch M, Cui L, Mengos A, Chang XB, Chen JH, and Riordan JR. The PDZ-binding chloride channel ClC-3B localizes to the Golgi and associates with cystic fibrosis transmembrane conductance regulator-interacting PDZ proteins. J Biol Chem 278: 6440–6449, 2003.[Abstract/Free Full Text]

20. Heiska L, Alfthan K, Grönholm M, Vilja P, Vaheri A, and Carpén O. Association of ezrin with intercellular adhesion molecule-1 and -2 (ICAM-1 and ICAM-2): regulation by phosphatidylinositol 4,5-bisphosphate. J Biol Chem 273: 21893–21900, 1998.[Abstract/Free Full Text]

21. Henry MD, Gonzalez Agosti C, and Solomon F. Molecular dissection of radixin: distinct and interdependent functions of the amino- and carboxy-terminal domains. J Cell Biol 129: 1007–1022, 1995.[Abstract/Free Full Text]

22. Ivetic A and Ridley AJ. Ezrin/radixin/moesin proteins and Rho GTPase signalling in leucocytes. Immunology 112: 165–176, 2004.[CrossRef][Web of Science][Medline]

23. Karvar S, Yao X, Duman JG, Hybiske K, Liu Y, and Forte JG. Intracellular distribution and functional importance of vesicle-associated membrane protein 2 in gastric parietal cells. Gastroenterology 123: 281–290, 2002.[CrossRef][Web of Science][Medline]

24. Krieg J and Hunter T. Identification of the two major epidermal growth factor-induced tyrosine phosphorylation sites in the microvillar core protein ezrin. J Biol Chem 267: 19258–19265, 1992.[Abstract/Free Full Text]

25. Mahon MJ, Donowitz M, Yun CC, and Segre GV. Na+/H+ exchanger regulatory factor 2 directs parathyroid hormone 1 receptor signalling. Nature 417: 858–861, 2002.[CrossRef][Medline]

26. Martin M, Andréoli C, Sahuquet A, Montcourrier P, Algrain M, and Mangeat P. Ezrin NH2-terminal domain inhibits the cell extension activity of the COOH-terminal domain. J Cell Biol 128: 1081–1093, 1995.[Abstract/Free Full Text]

27. Martin M, Roy C, Montcourrier P, Sahuquet A, and Mangeat P. Three determinants in ezrin are responsible for cell extension activity. Mol Biol Cell 8: 1543–1557, 1997.[Abstract]

28. Matsui T, Maeda M, Doi Y, Yonemura S, Amano M, Kaibuchi K, and Tsukita S. Rho-kinase phosphorylates COOH-terminal threonines of ezrin/radixin/moesin (ERM) proteins and regulates their head-to-tail association. J Cell Biol 140: 647–657, 1998.[Abstract/Free Full Text]

29. Maudsley S, Zamah AM, Rahman N, Blitzer JT, Luttrell LM, Lefkowitz RJ, and Hall RA. Platelet-derived growth factor receptor association with Na+/H+ exchanger regulatory factor potentiates receptor activity. Mol Cell Biol 20: 8352–8363, 2000.[Abstract/Free Full Text]

30. Reczek D, Berryman M, and Bretscher A. Identification of EBP50: A PDZ-containing phosphoprotein that associates with members of the ezrin-radixin-moesin family. J Cell Biol 139: 169–179, 1997.[Abstract/Free Full Text]

31. Reczek D and Bretscher A. The carboxyl-terminal region of EBP50 binds to a site in the amino-terminal domain of ezrin that is masked in the dormant molecule. J Biol Chem 273: 18452–18458, 1998.[Abstract/Free Full Text]

32. Sawaguchi A, McDonald KL, Karvar S, and Forte JG. A new approach for high-pressure freezing of primary culture cells: the fine structure and stimulation-associated transformation of cultured rabbit gastric parietal cells. J Microsc 208: 158–166, 2002.[Web of Science][Medline]

33. Serrador JM, Vicente-Manzanares M, Calvo J, Barreiro O, Montoya MC, Schwartz-Albiez R, Furthmayr H, Lozano F, and Sanchez-Madrid F. A novel serine-rich motif in the intercellular adhesion molecule 3 is critical for its ezrin/radixin/moesin-directed subcellular targeting. J Biol Chem 277: 10400–10409, 2002.[Abstract/Free Full Text]

34. Short DB, Trotter KW, Reczek D, Kreda SM, Bretscher A, Boucher RC, Stutts MJ, and Milgram SL. An apical PDZ protein anchors the cystic fibrosis transmembrane conductance regulator to the cytoskeleton. J Biol Chem 273: 19797–19801, 1998.[Abstract/Free Full Text]

35. Simons PC, Pietromonaco SF, Reczek D, Bretscher A, and Elias L. C-terminal threonine phosphorylation activates ERM proteins to link the cell's cortical lipid bilayer to the cytoskeleton. Biochem Biophys Res Commun 253: 561–565, 1998.[CrossRef][Web of Science][Medline]

36. Sun F, Hug MJ, Lewarchik CM, Yun CHC, Bradbury NA, and Frizzell RA. E3KARP mediates the association of ezrin and protein kinase A with the cystic fibrosis transmembrane conductance regulator in airway cells. J Biol Chem 275: 29539–29546, 2000.[Abstract/Free Full Text]

37. Tsien RY. The green fluorescent protein. Annu Rev Biochem 67: 509–544, 1998.[CrossRef][Web of Science][Medline]

38. Turunen O, Wahlström T, and Vaheri A. Ezrin has a COOH-terminal actin-binding site that is conserved in the ezrin protein family. J Cell Biol 126: 1445–1453, 1994.[Abstract/Free Full Text]

39. Urushidani T, Hanzel DK, and Forte JG. Characterization of an 80-kDa phosphoprotein involved in parietal cell stimulation. Am J Physiol Gastrointest Liver Physiol 256: G1070–G1081, 1989.[Abstract/Free Full Text]

40. Xia Z and Liu Y. Reliable and global measurement of fluorescence resonance energy transfer using fluorescence microscopes. Biophys J 81: 2395–2402, 2001.[Web of Science][Medline]

41. Xu Y, Kanauchi A, von Arnim AG, Piston DW, and Johnson CH. Bioluminescence resonance energy transfer: monitoring protein-protein interactions in living cells. Methods Enzymol 360: 289–301, 2003.[Web of Science][Medline]

42. Yao X, Thibodeau A, and Forte JG. Ezrin-calpain I interactions in gastric parietal cells. Am J Physiol Cell Physiol 265: C36–C46, 1993.[Abstract/Free Full Text]

43. Yonemura S, Hirao M, Doi Y, Takahashi N, Kondo T, and Tsukita S. Ezrin/radixin/moesin (ERM) proteins bind to a positively charged amino acid cluster in the juxta-membrane cytoplasmic domain of CD44, CD43, and ICAM-2. J Cell Biol 140: 885–895, 1998.[Abstract/Free Full Text]

44. Yun CHC, Lamprecht G, Forster DV, and Sidor A. NHE3 kinase A regulatory protein E3KARP binds the epithelial brush border Na+/H+ exchanger NHE3 and the cytoskeletal protein ezrin. J Biol Chem 273: 25856–25863, 1998.[Abstract/Free Full Text]

45. Zhou R, Cao X, Watson C, Miao Y, Guo Z, Forte JG, and Yao X. Characterization of protein kinase A-mediated phosphorylation of ezrin in gastric parietal cell activation. J Biol Chem 278: 35651–35659, 2003.[Abstract/Free Full Text]

46. Zhou R, Watson C, Fu C, Yao X, and Forte JG. Myosin II is present in gastric parietal cells and required for lamellipodial dynamics associated with cell activation. Am J Physiol Cell Physiol 285: C662–C673, 2003.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. Lee, S. Choi, G. Hallden, S. J. Yo, D. Schichnes, and G. W. Aponte
P2Y5 is a G{alpha}i, G{alpha}12/13 G protein-coupled receptor activated by lysophosphatidic acid that reduces intestinal cell adhesion
Am J Physiol Gastrointest Liver Physiol, October 1, 2009; 297(4): G641 - G654.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
A. Pagliocca, P. Hegyi, V. Venglovecz, S. A. Rackstraw, Z. Khan, G. Burdyga, T. C. Wang, R. Dimaline, A. Varro, and G. J. Dockray
Identification of ezrin as a target of gastrin in immature mouse gastric parietal cells
Exp Physiol, November 1, 2008; 93(11): 1174 - 1189.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
L. Zhu, J. Hatakeyama, C. Chen, A. Shastri, K. Poon, and J. G. Forte
Comparative study of ezrin phosphorylation among different tissues: more is good; too much is bad
Am J Physiol Cell Physiol, July 1, 2008; 295(1): C192 - C202.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
L. Zhu, R. Zhou, S. Mettler, T. Wu, A. Abbas, J. Delaney, and J. G. Forte
High turnover of ezrin T567 phosphorylation: conformation, activity, and cellular function
Am J Physiol Cell Physiol, September 1, 2007; 293(3): C874 - C884.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
G. Tamma, G. Procino, M. Svelto, and G. Valenti
Hypotonicity causes actin reorganization and recruitment of the actin-binding ERM protein moesin in membrane protrusions in collecting duct principal cells
Am J Physiol Cell Physiol, April 1, 2007; 292(4): C1476 - C1484.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. Mazzochi, D. J. Benos, and P. R. Smith
Interaction of epithelial ion channels with the actin-based cytoskeleton
Am J Physiol Renal Physiol, December 1, 2006; 291(6): F1113 - F1122.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/6/C1242    most recent
00521.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhu, L.
Right arrow Articles by Forte, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhu, L.
Right arrow Articles by Forte, J. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.