|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MUSCLE CELL BIOLOGY AND CELL MOTILITY
Department of Cellular and Integrative Physiology, Indiana University School of Medicine, Indianapolis, Indiana
Submitted 9 August 2004 ; accepted in final form 20 December 2004
| ABSTRACT |
|---|
|
|
|---|
Wiskott-Aldrich syndrome protein; actin-related protein; tracheal muscle; cytoskeleton
Wiskott-Aldrich syndrome protein (WASp) was originally described as a protein that could induce actin polymerization in fibroblasts in connection with the small GTPase cdc42 (43). In vitro studies demonstrated that WASp family proteins bind to the actin-related proteins 2 and 3 (Arp2/3) complex and induce Arp2/3 complex activation and the nucleation of actin filaments (21, 37). The Arp2/3 complex consists of one each of seven strongly associated subunits; Arp2 and Arp3 are actin-related proteins and function as the template for actin polymerization. The Arp2/3 complex is stable and remains intact in cells; all of the subunits are associated exclusively with the complex (13, 22, 33, 50). Although proteins other than WASp may regulate activity of the Arp2/3 complex, the evidence to date suggests that WASp family proteins are central to Arp2/3 complex activation (27).
In mammalian tissues, WASp is expressed exclusively in hematopoietic cells; however, the closely related protein neuronal Wiskott-Aldrich syndrome protein (N-WASp), first discovered in the brain, is expressed ubiquitously and is conserved across eukaryotic phyla (21, 24, 33). The demonstration that the binding of active cdc42 to N-WASp in vitro enhances its ability to activate the Arp2/3 complex provided evidence for an externally activated signaling pathway that could initiate actin filament nucleation (37). The WASp family proteins have been implicated in filopodia formation in fibroblast cell lines (25) and are essential for the motility of a number of microbial pathogens within their host cells (20, 41). However, despite the ubiquitous expression of these proteins in mammalian cells, there is little information about their function in physiological processes.
WASp family proteins share a conserved domain organization that includes a module at the extreme COOH terminus responsible for binding to and activating the Arp2/3 complex. This region consists of one or two verprolin homology regions (V; alternatively referred to as W for WASp homology), followed by a central sequence (C) and an acidic region (A). The V sequence binds to G-actin and is common to many actin-binding proteins (16, 26, 32, 36, 51). The COOH-terminal acidic A domain binds the Arp2/3 complex (13, 37). Both the Arp2/3 complex and G-actin must bind to the COOH-terminal domain VCA region of N-WASp for the nucleation of an actin filament to be initiated (26, 36, 51). The VCA COOH-terminal region of N-WASp is the minimal region required to bind to and activate the Arp2/3 complex (21). It is constitutively active and sufficient by itself to stimulate actin filament assembly by the Arp2/3 complex in reconstituted systems in vitro (16).
In vitro studies suggest that N-WASp remains in an inactive conformation until activated by upstream signaling molecules (13). When N-WASp is in its inactive conformation, the VCA domain is masked, whereas in the active conformation, the VCA domain is exposed and able to interact with both the Arp2/3 complex and G-actin and thereby initiate the nucleation of new actin filaments. The CA region by itself binds the Arp2/3 complex but lacks the binding sites for G-actin and acts as a dominant-negative inhibitor of WASp or N-WASp protein activation (16, 36, 37, 50).
In the present study, we expressed a peptide for the CA domain of N-WASp in smooth muscle tissues to evaluate the role of N-WASp in regulating activation of the Arp2/3 complex and actin polymerization in response to contractile stimulation in smooth muscle. Our results demonstrate that the inhibition of N-WASp-mediated activation of the Arp2/3 complex in smooth muscle tissues inhibits both actin polymerization and active tension generation in response to muscarinic stimulation. We conclude that the activation of N-WASp may be an essential step in the pharmacological activation of contraction in smooth muscle.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Preparation of purified N-WASp VCA and CA fusion proteins and mammalian expression plasmids for wild-type N-WASp proteins and VCA and CA domains. The pGEX-2T vectors encoding glutathione S-transferase (GST) fusions of N-WASp VCA (amino acids 392505) or CA (amino acids 450505) peptides and pCS2+ plasmids encoding full-length bovine N-WASp were generously provided by Dr. Marc W. Kirschner (Harvard Medical School, Boston, MA). GST protein was fused to the NH2 terminus of the N-WASp peptides. Purified N-WASp VCA and CA fusion proteins were prepared by expressing them in Escherichia coli. Proteins were affinity purified on glutathione-Sepharose beads using standard methodology.
The N-WASp VCA, N-WASp CA, and full-length wild-type N-WASp bovine cDNA were subcloned into the mammalian expression vector, pEGFP (Clontech, San Diego, CA). The cDNA encoding the CA (1,3751,503) and the VCA domains of N-WASp (1,1621,503) were obtained by performing PCR using the pCS2+ plasmid encoding full-length bovine wild-type N-WASp as the template. The primers were designed as follows: VCA upstream primer, GCTCCACCAGGGAAGCTTATGCCCCCTGGC; CA upstream primer, GCCCCAGAGAAGCTTATGCCAGCACCT; and the downstream primer for both VCA and CA, TCAGTCTTAGGATCCATCATCATCCTC. The PCR products containing N-WASp VCA or CA cDNA were inserted into the pEGFP vector at the HindIII and BamHI sites, in which N-WASp VCA or CA was fused to the COOH terminus of the EGFP. The full-length wild-type N-WASp cDNA (11,503) cDNA was obtained by cutting the pCS2+ plasmid using HindIII and SnaBI and subcloned into the pEGFP vector at the HindIII and KpnI sites by making the KpnI end blunt to produce a construct pEGFP-N-WASp(WT) in which the wild-type N-WASp protein was fused to the COOH terminus of the EGFP. Sequences of all newly made constructs were confirmed. E. coli (XL-1blue) transformed with N-WASp VCA or CA cDNA were grown in Luria-Bertani broth overnight. The bacterial cells were harvested by centrifugation at 4,000 rpm for 15 min at 4°C, and the plasmids were purified using standard methodology.
Introduction of recombinant N-WASp proteins and plasmids into smooth muscle strips. The purified N-WASp GST-tagged VCA and CA fusion proteins and mammalian expression vectors for the bovine N-WASp VCA domain, CA domain, and full-length wild-type N-WASp were introduced into tracheal smooth muscle strips using the method of reversible permeabilization (also called chemical loading) that we described previously (31, 4648): After the optimal muscle length was determined, smooth muscle strips were placed onto metal hooks under tension to maintain them at constant length. Strips were then incubated successively in each of the following solutions: solution 1 (4°C for 120 min) containing (in mM) 10 EGTA, 5 Na2ATP, 120 KCl, 2 MgCl2, and 20 N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid (TES); solution 2 (4°C overnight) containing (in mM) 0.1 EGTA, 5 Na2ATP, 120 KCl, 2 MgCl2, and 20 TES, as well as 10 µg/ml plasmids or 1 mg/ml purified N-WASp VCA or CA GST fusion proteins; solution 3 (4°C for 30 min) containing (in mM) 0.1 EGTA, 5 Na2ATP, 120 KCl, 10 MgCl2, and 20 TES; and solution 4 (22°C for 60 min) containing (in mM) 110 NaCl, 3.4 KCl, 0.8 MgSO4, 25.8 NaHCO3, 1.2 KH2PO4, and 5.6 dextrose. Solutions 13 were aerated with 100% O2 to maintain pH 7.1, and solution 4 was aerated with 95% O2-5% CO2 to maintain pH 7.4. After 30 min in solution 4, CaCl2 was added gradually to a final concentration of 2.4 mM. After proteins were introduced into the muscle strips, muscle tissues were returned to PSS at 37°C in 25-ml organ baths and attached to force transducers for the immediate measurement of isometric force. When the procedure was used to introduce plasmids into the strips, the muscle strips were then transferred to DMEM containing 5 mM Na2ATP, 100 U/ml penicillin, 100 µg/ml streptomycin, and 10 µg/ml plasmids (N-WASp wild type, VCA or CA domains) and incubated for 2 days at 37°C to allow for expression of the recombinant proteins.
The efficiency of tissue transfection was evaluated by determining the percentage of cells dissociated from plasmid-treated muscle tissues that expressed EGFP-labeled proteins (see method described in Dissociation of airway smooth muscle cells from tissue strips). A Zeiss LSM 510 laser scanning confocal microscope was used to view GFP fluorescence in living smooth muscle cells freshly dissociated from muscle tissues treated with plasmids encoding EGFP-tagged N-WASp VCA or CA peptides or untreated tissues. The GFP fluorescence was excited with a 488-nm argon laser light, and fluorescence emissions were collected at 500530 nm with an Apo x40 water-immersion lens objective (NA 1.2) (see Fig. 2).
|
Immunofluorescence labeling. Stimulated and unstimulated smooth muscle cells on coverslips were washed three times in Tris-buffered saline (TBS) containing 50 mM Tris, 150 mM NaCl, and 0.1% NaN3 and permeabilized in 0.2% Triton X-100 dissolved in TBS for 2 min. Cells were washed again in TBS and placed in a blocking solution containing 2% bovine serum albumin for 1 h at room temperature. Cells were washed repeatedly and incubated with a primary antibody against N-WASp (rabbit polyclonal, H-100; Santa Cruz Biotechnology, Santa Cruz, CA), Arp3 (goat polyclonal, G-15; Santa Cruz Biotechnology), or STAT6 (mouse monoclonal clone 23; Transduction Labs, Lexington, KY) for 1 h at 37°C. The specificity of these antibodies for the target protein was documented using immunoblot analysis (see Figs. 7C and 8C). Cells were washed again and incubated with a secondary antibody conjugated to a fluorescent green (Alexa 488) or red (Alexa 546) fluoroprobe (Molecular Probes, Eugene, OR) for 30 min at 37°C. In some experiments, cells were double-labeled by reacting primary antibodies with secondary antibodies conjugated to different fluorescent dyes. Cells were washed to remove excess antibodies, and coverslips were mounted onto slides with mounting medium.
|
|
1 µm in cell thickness. The plane of focus was set midway between the bottom and the top of the cell. Fluorescence intensity measurements were standardized among all cells compared within a single experiment by maintaining the same confocal settings for each fluoroprobe. Images of smooth muscle cells were analyzed for regional differences in fluorescence intensity of labeled proteins by quantifying the pixel intensity with a series of six cross-sectional line scans along the entire length of each cell as previously described (31). The area of the nucleus was excluded from the analysis. The ratio of pixel intensity between the cell periphery and interior was determined for each line scan by calculating the ratio of the average maximum pixel intensity at the cell periphery to the minimum pixel intensity in the cell interior. The ratios of pixel intensities between the cell periphery and the cell interior for all of the six line scans performed on a given cell were averaged to obtain a single value for the ratio for each cell. The ratio of fluorescence intensity at the cell periphery to that at the cell interior was compared in cells at rest and in cells stimulated with ACh (103 M).
Immunoblot analysis. Pulverized smooth muscle strips were mixed with 50 µl of extraction buffer containing: 20 mM Tris·HCl, pH 7.4, 2% Triton X-100, 0.2% SDS, 2 mM EDTA, phosphatase inhibitors (in mM: 2 sodium orthovanadate, 2 molybdate, and 2 sodium pyrophosphate), and protease inhibitors (in mM: 2 benzamidine, 0.5 aprotinin, and 1 phenylmethylsulfonyl fluoride). Samples were boiled for 5 min and centrifuged at 14,000 rpm for 15 min, and then the supernatant was collected. Muscle extracts were then boiled in sample buffer (1.5% DTT, 2% SDS, 80 mM Tris·HCl, pH 6.8, 10% glycerol, and 0.01% bromophenol blue) for 5 min and separated using SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Proteins were transferred to nitrocellulose membranes, which were then probed with antibodies followed by horseradish peroxidase (HRP)-conjugated secondary antibodies (Ig; Jackson ImmunoResearch). Proteins were visualized using enhanced chemiluminescence (ECL) and quantified using scanning densitometry.
Immunoprecipitation of proteins. Proteins were immunoprecipitated as previously described (31). Pulverized muscle strips were mixed with extraction buffer containing 20 mM Tris·HCl, pH 7.4, 2% Triton X-100, 0.2% SDS, 2 mM EDTA, 0.9% NaCl, phosphatase inhibitors (in mM: 2 sodium orthovanadate, 2 molybdate, and 2 sodium pyrophosphate), and protease inhibitors (in mM: 2 benzamidine, 0.5 aprotinin, and 1 phenylmethylsulfonyl fluoride). Each sample was centrifuged for the collection of supernatant. Muscle extracts containing equal amounts of protein were precleared for 30 min with 50 µl of 10% protein A-Sepharose. The precleared extracts were centrifuged at 14,000 rpm for 2 min. The extracts were incubated overnight with antibody against N-WASp to immunoprecipitate endogenous N-WASp and then incubated for 2 h with 125 µl of a 10% suspension of protein A-Sepharose beads conjugated to rabbit anti-goat Ig. Immunocomplexes were washed four times in a buffer containing 50 mM Tris·HCl (pH 7.6), 150 mM NaCl, and 0.1% Triton X-100. All procedures of immunoprecipitation were performed at 4°C. The immunoprecipitates of N-WASp were separated by SDS-PAGE followed by transfer to nitrocellulose membranes. The nitrocellulose membranes were divided into two parts: the lower part was probed with antibody for Arp3 (G-15) or Arp2 (H-84) (Santa Cruz Biotechnology), and the upper part was probed with antibody against N-WASp (N-15; Santa Cruz Biotechnology) or monoclonal myosin heavy chain (clone hSM-V; Sigma). Proteins were quantitated using scanning densitometry.
Analysis of MLC phosphorylation. Analysis of myosin light-chain (MLC) phosphorylation was performed as previously described (31, 44). Muscle strips were rapidly frozen at desired time points after contractile stimulation with ACh and then immersed in acetone containing 10% (wt/vol) trichloroacetic acid (TCA) and 10 mM DTT, which was precooled using dry ice. Strips were thawed in acetone-TCA-DTT at room temperature and then washed four times with acetone-DTT. Proteins were extracted for 60 min in 8 M urea, 20 mM Tris base, 22 mM glycine, and 10 mM DTT. MLCs were separated by performing glycerol-urea-PAGE and transferred to nitrocellulose. The membranes were immunoblotted with polyclonal affinity-purified rabbit MLC 20 antibody. Unphosphorylated and phosphorylated bands of MLCs were detected using scanning densitometry. MLC phosphorylation was calculated as the ratio of phosphorylated MLCs to total MLCs.
Analysis of F-actin and G-actin.
The relative proportions of F-actin and G-actin in smooth muscle tissues were analyzed using an assay kit from Cytoskeleton (Denver, CO). Briefly, each of the tracheal smooth muscle strips was homogenized in 200 µl of F-actin stabilization buffer (50 mM PIPES, pH 6.9, 50 mM NaCl, 5 mM MgCl2, 5 mM EGTA, 5% glycerol, 0.1% Triton X-100, 0.1% Nonidet P-40, 0.1% Tween-20, 0.1%
-mercaptoethanol, 0.001% antifoam, 1 mM ATP, 1 µg/ml pepstatin, 1 µg/ml leupeptin, 10 µg/ml benzamidine, and 500 µg/ml tosyl arginine methyl ester). Supernatants of the protein extracts were collected after centrifugation at 150,000 g for 60 min at 37°C. The pellets were resuspended in 200 µl of ice-cold distilled water containing 1 µM cytochalasin D and then incubated on ice for 1 h to depolymerize F-actin. The resuspended pellets were gently mixed every 15 min. Four microliters of supernatant (G-actin) and pellet (F-actin) fractions were subjected to immunoblot analysis using anti-actin antibody (clone AC-40; Sigma). The ratios of F-actin to G-actin were determined using densitometry.
A standard curve for actin protein was determined using immunoblot analysis with anti-total actin antibody (clone AC-40; Sigma) for actin ranging from 0.02 to 0.4 µg. The immunoblots of G-actin and F-actin fractions were compared with the standard curve to determine the amounts of G-actin and F-actin in each fraction, and then the amounts of G-actin and F-actin in the whole muscle strip were determined by adding the amounts in the soluble and insoluble fractions. The proportions of F-actin and G-actin in unstimulated and stimulated muscle strips were calculated on the basis of the amount of actin in each fraction relative to the total actin protein in the muscle strip.
In some experiments, the membrane was blotted with anti-
-actin antibody (clone AC-15; Sigma) and then stripped and reblotted with anti-
-actin antibody (clone 1A4; Sigma) to evaluate the polymerization of actin isoforms in smooth muscle tissues.
Statistical analysis. Comparisons between two groups were performed using paired t-tests. Comparisons among multiple groups were performed using one-way ANOVA. Values refer to the number of cells or tissue strips used to obtain mean values. P < 0.05 was considered statistically significant.
| RESULTS |
|---|
|
|
|---|
|
37 kDa) and CA (
32 kDa) peptides were detected in smooth muscle tissues treated with plasmids encoding N-WASp VCA or CA peptides, but not in untreated muscle strips or muscle strips treated with EGFP plasmids.
Introduction of N-WASp CA peptides into muscle strips inhibits force development in tracheal smooth muscle tissue.
Purified GST fusion proteins for the VCA and CA domains of N-WASp were introduced into tracheal smooth muscle tissue strips by performing reversible permeabilization. Force in response to 105 M ACh was measured 12 h after the introduction of the N-WASp fusion proteins and compared with force measured before incubation (Fig. 3). In smooth muscle strips treated with the GST fusion proteins for the N-WASp CA peptide, isometric contractile force in response to 5-min stimulation with ACh was significantly reduced to 69.8 ± 3.8% of preintroduction force (n = 14; P < 0.05). In contrast, in strips treated with GST fusion proteins for the N-WASp VCA domain or with no proteins, isometric force in response to 5-min stimulation with ACh was not significantly different from the preintroduction force (Fig. 3B) (n = 14; P > 0.05). Protein extracts from muscle strips were examined using Western blot analysis to confirm that the N-WASp peptides were present in smooth muscle strips (Fig. 3C). The depression of force caused by the introduction of the GST fusion proteins for the N-WASp CA domain was somewhat less than that obtained when the N-WASp CA peptide was expressed in the tissue by introducing plasmids, possibly because the latter method resulted in higher levels of the CA domain peptides in the smooth muscle tissues. These results demonstrate that isometric contraction in response to ACh in smooth muscle strips also can be inhibited by short-term (
1 h) exposure to N-WASp CA peptides.
|
|
7% of the total cellular actin in response to contractile stimulation. ACh stimulation caused similar changes in the amounts of G-actin and F-actin in smooth muscle tissues treated with plasmids encoding the N-WASp VCA domain (n = 10; P < 0.05). However, in smooth muscle strips expressing the N-WASp CA domain, stimulation with ACh did not cause significant changes in the amounts G-actin or F-actin. In CA-treated muscle strips stimulated with ACh, the G-actin content was significantly higher, and the F-actin content was significantly lower, than that in the unstimulated or VCA-treated muscle strips. These results indicate that expression of the N-WASp CA domain inhibited actin polymerization in muscle strips in response to ACh stimulation.
In separate experiments, the G-actin and F-actin fractions were blotted using anti-
-actin antibody and anti-
-actin antibody to evaluate which isoforms of actin were undergoing polymerization in response to contractile stimulation. Our results showed that both
-actin and
-actin polymerized in response to ACh stimulation in tracheal smooth muscle tissues. In unstimulated muscle strips, the ratios of F-actin to G-actin were 3.0 ± 0.6 for
-actin and 2.8 ± 0.3 in
-actin. ACh stimulation increased the ratio of F-actin to G-actin to 6.3 ± 2.2 for
-actin and to 6.0 ± 0.6 for
-actin. There were no significant differences in the proportions of
-actin and
-actin isoforms of either G- or F-actin (Fig. 5) (n = 4; P > 0.05).
|
|
Ratios of fluorescence intensity between the cell periphery and the cell interior for N-WASp and Arp3 were calculated for unstimulated cells and for cells stimulated with ACh (Fig. 7B). A total of 35 unstimulated and 38 stimulated smooth muscle cells obtained from six experiments were analyzed for each protein. Fluorescence intensities for both N-WASp and Arp3 were
2.5 times higher at the cell periphery than in the cell interior after stimulation with ACh (P < 0.05). In contrast, in the unstimulated cells, the concentrations of N-WASp and Arp3 at the cell periphery were only slightly elevated relative to those in the cell interior (
1.2 times higher for both N-WASp and Arp3). These results indicate that stimulation with a contractile agonist promotes the recruitment of both N-WASp and the Arp2/3 complex to the smooth muscle cell membrane.
We considered the possibility that the localization of Arp3 and N-WASp at the membrane of ACh-stimulated smooth muscle cells might result from a nonspecific effect of contraction on the distribution of cytoplasmic proteins in the isolated smooth muscle cells. To evaluate this possibility, we used immunofluorescence microscopy to compare the localization of Arp3 and the signal transduction protein, STAT6, in freshly isolated smooth muscle cells that were stimulated with ACh or left unstimulated (Fig. 8). The cells were fixed and double-immunostained for Arp3 and STAT6 and then visualized using confocal microscopy. STAT6 can be activated in airway smooth muscle by stimulating the interleukin-4 receptors (19), which causes STAT6 to redistribute to the nucleus. STAT6 would not be expected to undergo activation or translocation within the cell in response to stimulation with ACh.
Figure 8 illustrates the response of freshly dissociated smooth muscle cells that were fixed and double-stained for Arp3 and STAT6 unstimulated cells and cells stimulated with ACh. The results shown are typical of observations obtained using 13 unstimulated cells and 20 stimulated cells from smooth muscle tissues obtained from two separate experiments. The mean results for all cells are shown in Fig. 8B. Arp3 was distributed throughout the cytoplasm of unstimulated cells and relocalized to the cell membrane in response to stimulation with ACh. STAT6 was also distributed throughout the cytoplasm of unstimulated cells. However, in contrast to Arp3, the cellular localization of STAT6 did not change in response to stimulation with ACh.
Expression of the N-WASp CA domain inhibits the recruitment of Arp3 to the cell periphery in response to stimulation with ACh. Smooth muscle cells were freshly dissociated from muscle strips and double-stained with antibodies to N-WASp and Arp3 to evaluate the effect of the expression of the N-WASp VCA and CA domain peptides on the redistribution of endogenous N-WASp and Arp2/3 complex in response to contractile stimulation. In freshly dissociated smooth muscle cells expressing either wild-type N-WASp or the N-WASp VCA domain peptides, the fluorescence of both endogenous N-WASp and Arp3 was significantly increased at the cell periphery relative to the cell interior in cells stimulated with ACh (Fig. 9A). In these groups of cells, the fluorescence intensity ratios between the cell periphery and the cell interior for endogenous N-WASp and Arp3 ranged from 2.5 to 2.7 (Fig. 9B). In smooth muscle cells dissociated from muscle strips expressing the N-WASp CA domain peptides, endogenous N-WASp redistributed to the cell periphery in response to ACh stimulation (ratio, 2.7 ± 0.4; n = 32), but there was very little redistribution of Arp3 to the cell periphery (ratio, 1.4 ± 0.3; n = 32) (Fig. 9). Thus expression of N-WASp CA domain peptides in tracheal smooth muscle strips inhibited the recruitment of endogenous Arp3 to the cell periphery in response to ACh stimulation. In unstimulated cells expressing the VCA or CA domain peptides or wild-type N-WASp, Arp3 and N-WASp were distributed throughout the cytoplasm. The distribution of the endogenous N-WASp and Arp3 in these cells was not different from that in cells from untreated tissues.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
We evaluated the involvement of N-WASp in the regulation of contraction in smooth muscle by expressing a fusion protein encoding the GFP-tagged COOH-terminal domain of N-WASp, the CA domain, in tracheal smooth muscle tissues. In reconstituted actin polymerization assay systems in vitro, the CA domain of the WASp family proteins acts as a dominant-negative inhibitor for activation of the Arp2/3 complex by competing with full-length WASp or N-WASp proteins for binding to the Arp2/3 complex (16, 37). In tracheal smooth muscle tissues, expression of the CA domain of N-WASp in muscle tissues inhibited active tension development stimulated by the administration of exogenous ACh by
50%. Expression of the CA domain also inhibited ACh-induced actin polymerization as assessed by measuring the relative contents of G-actin and F-actin in stimulated and unstimulated muscle strips using a fractionation assay. In contrast, expression of the VCA domain of N-WASp, which is constitutively active in vitro, did not inhibit tension development or actin polymerization in these smooth muscle tissues.
The activation of N-WASp is thought to require its translocation and anchoring at the membrane by activator molecules such as cdc42 or phosphatidylinositol 4,5-bisphosphate (PIP2) (5, 6, 12, 24, 50). Upon activation, N-WASp undergoes a conformational change that allows it to bind to the Arp2/3 complex (6, 12, 25, 36). Binding of the Arp2/3 complex to N-WASp results in activation of the complex, enabling it to catalyze the polymerization of actin. To obtain further evidence that N-WASp and the Arp2/3 complex are activated during the contractile stimulation of smooth muscle, we assessed the effect of ACh on the association of Arp2/3 complex proteins with N-WASp in extracts from smooth muscle tissues. The amount of Arp2 or Arp3 that coprecipitated with N-WASp increased significantly in extracts from tissues that had been stimulated with ACh compared with extracts from unstimulated tissues, indicating that the association of the Arp2/3 complex with N-WASp is increased by contractile stimulation. The expression of the CA domain of N-WASp in tracheal smooth muscle tissues prevented the increase in the association of endogenous N-WASp with Arp2 or Arp3 in ACh-stimulated tissues. Thus expression of the CA domain of N-WASp in these tissues is effective in inhibiting the activation of the Arp2/3 complex by N-WASp in response to stimulation with ACh.
Further evidence for the activation of N-WASp and the Arp2/3 complex by ACh was obtained by evaluating changes in the localization of these proteins in muscle cells in response to contractile stimulation. Smooth muscle cells were enzymatically dissociated from muscle tissues, and the localization of N-WASp and Arp proteins was visualized using immunofluorescence and confocal microscopy. After stimulation with ACh, the concentration of both N-WASp and Arp3 increased at the membrane, whereas both proteins were distributed more evenly throughout the cytoplasm in unstimulated cells.
In cells dissociated from tissues expressing the CA domain peptide of N-WASp, the redistribution of Arp3 to the membrane in response to ACh was inhibited. In these cells, stimulation with ACh resulted in the redistribution of endogenous N-WASp to the membrane, but Arp3 and the recombinant CA peptide remained distributed throughout the cytoplasm. This observation is consistent with in vitro studies that have suggested that the CA fragment of N-WASp binds to and sequesters the Arp2/3 complex and thereby prevents its activation (16). In contrast, the N-WASp VCA domain peptides did not inhibit the redistribution of Arp3 to the membrane in response to stimulation with ACh. Neither VCA nor CA N-WASp COOH-terminal peptides contain the centrally located N-WASp sequences required for N-WASp to bind to cdc42 and PIP2 and anchor at the membrane (12, 36, 37). Thus membrane localization of these COOH-terminal peptides would not be expected. Although the VCA domain of N-WASp can bind to the Arp2/3 complex, there is evidence that this interaction is transient and that the VCA domain of N-WASp is released from the Arp2/3 complex when actin polymerization is initiated (9, 49). Thus the VCA domain peptide would not be expected to sequester the Arp2/3 complex or to inhibit the activation of endogenous N-WASp. Our immunofluorescence data provide further evidence that the N-WASp CA domain peptide inhibits the activation of the Arp2/3 complex by endogenous N-WASp in smooth muscle tissues in response to stimulation with ACh.
In tracheal smooth muscle, the inhibition of actin polymerization by cytochalasin or latrunculin results in a marked inhibition of active tension development without significantly affecting MLC phosphorylation (23). Moreover, actin polymerization also can be inhibited by preventing the phosphorylation of the scaffolding protein paxillin, which inhibits active contraction without affecting either MLC phosphorylation or myosin ATPase activity (47). These previous studies suggested that actin polymerization functions in the regulation of tension development separately from and independently of the activation of myosin ATPase activity and cross-bridge cycling. Our present results are consistent with our previous observations in that the inhibition of actin polymerization by the CA domain of N-WASp had no effect on the increase in MLC phosphorylation in response to agonist stimulation. Thus the effect of the CA domain in inhibiting active force development during contractile stimulation appears to result directly from the inhibition of actin polymerization rather than from effects on MLC phosphorylation or cross-bridge cycling.
The functional role of actin polymerization in the regulation of tension development in smooth muscle is not known. Estimates from our present study suggest that the pool of G-actin constitutes <20% of the total actin in unstimulated tracheal smooth muscle tissues. This estimate is slightly lower than that obtained in a previous study in which we estimated the G-actin pool to be
30% of total actin (23), which may reflect better separation of soluble and polymerized actin in extracts of smooth muscle tissues using our current methods. Contractile stimulation decreased the amount of G-actin by
40%, resulting in a twofold increase in the ratio of F-actin to G-actin. These values are consistent with our previous observations regarding tracheal muscle tissues (23, 46, 47) and with previous reports of smooth muscle cells in which contractile stimulation increased the ratio of F-actin (estimated by FITC-phalloidin staining) to G-actin (estimated by Texas Red-labeled DNase I staining) approximately twofold (15).
A critical question is how a 710% increase in the amount of F-actin might regulate tension development during contractile stimulation. The molar ratio of actin to myosin in smooth muscle is quite high: It has been reported to be as low as 8:1 in chicken gizzard and
15:1 in vascular muscle and as high as 50:1 in isolated amphibian visceral muscle (8, 29, 42). Thus it seems unlikely that the polymerization of new actin would be necessary to form actin filaments to interact with myosin for the process of cross-bridge cycling. Our observation that the inhibition of actin polymerization does not disrupt myosin ATPase activity or MLC phosphorylation also supports the idea that the newly polymerized actin is not involved in signaling processes that regulate cross-bridge cycling or the formation of filaments that interact with myosin (23, 47). Furthermore, the inhibition of actin polymerization in smooth muscle tissues by either of the inhibitors cytochalasin or latrunculin does not result in evident alterations in cytoskeletal structure when the tissues are examined using electron microscopy (23).
Smooth muscle cells contain both
- and
-isoforms of actin (39). It has been proposed that myosin may interact preferentially with
-actin, while
-actin may sustain a structural function by cross-linking the contractile apparatus to dense bodies and dense plaques in smooth muscle (39). Using specific antibodies for actin isoforms in the present study, we found that both
-actin and
-actin isoforms undergo polymerization in response to contractile stimulation; thus the polymerization of actin during contractile activation is not selective for a specific actin isoform.
N-WASp-mediated actin polymerization may be involved in regulating smooth muscle cell structure and in forming connections to the cell membrane that are necessary to transmit tension from the contractile apparatus to the extracellular matrix. The Arp2/3 complex is a critical player in the initiation of actin polymerization that drives lamellipodium and filapodium protrusion in motile nonmuscle cells (40). In the motile cells, a local change of signal catalyzes the assembly of meshwork actin filaments at the cell membrane that propel the protrusion of the edge of the membrane (34, 40). The assembly of these actin-based structures is regulated by the small GTPases Rac and cdc42 (11, 28, 35), which can be activated by growth factors and integrin receptors. N-WASp and WASp are the only known effectors of cdc42 that can directly activate actin assembly through activation of the nucleating activity of the Arp2/3 complex. There is evidence that the activation of cdc42 is required for N-WASp-mediated actin polymerization in tracheal smooth muscle (45).
Smooth muscle lines hollow organs that undergo large changes in shape and volume under physiological conditions in vivo, and the muscle must rapidly adapt its compliance and contractility to accommodate external mechanical forces (10). Actin filaments attach to adhesion plaques at the membrane, where transmembrane integrins connect to the extracellular matrix, enabling the transmission of tension between the inside and the outside of the cell (4, 38). The ability of smooth muscle to adapt its properties to changes in its length or shape may result from the reorganization of the actin filament network in a manner that is analogous to lamellipodia formation during cell spreading and cell migration in nonmuscle cells. The polymerization of new actin filaments and their attachment to adhesion sites along the membrane may provide a mechanism for the cell to adapt its structure to shape changes imposed by external forces. The connections formed by the new actin filaments may be necessary for the transmission of tension from the contractile apparatus to the extracellular matrix during active contraction.
In conclusion, our present study demonstrates that actin polymerization in smooth muscle requires N-WASp-mediated activation of the Arp2/3 complex and that this process plays an essential role in tension generation in response to a contractile stimulus. Only a small percentage (<10%) of total actin polymerizes in response to contractile stimulation. This actin may be critical for the transmission of tension from the contractile apparatus to adhesion sites on the membrane during contractile stimulation. Newly formed actin filaments may localize beneath the cell membrane and regulate changes in smooth muscle cell shape and stiffness in response to external mechanical forces.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. An SS, Laudadio RE, Lai J, Rogers RA, and Fredberg JJ. Stiffness changes in cultured airway smooth muscle cells. Am J Physiol Cell Physiol 283: C792C801, 2002.
3. Barany M, Barron JT, Gu L, and Barany K. Exchange of the actin-bound nucleotide in intact arterial smooth muscle. J Biol Chem 276: 4839848403, 2001.
4. Burridge K and Chrzanowska-Wodnicka M.. Focal adhesions, contractility, and signaling. Annu Rev Cell Dev Biol 12: 463518, 1996.[CrossRef][Web of Science][Medline]
5. Carlier MF, Ducruix A, and Pantaloni D. Signalling to actin: the Cdc42-N-WASP-Arp2/3 connection. Chem Biol 6: R235R240, 1999.[CrossRef][Web of Science][Medline]
6. Caron E. Regulation of Wiskott-Aldrich syndrome protein and related molecules. Curr Opin Cell Biol 14: 8287, 2002.[CrossRef][Web of Science][Medline]
7. Cipolla MJ, Gokina NI, and Osol G. Pressure-induced actin polymerization in vascular smooth muscle as a mechanism underlying myogenic behavior. FASEB J 16: 7276, 2002.
8. Cooke PH, Kargacin G, Craig R, Fogarty K, and Fay FS. Molecular structure and organization of filaments in single, skinned smooth muscle cells. Prog Clin Biol Res 245: 125, 1987.[Medline]
9. Egile C, Loisel TP, Laurent V, Li R, Pantaloni D, Sansonetti PJ, and Carlier MF. Activation of the CDC42 effector N-WASP by the Shigella flexneri IcsA protein promotes actin nucleation by Arp2/3 complex and bacterial actin-based motility. J Cell Biol 146: 13191332, 1999.
10. Gunst SJ, Tang DD, and Opazo Saez AM. Cytoskeletal remodeling of the airway smooth muscle cell: a mechanism for adaptation to mechanical forces in the lung. Respir Physiol Neurobiol 137: 151168, 2003.[CrossRef][Web of Science][Medline]
11. Hall A. Rho GTPases and the actin cytoskeleton. Science 279: 509514, 1998.
12. Higgs HN and Pollard TD. Activation by Cdc42 and PIP2 of Wiskott-Aldrich syndrome protein (WASp) stimulates actin nucleation by Arp2/3 complex. J Cell Biol 150: 13111320, 2000.
13. Higgs HN and Pollard TD. Regulation of actin filament network formation through Arp2/3 complex: activation by a diverse array of proteins. Annu Rev Biochem 70: 649676, 2001.[CrossRef][Web of Science][Medline]
14. Hirshman CA and Emala CW. Actin reorganization in airway smooth muscle cells involves Gq and Gi-2 activation of Rho. Am J Physiol Lung Cell Mol Physiol 277: L653L661, 1999.
15. Hirshman CA, Togashi H, Shao D, and Emala CW. G
i-2 is required for carbachol-induced stress fiber formation in human airway smooth muscle cells. Am J Physiol Lung Cell Mol Physiol 275: L911L916, 1998.
16. Hüfner K, Higgs HN, Pollard TD, Jacobi C, Aepfelbacher M, and Linder S. The verprolin-like central (VC) region of Wiskott-Aldrich syndrome protein induces Arp2/3 complex-dependent actin nucleation. J Biol Chem 276: 3576135767, 2001.
17. Ishida T, Ishida M, Suero J, Takahashi M, and Berk BC. Agonist-stimulated cytoskeletal reorganization and signal transduction at focal adhesions in vascular smooth muscle cells require c-Src. J Clin Invest 103: 789797, 1999.[Web of Science][Medline]
18. Jones KA, Perkins WJ, Lorenz RR, Prakash YS, Sieck GC, and Warner DO. F-actin stabilization increases tension cost during contraction of permeabilized airway smooth muscle in dogs. J Physiol 519: 527538, 1999.
19. Laporte JC, Moore PE, Baraldo S, Jouvin MH, Church TL, Schwartzman IN, Panettieri RA Jr, Kinet JP and Shore SA. Direct effects of interleukin-13 on signaling pathways for physiological responses in cultured human airway smooth muscle cells. Am J Respir Crit Care Med 164: 141148, 2001.
20. Lommel S, Benesch S, Rottner K, Franz T, Wehland J, and Kühn R. Actin pedestal formation by enteropathogenic Escherichia coli and intracellular motility of Shigella flexneri are abolished in N-WASP-defective cells. EMBO Rep 2: 850857, 2001.[CrossRef][Web of Science][Medline]
21. Machesky LM, Mullins RD, Higgs HN, Kaiser DA, Blanchoin L, May RC, Hall ME, and Pollard TD. Scar, a WASp-related protein, activates nucleation of actin filaments by the Arp2/3 complex. Proc Natl Acad Sci USA 96: 37393744, 1999.
22. May RC. The Arp2/3 complex: a central regulator of the actin cytoskeleton. Cell Mol Life Sci 58: 16071626, 2001.[CrossRef][Web of Science][Medline]
23. Mehta D and Gunst SJ. Actin polymerization stimulated by contractile activation regulates force development in canine tracheal smooth muscle. J Physiol 519: 829840, 1999.
24. Miki H, Miura K, and Takenawa T. N-WASP, a novel actin-depolymerizing protein, regulates the cortical cytoskeletal rearrangement in a PIP2-dependent manner downstream of tyrosine kinases. EMBO J 15: 53265335, 1996.[Web of Science][Medline]
25. Miki H, Sasaki T, Takai Y, and Takenawa T. Induction of filopodium formation by a WASP-related actin-depolymerizing protein N-WASP. Nature 391: 9396, 1998.[CrossRef][Medline]
26. Miki H and Takenawa T. Direct binding of the verprolin-homology domain in N-WASP to actin is essential for cytoskeletal reorganization. Biochem Biophys Res Commun 243: 7378, 1998.[CrossRef][Web of Science][Medline]
27. Millard TH, Sharp SJ, and Machesky LM. Signalling to actin assembly via the WASP (Wiskott-Aldrich syndrome protein)-family proteins and the Arp2/3 complex. Biochem J 380: 117, 2004.[CrossRef][Web of Science][Medline]
28. Nobes CD and Hall A. Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell 81: 5362, 1995.[CrossRef][Web of Science][Medline]
29. Nonomura J. Fine structure of myofilaments in chicken gizzard smooth muscle. In: Recent Progress in Electron Microscopy of Cells and Tissues, edited by Yamada E, Mazuhira K, Kurosumi K, and Nagano T. Stuttgart, Germany: Thieme, 1976, p. 4048.
30. Obara K and Yabu H. Effect of cytochalasin B on intestinal smooth muscle cells. Eur J Pharmacol 255: 139147, 1994.[CrossRef][Web of Science][Medline]
31. Opazo Saez AM, Zhang W, Wu Y, Turner CE, Tang DD, and Gunst SJ. Tension development during contractile stimulation of smooth muscle requires recruitment of paxillin and vinculin to the membrane. Am J Physiol Cell Physiol 286: C433C447, 2004.
32. Paunola E, Mattila PK, and Lappalainen P. WH2 domain: a small, versatile adapter for actin monomers. FEBS Lett 513: 9297, 2002.[CrossRef][Web of Science][Medline]
33. Pollard TD, Blanchoin L, and Mullins RD. Molecular mechanisms controlling actin filament dynamics in nonmuscle cells. Annu Rev Biophys Biomol Struct 29: 545576, 2000.[CrossRef][Web of Science][Medline]
34. Rafelski SM and Theriot JA. Crawling toward a unified model of cell mobility: Spatial and temporal regulation of actin dynamics. Annu Rev Biochem 73: 209239, 2004.[CrossRef][Web of Science][Medline]
35. Ridley AJ. Rho family proteins: coordinating cell responses. Trends Cell Biol 11: 471477, 2001.[CrossRef][Web of Science][Medline]
36. Rohatgi R, Ho HY, and Kirschner MW. Mechanism of N-WASP activation by CDC42 and phosphatidylinositol 4,5-bisphosphate. J Cell Biol 150: 12991310, 2000.
37. Rohatgi R, Ma L, Miki H, Lopez M, Kirchhausen T, Takenawa T, and Kirschner MW. The interaction between N-WASP and the Arp2/3 complex links Cdc42-dependent signals to actin assembly. Cell 97: 221231, 1999.[CrossRef][Web of Science][Medline]
38. Shyy JY and Chien S. Role of integrins in cellular responses to mechanical stress and adhesion. Curr Opin Cell Biol 9: 707713, 1997.[CrossRef][Web of Science][Medline]
39. Small JV. Structure-function relationships in smooth muscle: the missing links. Bioessays 17: 785792, 1995.[CrossRef][Web of Science][Medline]
40. Small JV, Stradal T, Vignal E, and Rottner K. The lamellipodium: where motility begins. Trends Cell Biol 12: 112120, 2002.[CrossRef][Web of Science][Medline]
41. Snapper SB, Takeshima F, Antón I, Liu CH, Thomas SM, Nguyen D, Dudley D, Fraser H, Purich D, Lopez-Ilasaca M, Klein C, Davidson L, Bronson R, Mulligan RC, Southwick F, Geha R, Goldberg MB, Rosen FS, Hartwig JH, and Alt FW. N-WASP deficiency reveals distinct pathways for cell surface projections and microbial actin-based motility. Nat Cell Biol 3: 897904, 2001.[CrossRef][Web of Science][Medline]
42. Somlyo AP, Devine CE, Somlyo AV, and Rice RV. Filament organization in vertebrate smooth muscle. Philos Trans R Soc Lond B Biol Sci 265: 223229, 1973.[Web of Science][Medline]
43. Symons M, Derry JMJ, Karlak B, Jiang S, Lemahieu V, McCormick F, Francke U, and Abo A. Wiskott-Aldrich syndrome protein, a novel effector for the GTPase CDC42Hs, is implicated in actin polymerization. Cell 84: 723734, 1996.[CrossRef][Web of Science][Medline]
44. Tang DD and Gunst SJ. Depletion of focal adhesion kinase by antisense depresses contractile activation of smooth muscle. Am J Physiol Cell Physiol 280: C874C883, 2001.
45. Tang DD and Gunst SJ. The small GTPase Cdc42 regulates actin polymerization and tension development during contractile stimulation of smooth muscle. J Biol Chem 279: 5172251728, 2004.
46. Tang DD and Tan J. Downregulation of profilin with antisense oligodeoxynucleotides inhibits force development during stimulation of smooth muscle. Am J Physiol Heart Circ Physiol 285: H1528H1536, 2003.
47. Tang DD, Turner CE, and Gunst SJ. Expression of non-phosphorylatable paxillin mutants in canine tracheal smooth muscle inhibits tension development. J Physiol 553: 2135, 2003.
48. Tang DD, Wu MF, Opazo Saez AM, and Gunst SJ. The focal adhesion protein paxillin regulates contraction in canine tracheal smooth muscle. J Physiol 542: 501513, 2002.
49. Uruno T, Liu J, Li Y, Smith N, and Zhan X. Sequential interaction of actin-related proteins 2 and 3 (Arp2/3) complex with neural Wiscott-Aldrich syndrome protein (N-WASP) and cortactin during branched actin filament network formation. J Biol Chem 278: 2608626093, 2003.
50. Welch MD and Mullins RD. Cellular control of actin nucleation. Annu Rev Cell Dev Biol 18: 247288, 2002.[CrossRef][Web of Science][Medline]
51. Yamaguchi H, Miki H, and Takenawa T. Two verprolin homology domains increase the Arp2/3 complex-mediated actin polymerization activities of N-WASP and WAVE1 C-terminal regions. Biochem Biophys Res Commun 297: 214219, 2002.[CrossRef][Web of Science][Medline]
52. Youn T, Kim SA, and Hai CM. Length-dependent modulation of smooth muscle activation: effects of agonist, cytochalasin, and temperature. Am J Physiol Cell Physiol 274: C1601C1607, 1998.
This article has been cited by other articles:
![]() |
S. Chen, R. Wang, Q.-F. Li, and D. D. Tang Abl knockout differentially affects p130 Crk-associated substrate, vinculin, and paxillin in blood vessels of mice Am J Physiol Heart Circ Physiol, August 1, 2009; 297(2): H533 - H539. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Tang p130 Crk-Associated Substrate (CAS) in Vascular Smooth Muscle Journal of Cardiovascular Pharmacology and Therapeutics, June 1, 2009; 14(2): 89 - 98. [Abstract] [PDF] |
||||
![]() |
L. A. Martinez-Lemus, M. A. Hill, and G. A. Meininger The Plastic Nature of the Vascular Wall: A Continuum of Remodeling Events Contributing to Control of Arteriolar Diameter and Structure Physiology, February 1, 2009; 24(1): 45 - 57. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wu, Y. Huang, B. P. Herring, and S. J. Gunst Integrin-linked kinase regulates smooth muscle differentiation marker gene expression in airway tissue Am J Physiol Lung Cell Mol Physiol, December 1, 2008; 295(6): L988 - L997. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. R. Kim, C. Gallant, P. C. Leavis, S. J. Gunst, and K. G. Morgan Cytoskeletal remodeling in differentiated vascular smooth muscle is actin isoform dependent and stimulus dependent Am J Physiol Cell Physiol, September 1, 2008; 295(3): C768 - C778. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Gunst and W. Zhang Actin cytoskeletal dynamics in smooth muscle: a new paradigm for the regulation of smooth muscle contraction Am J Physiol Cell Physiol, September 1, 2008; 295(3): C576 - C587. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Tang and Y. Anfinogenova Physiologic Properties and Regulation of the Actin Cytoskeleton in Vascular Smooth Muscle Journal of Cardiovascular Pharmacology and Therapeutics, June 1, 2008; 13(2): 130 - 140. [Abstract] [PDF] |
||||
![]() |
D. D. Tang Intermediate filaments in smooth muscle Am J Physiol Cell Physiol, April 1, 2008; 294(4): C869 - C878. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhang and S. J. Gunst Interactions of Airway Smooth Muscle Cells with Their Tissue Matrix: Implications for Contraction Proceedings of the ATS, January 1, 2008; 5(1): 32 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Anfinogenova, R. Wang, Q.-f. Li, A. M. Spinelli, and D. D. Tang Abl Silencing Inhibits CAS-Mediated Process and Constriction in Resistance Arteries Circ. Res., August 17, 2007; 101(4): 420 - 428. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. An, T. R. Bai, J. H. T. Bates, J. L. Black, R. H. Brown, V. Brusasco, P. Chitano, L. Deng, M. Dowell, D. H. Eidelman, et al. Airway smooth muscle dynamics: a common pathway of airway obstruction in asthma Eur. Respir. J., May 1, 2007; 29(5): 834 - 860. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Wang, Q.-F. Li, Y. Anfinogenova, and D. D. Tang Dissociation of Crk-associated substrate from the vimentin network is regulated by p21-activated kinase on ACh activation of airway smooth muscle Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L240 - L248. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Wang, Q. Li, and D. D. Tang Role of vimentin in smooth muscle force development Am J Physiol Cell Physiol, September 1, 2006; 291(3): C483 - C489. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ito, A. Majumdar, H. Kume, K. Shimokata, K. Naruse, K. R. Lutchen, D. Stamenovic, and B. Suki Viscoelastic and dynamic nonlinear properties of airway smooth muscle tissue: roles of mechanical force and the cytoskeleton Am J Physiol Lung Cell Mol Physiol, June 1, 2006; 290(6): L1227 - L1237. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhang and S. J. Gunst Dynamic association between {alpha}-actinin and {beta}-integrin regulates contraction of canine tracheal smooth muscle J. Physiol., May 1, 2006; 572(3): 659 - 676. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. P. Silveira, J. P. Butler, and J. J. Fredberg Length adaptation of airway smooth muscle: a stochastic model of cytoskeletal dynamics J Appl Physiol, December 1, 2005; 99(6): 2087 - 2098. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |