|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS
Indiana University School of Optometry, Bloomington, Indiana
Submitted 18 August 2004 ; accepted in final form 9 November 2004
| ABSTRACT |
|---|
|
|
|---|
corneal endothelium; sodium bicarbonate cotransporter; small interfering RNA; bicarbonate transport
Previous studies have shown that the uptake of HCO3 across the basolateral membrane of corneal endothelial cells occurs by a potent Na+-dependent, Cl-independent, DIDS-sensitive, and electrogenic Na+-2HCO3 cotransporter (5, 8, 21, 35). The activity of this cotransporter has a significant effect on intracellular pH (pHi), and it appears to be the major entry point for HCO3 flux across the endothelium (5, 8). Recent molecular cloning experiments have identified several Na+-dependent bicarbonate transporters (3, 10, 20, 23, 27, 31, 40). Two variants of NBC1 have been found: the kidney proximal tubule form of NBC (kNBC) (11, 30) has a 1:3 stoichiometry, and the pancreas form of NBC (pNBC) (1, 38) has a 1:2 stoichiometry. However, more recent studies have shown that the stoichiometry of either kNBC or pNBC can change depending on the cell type in which it is expressed (17).
Our previous studies have shown that human (35) and bovine corneal endothelial cells (36) express the pNBC isoform only. An earlier report (42), however, suggested that both pNBC and kNBC are expressed in human corneal endothelium. Immunohistochemistry studies in cultured and fresh bovine (36), rat (4), and human endothelium (35, 41) indicate that NBC1 exclusively locate to the basolateral membrane; however, a recent report (13) suggests apical expression as well. Whereas HCO3 uptake by a basolateral Na+-2HCO3 cotransporter is certain, the mechanism for apical efflux is not clear. Evidence has been provided suggesting that HCO3 can exit the endothelial cells through anion channels such as the cystic fibrosis transmembrane conductance regulator (CFTR) and Ca2+-activated Cl channels (CaCC) (13, 34, 45). In addition, CO2 diffusion and conversion to HCO3 by an apical membrane-bound extracellular carbonic anhydrase (CAIV) could also provide for net apical efflux (5, 6). If an apical NBC1 exists, then a 1Na+:3HCO3 stoichiometry could also potentially contribute to the apical efflux pathways (13).
In the present study we have investigated the role of NBC1 in HCO3 permeability and transendothelial HCO3 fluxes in cultured corneal endothelial cells by using a short interfering RNA (siRNA) knockdown approach. siRNA has significant advantages over pharmacological agents such as DIDS, which can block several anion transporters and channels. We found that siRNA transiently inhibited NBC1 expression, significantly reduced basolateral but not apical HCO3 permeability, and reduced non-steady-state basolateral-to-apical HCO3 flux and net transendothelial HCO3 flux, indicating that an apical NBC1, if present, does not significantly contribute to net HCO3 flux.
| MATERIALS AND METHODS |
|---|
|
|
|---|
siRNA transfection. Four sense and antisense oligonucleotides corresponding to the following NBC1 cDNAs were designed and blasted using the Ambion siRNA-targeting design tool and were purchased from Invitrogen: AAGTTTGAAGAAAAAGTGGAA (397417), AAAGAATATGTACTCAGGTGG (12091229), AATTGTGCCAAGTGAGTTCAA (22592279), and AAAAAGAAGGAGGATGAGAAG (30343054). Using these oligonucleotides, four siRNAs for NBC1 were synthesized using the Silencer siRNA construction kit from Ambion. A siCONTROL nontargeting siRNA (no known mammalian homology) was purchased from Dharmacom. Cells were transfected when 7080% confluent by using Oligofectamine (Invitrogen) according to the manufacturers protocol in the presence of siRNA. Cell-coated coverslips or Anodiscs in six-well plates were incubated with 1 ml of Opti-MEM I (GIBCO) containing siRNA for 4 h, followed by addition of 2 ml of standard DMEM with serum. T-25 flasks were treated with 2 ml of Opti-MEM I containing siRNA, followed by addition of 4 ml of culture medium. Medium was then changed every 2 days.
Immunoblotting.
BCEC were dissolved directly in 2% SDS sample buffer that contained protease inhibitors. The preparations were sonicated (Branson 250) briefly on ice and centrifuged at 10,000 g for 510 min. An aliquot of the supernatant was taken for protein concentration measurement using the Bradford assay (Bio-Rad). Samples (30 µg, not heated) were resolved on SDS-PAGE and transferred to polyvinylidene difluoride membrane (Bio-Rad). Blots were then probed with NBC1 polyclonal antibody (AB-3212, 1:2,000; Chemicon) or
-subunit of Na+-K+-ATPase antibody (1:1,000; Developmental Hybridoma Bank, Iowa University), and bound antibody was detected using enhanced chemiluminescence (ECL). The membrane was then stripped using Re-blot plus strong antibody stripping solution (Chemicon) to remove NBC1 antibody or Na+-K+-ATPase antibody, and blots were incubated with
-actin polyclonal antibody (1:10,000; Sigma) and developed using ECL. Films were scanned to produce digital images that were then assembled and labeled using Photoshop software.
Immunofluorescence. Cultured cells grown to confluence on coverslips were washed three to four times with warmed (37°C) PBS and fixed for 30 min in warmed PLP fixation solution (2% paraformaldehyde, 75 mM lysine, 10 mM sodium periodate, and 45 mM sodium phosphate, pH 7.4) on a rocker. After fixation, the cells were washed three to four times with PBS. Coverslips were then kept for 5 min in PBS that contained 1% SDS to unmask epitopes and washed three times in PBS. Cells were blocked for 1 h in PBS that contained 0.2% bovine serum albumin, 5% goat serum, 0.01% saponin, and 50 mM NH4Cl. Rabbit polyclonal NBC1 antibody and rat monoclonal ZO-1 antibody (MAB1520; Chemicon) diluted 1:100 together in PBS-goat serum (1:1) were added onto coverslips and incubated for 1 h at room temperature or overnight at 4°C. Coverslips were washed three times for 15 min in PBS that contained 0.01% saponin. Secondary antibodies conjugated to Alexa 488 (NBC1) (1:1,000; Molecular Probes) and Alexa Fluor 594 (ZO-1) (1:1,000; Molecular Probes) were applied for 1 h at room temperature. Coverslips were washed and then stained with 1 µg/ml Hoechst nuclear dye for 5 min. Coverslips were washed with water and mounted with Prolong antifade medium (Molecular Probes) according to the manufacturers instructions. Fluorescence was observed with a standard epifluorescence microscope equipped with a cooled charge-coupled device camera.
Microscope perfusion.
For measurement of pHi and HCO3 transendothelial flux, cells were cultured to confluence on 13-mm diameter, 0.2-µm Anodisc membranes. Anodiscs were placed in a double-sided perfusion chamber designed for independent perfusion of the apical and basolateral sides (9). The assembled chamber was placed on a water-jacketed (37°C) brass collar held on the stage of an inverted microscope (Nikon Diaphot 200) and viewed with a long-working-distance (2 mm) water-immersion objective (x40; Nikon). Apical and basolateral compartments were connected to hanging syringes that contained Ringer solution in a Plexiglas warming box (37°C) by using Phar-Med tubing. The flow of the perfusate (
0.5 ml/min) was achieved by gravity. Two independent eight-way valves were employed to select the desired perfusate for the apical and basolateral chambers. The composition of the standard HCO3-rich Ringer solution used throughout the study was (in mM) 150 Na+, 4 K+, 0.6 Mg2+, 1.4 Ca2+, 118 Cl, 1 HPO42, 10 HEPES, 28.5 HCO3, 2 gluconate, and 5 glucose, equilibrated with 5% CO2 and pH adjusted to 7.50 at 37°C. HCO3-free Ringer solution (pH 7.50) was prepared by equimolar substitution of NaHCO3 with sodium gluconate. Low-HCO3 Ringer solution (2.85 mM HCO3, pH 6.5) was prepared by replacing 25.65 mM NaHCO3 with sodium gluconate.
Measurement of HCO3 permeability.
BCEC cultured onto permeable Anodisc filters were loaded with the pH-sensitive fluorescent dye 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein (BCECF) by incubation in HCO3-free Ringer solution that contained 1 µM BCECF-AM at room temperature for 3060 min. Dye-loaded cells were then kept in Ringer solution for at least 30 min before use. Fluorescence excitation (495 and 440 nM) and data collection were obtained using a DeltaRam ratio fluorescence system (Photon Technology International, Monmouth Junction, NJ) controlled by Felix software. Fluorescence ratios were obtained at 1 s1 and were calibrated against pHi by using the high-potassium-nigericin technique (39). A calibration curve, which follows a pH titration equation, has been constructed for BCEC (7). HCO3 permeabilities of apical and basolateral membranes was determined using the constant-CO2 or constant-pH protocols as described previously (5). Briefly, in the constant-pH protocol, the HCO3-rich Ringer on the apical or basolateral side is replaced with a CO2- and HCO3-free Ringer of the same pH (HEPES buffered). Under this protocol, the initial pHi change is due to rapid CO2 efflux (increase in pHi), followed by HCO3 efflux (decrease in pHi). The maximum slope of the pHi decrease is taken as an estimate of HCO3 permeability. In the constant-CO2 protocol, the HCO3-rich Ringer (28.5 mM HCO3, 5% CO2, pH 7.5) is replaced with a low-HCO3 solution (2.85 mM HCO3, 5% CO2, pH 6.5). Under this protocol, the initial pHi change is predominantly due to HCO3 efflux, because there is no CO2 gradient. However, there is a pH gradient that can contribute (
15%) to the pHi decrease (5). Separate control experiments are performed in the absence of CO2/HCO3 to estimate this contribution.
Measurement of transendothelial HCO3 flux.
BCEC cultured onto permeable Anodisc filters, perfused in a double-sided chamber, were exposed to the standard HCO3-rich solution (5% CO2, 28.5 mM HCO3, pH 7.5) on the basolateral and apical sides at 37°C. A low-HCO3 solution (5% CO2/2.85 mM HCO3, pH 6.5) without HEPES buffer and containing 1 µM BCECF free acid was then quickly exchanged on one side of the chamber, and the exit tube on that side was clamped. The pH of the low-HCO3 solution was estimated (1 Hz) at
200 µm from the surface of the cells by measuring the fluorescence ratio of BCECF using the microscope fluorometer. The pH of the low-HCO3 solution rose from 6.5, and the initial rate of change over the first 20 s after clamping was estimated. After the initial pH change was recorded, HCO3-rich solution was returned, the chamber was flipped over on the microscope stage, and the same measurement procedure was repeated so that unidirectional fluxes in the apical-to-basolateral and basolateral-to-apical directions were obtained for each Anodisc. Separate control experiments also were performed with the same pH gradient across the cells in 1 mM HEPES but in the complete absence of CO2/HCO3. This pH change was used to estimate the initial OH flux (JOH) across the Anodisc, which was subtracted from the total flux calculated in the presence of HCO3. Each unidirectional HCO3 flux can be calculated as
![]() |
is the buffering capacity, which is 2.3 x [HCO3], or 6.55 mM/pH. JOH is the OH flux calculated in the same manner, where
is 0.5 mM/pH. The difference between basolateral-to-apical and apical-to-basolateral unidirectional fluxes is the net HCO3 flux. This is called non-steady-state flux because it was measured in the presence of a large HCO3 gradient.
Measurement of steady-state HCO3 flux.
BCEC cultured to confluence on 0.2-µm Anopore membrane tissue culture inserts were washed with DMEM containing 2% bovine calf serum. Then, 200 µl of this culture medium containing 1 µM BCECF free acid were placed on the apical side and 300 µl on the basolateral side. After 6 h in a standard 5% CO2 incubator at 37°C, cultures were placed in a large glove box equilibrated with 5% CO2 at 37°C. Samples (50 µl) were taken from the apical and basolateral sides with separate glass capillary tubes, and both ends were sealed with wax. The tubes were then taken to the microscope fluorometer, and the fluorescence ratio of BCECF was measured. The pH of each sample was then determined using a standard curve constructed by using solutions of known pH that had been placed within capillary tubes. The difference in pH was calculated as
pH = apical pH basolateral pH. A positive
pH indicates apical HCO3 accumulation.
| RESULTS |
|---|
|
|
|---|
|
|
Previous investigations have shown that HCO3 plays a key role in regulation of endothelial cell pHi and that NBC1 has an exclusive role in basolateral HCO3 transport (5, 8, 21, 35). These conclusions are based on experiments showing Na+-dependent and DIDS-sensitive, electrogenic HCO3 transport at the basolateral membrane (36). More recently, data have been presented suggesting that NBC1 is also present on the apical membrane and could have a role in transendothelial HCO3 flux (13). We used a constant-pH and a constant-CO2 protocol (5) to examine the apical and basolateral HCO3 permeabilities of cultured corneal endothelial cells. In the constant-pH protocol, the HCO3-rich Ringer is replaced with HCO3-free Ringer. The initial pHi change is due to rapid CO2 efflux. Although HCO3 efflux is occurring concomitantly, a decrease in pHi is not observed until the [CO2] has equilibrated (
15 s). The maximum rate of pHi decrease (averaged over 20 s) is taken as an indirect measure of HCO3 efflux. In the constant-CO2 protocol, the HCO3-rich Ringer (28.5 mM, pH 7.5) is replaced with low-HCO3 (2.85 mM, pH 6.5) Ringer. The initial pHi drop is predominantly from HCO3 efflux with a small (15%) contribution from H+ flux (5). Figure 3 shows that there was a sharp and rapid acidification due to HCO3 efflux (0.004467 ± 0.003187 pHi/s, n = 6) below the baseline after the initial alkalinization from CO2 efflux during the constant-pH protocol on the basolateral side; however, there was a significantly slower acidification (0.00073 ± 0.0000544 pHi/s, n = 6, P < 0.001) in cells that had been treated with 5 nM siRNA, indicating a more than sixfold decrease in basolateral HCO3 permeability. When the constant-CO2 protocol was used to remove the effect of CO2 fluxes, similar results were obtained. There was a significantly slower drop in pHi (0.000812 ± 0.0000918 pHi/s, n = 6, P < 0.001) in the siRNA-treated cells compared with the control cells (0.00506 ± 0.000338 pHi/s, n = 6). Conversely, there was no significant difference in the rate of pHi decrease on the apical side between the control and siRNA-treated cells, under either the constant-pH or constant-CO2 protocol. To test that the procedure of introducing foreign siRNA could have nonspecific effects on the measured HCO3 permeabilities, we transfected the siCONTROL siRNA into BCEC and measured pHi using the constant-CO2 protocol. Figure 4 shows that there was no significant difference in HCO3 permeabilities between control and siCONTROL siRNA-treated cells on either the basolateral or apical side. These results indicate that NBC1 plays a major role in the regulation of basolateral HCO3 permeability but not apical HCO3 permeability in corneal endothelial cells.
|
|
|
pH = apical pH basolateral pH) of the apical medium (+0.077 ± 0.018 pH unit). As a further control, cultures were treated with ouabain, which was expected to inhibit all Na+-dependent active transport processes and reduce the net pH change to zero. However, we found that 100 µM ouabain reversed the pH gradient to 0.073 ± 0.017 pH unit. NBC1 siRNA treatment caused a small alkalinization of the basolateral medium and a larger acidification of the apical medium, producing a net pH change of 0.098 ± 0.032, very similar to ouabain treatment. Figure 6 summarizes these data and indicates that NBC1 plays a major role in transendothelial HCO3 transport.
|
| DISCUSSION |
|---|
|
|
|---|
The RNA interference (RNAi) technique has been extended to a wide range of commonly used mammalian cells. RNAi is a highly specific form of posttranscriptional gene silencing using 21- to 23-nt siRNA molecules and has been shown to be an effective and specific method for examining functional roles of specific proteins (2, 14, 26). RNAi is very attractive for reducing NBC1 activity, because the primary pharmacological inhibiting agent DIDS is nonspecific and can block other anion transporters and channels. Moreover, the information obtained from selective application of DIDS is difficult to interpret. For example, slowing HCO3 efflux through a DIDS-sensitive apical transporter or channel should increase pHi. However, we have observed that apical application of DIDS produces a delayed reduction in pHi of corneal endothelial cells. This result suggests that little, if any, apical DIDS-sensitive HCO3 flux is present and that the drug was diffusing to the lateral membrane and inhibiting the basolateral Na+-2HCO3 cotransporter. In the present study, we have shown that transfection of siRNA designed to target NBC1 markedly attenuated the expression of NBC1 in BCEC. In general, it is best to use the lowest effective concentration of siRNA, because high doses can have nonspecific effects (32). We found that high concentrations of siRNA (
20 nM) showed some toxicity to the cells 4 days posttransfection, so we chose 515 nM siRNA as the optimal concentration throughout this study. Some studies have indicated that there is no significant nonspecific interference and degradation of endogenous mRNAs in mammalian cells subject to siRNA (12, 32); however, small mismatches with non-target genes can risk inhibiting expression of these genes (33). In addition to the posttranscriptional, sequence-specific effect mediated by the siRNA, the introduction of sequence nonspecific siRNA can sometimes have unpredictable effects on gene expression (14). To exclude these nonspecific effects, we used a siCONTROL nontargeting siRNA to determine whether the activation of the RNAi-induced silencing complex (RISC) could nonspecifically affect NBC1 expression or function. Figure 2 shows that siCONTROL siRNA did not have any effect on NBC1 expression, whereas NBC1 siRNA decreased NBC1 expression but did not affect Na+-K+-ATPase expression. We chose to examine Na+-K+-ATPase expression because inhibition of this protein could produce functional changes similar to NBC1 inhibition. Furthermore, transfection with siCONTROL had no functional effect on HCO3 permeabilities (Fig. 4). These results suggest that siRNA targeted to NBC1 is specific and effective in reducing expression in BCEC.
Basolateral, but not apical, HCO3 permeability was significantly affected by NBC1 siRNA treatment. This was determined by measuring the rate of pHi change after removal of HCO3 from apical or basolateral perfusion chambers. Removal of HCO3 and CO2 from the perfusing Ringer solution maintains solution pH (constant pH protocol); however, the pHi changes induced are confounded by initial CO2 efflux, which must be cleared before the rate of pHi decrease can be measured. The constant-CO2 protocol avoids confounding by CO2 fluxes but adds instead the reduced pH of the perfusate. Previously, we (37) showed that the pHi changes measured due to the bath pH changes contributed only
15% to the initial rate of pHi change. Nevertheless, both protocols showed similar sixfold drops in basolateral HCO3 permeability and no effect on apical permeability. The absence of an effect on apical HCO3 permeability is consistent with previous studies showing no change in apical HCO3 permeability under low-Na+ conditions (5) and an influx of Na+ upon removal of apical HCO3 (36). A siCONTROL siRNA was also transfected into endothelial cells, but this had no effect on HCO3 permeability in both basolateral and apical sides, indicating that NBC1 siRNA affects the basolateral permeability specifically.
The role of NBC1 in transendothelial HCO3 flux was measured under non-steady-state and steady-state conditions. Under non-steady-state conditions we introduced a large HCO3 gradient across the cell monolayer and measured initial unidirectional HCO3 fluxes, which were adjusted for OH fluxes. In control cultures, we found that basolateral-to-apical flux was significantly larger than apical-to-basolateral flux. Forskolin, which produces a rapid increase in cell cAMP concentration, has been shown to stimulate endothelial fluid transport (28) and activate an apical CFTR channel, leading to increased HCO3 permeability across the apical, but not basolateral, membrane (34, 46). We used forskolin as a positive control for the non-steady-state flux experiments. We found (Fig. 5) that 2 µM forskolin increased basolateral-to-apical but not apical-to-basolateral fluxes. The absence of a change in apical-to-basolateral fluxes in the presence of forskolin may be explained by a lack of significant change in driving force for HCO3 from the outside to the inside of cells across an apical membrane channel. When HCO3 is totally removed, the membrane potential depolarizes by only 5 mV (21). In apical-to-basolateral fluxes, basolateral HCO3 concentration is reduced from 28 to 2.85 mM. The initial intracellular HCO3 concentration is
20 mM (8), so there is a significant electrochemical gradient for HCO3 exit across the basolateral membrane, but initially there is no change in chemical gradient across the apical membrane and only a small change in electrical gradient that would still limit HCO3 influx across an apical channel. On the other hand, NBC1 siRNA inhibited basolateral-to-apical but not apical-to-basolateral fluxes, consistent with NBC1 contributing to a net HCO3 flux from the stroma to the anterior chamber (19, 25, 43).
Steady-state HCO3 flux was determined by measuring the relative pH change in apical and basolateral compartments in cultures bathed with identical HCO3-rich starting culture media. After 6 h of incubation, the apical side was relatively alkaline in control cultures. Similar types of measurements have been made in cultured endothelium using a pH-stat technique (13). Ouabain, which is expected to inhibit the accumulation of HCO3, actually produced a relative apical acidification. The reason for the apical acidification is not clear. One possibility is acidification by an apical lactate-H+ cotransporter (16), which would be unaffected by ouabains effect on Na+ gradients. siRNA treatment, which also was expected to inhibit apical compartment HCO3 accumulation, also produced a relative apical acidification consistent with the ouabain treatment and inhibition of net basolateral-to-apical HCO3 flux.
In summary, our results show conclusively that basolateral NBC1 (1Na+-2HCO3) has a significant role in transendothelial HCO3 flux. The basolateral Na+-2HCO3 cotransporter loads endothelial cells with HCO3. HCO3 flux from the cell across the apical membrane can be significantly stimulated by increasing cAMP concentration, consistent with an increase in apical HCO3 permeability through CFTR. However, we found no evidence for NBC1 on the apical membrane.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Ahn S, Nelson CD, Garrison TR, Miller WE, and Lefkowitz RJ. Desensitization, internalization, and signaling functions of
-arrestins demonstrated by RNA interference. Proc Natl Acad Sci USA 100: 17401744, 2003.
3. Amlal H, Burnham CE, and Soleimani M. Characterization of Na+/HCO3 cotransporter isoform NBC-3. Am J Physiol Renal Physiol 276: F903F913, 1999.
4. Bok D, Schibler MJ, Pushkin A, Sassani P, Abuladze N, Naser Z, and Kurtz I. Immunolocalization of electrogenic sodium-bicarbonate cotransporters pNBC1 and kNBC1 in the rat eye. Am J Physiol Renal Physiol 281: F920F935, 2001.
5. Bonanno J, Guan Y, Jelamskii S, and Kang X. Apical and basolateral CO2-HCO3 permeability in cultured bovine corneal endothelial cells. Am J Physiol Cell Physiol 277: C545C553, 1999.
6. Bonanno JA. Identity and regulation of ion transport mechanisms in the corneal endothelium. Prog Retin Eye Res 22: 6994, 2003.[CrossRef][Web of Science][Medline]
7. Bonanno JA and Giasson C. Intracellular pH regulation in fresh and cultured bovine corneal endothelium. I. Na/H exchange in the absence and presence of HCO3. Invest Ophthalmol Vis Sci 33: 30583067, 1992.
8. Bonanno JA and Giasson C. Intracellular pH regulation in fresh and cultured bovine corneal endothelium. II. Na:HCO3 cotransport and Cl/HCO3 exchange. Invest Ophthalmol Vis Sci 33: 30683079, 1992.
9. Bonanno JA, Guan Y, Xiao J, and Srinivas SP. Reevaluation of Cl/HCO3 exchange in cultured bovine corneal endothelial cells. Invest Ophthalmol Vis Sci 39: 27132722, 1998.
10. Burnham CE, Amlal H, Wang Z, Shull GE, and Soleimani M. Cloning and functional expression of a human kidney Na+:HCO3 cotransporter. J Biol Chem 272: 1911119114, 1997.
11. Burnham CE, Flagella M, Wang Z, Amlal H, Schull GE, and Soleimani M. Cloning, renal distribution, and regulation of the rat Na+-HCO3 cotransporter. Am J Physiol Renal Physiol 274: F1119F1126, 1998.
12. Chi JT, Chang HY, Wang NN, Chang DS, Dunphy N, and Brown PO. Genomewide view of gene silencing by small interfering RNAs. Proc Natl Acad Sci USA 100: 63436346, 2003.
13. Diecke FP, Wen Q, Sanchez JM, Kuang K, and Fischbarg J. Immunocytochemical localization of Na+-HCO3 cotransporters and carbonic anhydrase dependence of fluid transport in corneal endothelial cells. Am J Physiol Cell Physiol 286: C1434C1442, 2004.
14. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, and Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411: 494498, 2001.[CrossRef][Medline]
15. Fischbarg J and Lim J. Role of cations, anions, and carbonic anhydrase in fluid transport across rabbit corneal endothelium. J Physiol 241: 647675, 1974.
16. Giasson C and Bonanno JA. Facilitated transport of lactate by rabbit corneal endothelium. Exp Eye Res 59: 7381, 1994.[CrossRef][Web of Science][Medline]
17. Gross E, Hawkins K, Abuladze N, Pushkin A, Cotton CU, Hopfer U, and Kurtz I. The stoichiometry of the electrogenic sodium bicarbonate cotransporter NBC1 is cell-type dependent. J Physiol 531: 597603, 2001.
18. Hodson S. The regulation of corneal hydration by a salt pump requiring the presence of sodium and bicarbonate ions. J Physiol 236: 271302, 1974.[Web of Science][Medline]
19. Hodson S and Miller F. The bicarbonate ion pump in the endothelium which regulates the hydration of rabbit cornea. J Physiol 263: 563577, 1976.
20. Ishibashi K, Sasaki S, and Marumo F. Molecular cloning of a new sodium bicarbonate cotransporter cDNA from human retina. Biochem Biophys Res Commun 246: 535538, 1998.[CrossRef][Web of Science][Medline]
21. Jentsch T, Keller S, Koch M, and Wiederholt M. Evidence for coupled transport of bicarbonate and sodium in cultured bovine corneal endothelial cells. J Membr Biol 81: 189204, 1984.[CrossRef][Web of Science][Medline]
22. Kuang K, Xu M, Koniarek J, and Fischbarg J. Effects of ambient bicarbonate, phosphate and carbonic anhydrase inhibitors on fluid transport across rabbit endothelium. Exp Eye Res 50: 487493, 1990.[CrossRef][Web of Science][Medline]
23. Kurtz I, Petrasek D, and Tatishchev S. Molecular mechanisms of electrogenic sodium bicarbonate cotransport: structural and equilibrium thermodynamic considerations. J Membr Biol 197: 7790, 2004.[CrossRef][Web of Science][Medline]
24. MacCallum D, Lillie J, Scaletta L, Occhino J, Frederick W, and Ledbetter S. Bovine corneal endothelium in vitro. Exp Cell Res 139: 113, 1982.[CrossRef][Web of Science][Medline]
25. Mayes KR and Hodson S. Local osmotic coupling to the active trans-endothelial bicarbonate flux in the rabbit cornea. Biochim Biophys Acta 514: 286293, 1978.[Medline]
26. McManus MT and Sharp PA. Gene silencing in mammals by small interfering RNAs. Nat Rev Genet 3: 737747, 2002.[CrossRef][Web of Science][Medline]
27. Pushkin A, Abuladze N, Newman D, Lee I, Xu G, and Kurtz I. Two C-terminal variants of NBC4, a new member of the sodium bicarbonate cotransporter family: cloning, characterization, and localization. IUBMB Life 50: 1319, 2000.[Web of Science][Medline]
28. Riley M, Winkler B, Starnes C, and Peters M. Adenosine promotes regulation of corneal hydration through cyclic adenosine monophosphate. Invest Ophthalmol Vis Sci 37: 110, 1996.
29. Riley MV, Winkler BS, Czajkowski CA, and Peters MI. The roles of bicarbonate and CO2 in transendothelial fluid movement and control of corneal thickness. Invest Ophthalmol Vis Sci 36: 103112, 1995.
30. Romero MF, Fong P, Berger UV, Hediger MA, and Boron WF. Cloning and functional expression of rNBC, an electrogenic Na+-HCO3 cotransporter from rat kidney. Am J Physiol Renal Physiol 274: F425F432, 1998.
31. Romero MF, Hediger MA, Boulpaep EL, and Boron WF. Expression cloning and characterization of a renal electrogenic Na+/HCO3 cotransporter. Nature 387: 409413, 1997.[CrossRef][Medline]
32. Semizarov D, Frost L, Sarthy A, Kroeger P, Halbert DN, and Fesik SW. Specificity of short interfering RNA determined through gene expression signatures. Proc Natl Acad Sci USA 100: 63476352, 2003.
33. Snove O Jr and Holen T. Many commonly used siRNAs risk off-target activity. Biochem Biophys Res Commun 319: 256263, 2004.[CrossRef][Web of Science][Medline]
34. Sun XC and Bonanno JA. Expression, localization, and functional evaluation of CFTR in bovine corneal endothelial cells. Am J Physiol Cell Physiol 282: C673C683, 2002.
35. Sun XC and Bonanno JA. Identification and cloning of the Na/HCO3 cotransporter (NBC) in human corneal endothelium. Exp Eye Res 77: 287295, 2003.[CrossRef][Web of Science][Medline]
36. Sun XC, Bonanno JA, Jelamskii S, and Xie Q. Expression and localization of NaHCO3 cotransporter in bovine corneal endothelium. Am J Physiol Cell Physiol 279: C1648C1655, 2000.
37. Sun XC, Zhai CB, Cui M, Chen Y, Levin LR, Buck J, and Bonanno JA. HCO3-dependent soluble adenylyl cyclase activates cystic fibrosis transmembrane conductance regulator in corneal endothelium. Am J Physiol Cell Physiol 284: C1114C1122, 2003.
38. Thevenod F, Roussa E, Schmitt BM, and Romero MF. Cloning and immunolocalization of a rat pancreatic Na+ bicarbonate cotransporter. Biochem Biophys Res Commun 264: 291298, 1999.[CrossRef][Web of Science][Medline]
39. Thomas J, Buchsbaum R, Zimniak A, and Racker E. Intracellular pH measurements in Ehrlich ascites tumor cells utilizing spectroscopic probes generated in situ. Biochemistry 18: 22102218, 1979.[CrossRef][Medline]
40. Tsuganezawa H, Kobayashi K, Iyori M, Araki T, Koizumi A, Watanabe S, Kaneko A, Fukao T, Monkawa T, Yoshida T, Kim DK, Kanai Y, Endou H, Hayashi M, and Saruta T. A new member of the HCO3 transporter superfamily is an apical anion exchanger of
-intercalated cells in the kidney. J Biol Chem 276: 81808189, 2001.
41. Usui T, Hara M, Satoh H, Moriyama N, Kagaya H, Amano S, Oshika T, Ishii Y, Ibaraki N, Hara C, Kunimi M, Noiri E, Tsukamoto K, Inatomi J, Kawakami H, Endou H, Igarashi T, Goto A, Fujita T, Araie M, and Seki G. Molecular basis of ocular abnormalities associated with proximal renal tubular acidosis. J Clin Invest 108: 107115, 2001.[CrossRef][Web of Science][Medline]
42. Usui T, Seki G, Amano S, Oshika T, Miyata K, Kunimi M, Taniguchi S, Uwatoko S, Fujita T, and Araie M. Functional and molecular evidence for Na+-HCO3 cotransporter in human corneal endothelial cells. Pflügers Arch 438: 458462, 1999.[CrossRef][Web of Science][Medline]
43. Wigham C and Hodson S. Bicarbonate and the trans-endothelial short-circuit current of human cornea. Curr Eye Res 1: 285290, 1981.[Web of Science][Medline]
44. Winkler B, Riley M, Peters M, and Williams F. Chloride is required for fluid transport by the rabbit corneal endothelium. Am J Physiol Cell Physiol 262: C1167C1174, 1992.
45. Xie Q, Zhang Y, Zhai C, and Bonanno JA. Calcium influx factor from cytochrome P-450 metabolism and secretion-like coupling mechanisms for capacitative calcium entry in corneal endothelial cells. J Biol Chem 277: 1655916566, 2002.
46. Zhang Y, Xie Q, Sun XC, and Bonanno JA. Enhancement of HCO3 permeability across the apical membrane of bovine corneal endothelium by multiple signaling pathways. Invest Ophthalmol Vis Sci 43: 11461153, 2002.
This article has been cited by other articles:
![]() |
X. C. Sun, J. Li, M. Cui, and J. A. Bonanno Role of Carbonic Anhydrase IV in Corneal Endothelial HCO3- Transport Invest. Ophthalmol. Vis. Sci., March 1, 2008; 49(3): 1048 - 1055. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |