Am J Physiol Cell Physiol Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 288: C366-C376, 2005. First published October 6, 2004; doi:10.1152/ajpcell.00354.2004
0363-6143/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/2/C366    most recent
00354.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tipparaju, S. M.
Right arrow Articles by Bhatnagar, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tipparaju, S. M.
Right arrow Articles by Bhatnagar, A.

MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS

Differential regulation of voltage-gated K+ channels by oxidized and reduced pyridine nucleotide coenzymes

Srinivas M. Tipparaju,1 Nina Saxena,2 Si-Qi Liu,1 Rajiv Kumar,3 and Aruni Bhatnagar1

1Division of Cardiology, Department of Medicine, University of Louisville, Louisville, Kentucky; and Departments of 2Physiology and 3Pediatrics, Emory University School of Medicine, Atlanta, Georgia

Submitted 20 July 2004 ; accepted in final form 4 October 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The activity of the voltage-sensitive K+ (Kv) channels varies as a function of the intracellular redox state and metabolism, and several Kv channels act as oxygen sensors. However, the mechanisms underlying the metabolic and redox regulation of these channels remain unclear. In this study we investigated the regulation of Kv channels by pyridine nucleotides. Heterologous expression of Kv{alpha}1.5 in COS-7 cells led to the appearance of noninactivating currents. Inclusion of 0.1–1 mM NAD+ or 0.03–0.5 mM NADP+ in the internal solution of the patch pipette did not affect Kv currents. However, 0.5 and 1 mM NAD+ and 0.1 and 0.5 mM NADP+ prevented inactivation of Kv currents in cells transfected with Kv{alpha}1.5 and Kv{beta}1.3 and shifted the voltage dependence of activation to depolarized potentials. The Kv{beta}-dependent inactivation of Kv{alpha} currents was also decreased by internal pipette perfusion of the cell with 1 mM NAD+. The Kv{alpha}1.5-Kv{beta}1.3 currents were unaffected by the internal application of 0.1 mM NADPH or 0.1 or 1 mM NADH. Excised inside-out patches from cells expressing Kv{alpha}1.5-Kv{beta}1.3 showed transient single-channel activity. The mean open time and the open probability of these currents were increased by the inclusion of 1 mM NAD+ in the perfusate. These results suggest that NAD(P)+ prevents Kv{beta}-mediated inactivation of Kv currents and provide a novel mechanism by which pyridine nucleotides could regulate specific K+ currents as a function of the cellular redox state [NAD(P)H-to-NAD(P)+ ratio].

Shaker potassium ion channels; Kv{beta} subunits; patch clamp; aldo-keto reductase; COS-7 cells


THE ACTIVITY of the voltage-sensitive K+ (Kv) channels sets the resting membrane potential and regulates impulse generation in excitable cells (20, 54). In cardiac tissue the extent of activation of the Kv currents determines the duration and waveform of the action potential (9, 11, 33), and in neurons it regulates both action potential firing and neurotransmitter release (20, 21, 54). In addition, Kv channels also play a key role in T-cell activation (25), cell volume regulation (20, 21), mitogenesis (12), and apoptosis (8, 22, 34). In carotid body chemoreceptors (42), adrenomedullary chromaffin cells (46), and ductus arteriosus (31), Kv channels participate in oxygen sensing, and it has been shown (4, 10, 56) that inhibition of Kv currents in small resistance pulmonary arteries by hypoxia mediates pulmonary vasoconstriction (hypoxic pulmonary vasoconstriction, HPV). Although the mechanisms by which Kv currents respond to hypoxia remain unclear, accumulating evidence suggests that Kv currents may be regulated by changes in intermediary metabolism. This is supported by the observation that in pulmonary artery myocytes inhibition of glycolysis by deoxyglucose or mitochondrial uncoupling by carbonyl cyanide p-trifluoromethoxyphenylhydrazone simulates hypoxic inhibition of Kv currents (56), whereas inhibition of pyruvate kinase prevents chronic hypoxic pulmonary hypertension in rats (30). Collectively, these data suggest that Kv channels are sensitive to changes in cell metabolism and redox state and that this sensitivity could mediate hypoxic changes in Kv currents. Nevertheless, it remains unclear how changes in oxygen concentration or metabolic activity affect Kv channel activity.

The Kv proteins contain multiple cysteine residues that could respond to redox changes in the local environment. In agreement with this view, it has been shown that sulfhydryl reagents affect native Kv conductances (35, 40). Additionally, the redox sensitivity of Kv channels may be due to their ability to associate with ancillary {beta}-subunits. The Kv{beta} proteins are members of the aldo-keto reductase (AKR) superfamily (27, 28, 51), and as shown in previous studies by our group (26), they bind pyridine nucleotides with high affinity. These proteins associate with the cytoplasmic domain of specific {alpha}-proteins in homotetrameric assembly (27, 51, 54). They affect the voltage dependence of Kv currents, induce inactivation in noninactivating currents such as those due to Kv1.1 and Kv1.5, and accelerate inactivation of self-inactivating currents, e.g., those generated by Kv1.4 (19, 27, 39, 51). Thus the oxidoreductase properties of Kv{beta} proteins could affect the nature of their interactions with Kv{alpha} and could underlie the redox and metabolic sensitivity of native Kv currents.

We therefore examined how reduced and oxidized pyridine nucleotides affect Kv{alpha}1.5 currents in a heterologous expression system. A prototypical member of the Shaker family, Kv1.5 is the molecular correlate of the ultrarapid delayed-rectifier K+ current (Ikur) in the human atrium (14) and is expressed at high density in resistance pulmonary arteries (55). Mice lacking Kv1.5 display impaired HPV (3), and a decrease in the expression of Kv{alpha}1.5 is associated with pulmonary hypertension (48). Recently, Kv{alpha}1.5 gene therapy has been shown to restore oxygen-sensitive K+ current and reduce pulmonary vascular resistance (37), indicating that Kv1.5 may be an important component of vascular oxygen sensing and a link between excitability and metabolism. Our results show that, although Kv{alpha}1.5 expressed alone in COS-7 cells was insensitive to changes in pyridine nucleotides, reduced and oxidized pyridine nucleotides differentially regulated inactivation of the currents generated by the Kv{alpha}1.5-{beta}1.3 complex. On the basis of these data, we speculate that regulation by the redox state of pyridine coenzymes may be one mechanism linking metabolic activity to native Kv currents.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Transfection of COS cells. The full-length cDNAs encoding rat Kv{alpha}1.5 in a pNKS2 vector and human Kv{beta}1.3 in a pBluescript(KS+) vector were kindly provided by Dr. M. M. Tamkun (Colorado State University, Fort Collins, CO). A mammalian expression vector (pIRS-hrGFP-1; Stratagene) containing green fluorescent protein (GFP) as a reporter gene and a FLAG tag at the COOH terminal of the gene of interest was used as a transfection vector. To insert the genes in the expression vector, two pairs of PCR primers were designed and commercially synthesized, GCCCCCTGCGGCCGCACCATGGAGATCTCC (forward) and CAAATCTGTTTCACGGATCCTGTCCAGACAGAG (reverse) for Kv{alpha}1.5 and CTTCTCTGAAAGCGGCCGCGATGCTGGCAGCCCGGACAG (forward) and GCCTTATGATCTATGGATCCTCTTGCTGTAGGG (reverse) for Kv{beta}1.3. After PCR, the amplified genes with a specially designed terminus at both ends were ligated into pGEM-T (Promega) vector and further reinserted into pIRS-hrGFP-1 after restriction digestion (5'-NotI/3'-BamHI) and DNA fragment purification. The vectors were finally confirmed by DNA sequence analysis and labeled as pGFP-Kv{alpha} and pGFP-Kv{beta}, respectively. pGFP-Kv{alpha} alone or with pGFP-Kv{beta} was transiently expressed in COS-7 cells with Lipofectamine (Invitrogen). The cells were maintained in DMEM containing 10% FBS at 37°C under a 5% CO2-95% air atmosphere and transfected when they were 60% confluent. For each 35-mm tissue culture dish we used 2 µg of each vector at a DNA-to-Lipofectamine ratio of 1:1, and the cells were exposed to the vector-Lipofectamine mixture for 4 h in serum-free DMEM at 37°C in a humidified CO2 atmosphere. The transfected cells were observed under a fluorescence microscope to monitor protein expression, harvested 48 h after transfection by brief trypsinization, washed twice with serum-free DMEM, and stored at room temperature for recording of membrane currents within 12 h.

For Western blot analysis, COS-7 cells were grown to 60% confluence and were transfected with pGFP-Kv{alpha}1.5 and/or pGFP-Kv{beta}1.3 as indicated. After 48 h, the cells were scraped and lysed by sonication. The membrane and cytosolic fractions were obtained by ultracentrifugation at 120,000 g for 1 h. Cytoplasmic and membrane proteins were separated on SDS-PAGE, and Western blots were developed with a polyclonal anti-FLAG antibody and chemiluminescence detection. The expression of Kv{beta}1.3 protein was examined with a polyclonal antibody (rabbit anti-human Kv{beta}1.3) against full-length Kv{beta}1.3.

Whole cell current measurements. The cells were perfused at 2.5 ml/min in a recording chamber with normal Tyrode solution containing (in mM) 135 NaCl, 1.1 MgCl2, 1.8 CaCl2, 5.4 KCl, 10 HEPES, and 10 glucose, pH 7.4, at room temperature. Voltage-clamp experiments were performed in the whole cell configuration as described previously (23), using patch pipettes filled with an internal solution containing (in mM) 100 K-aspartate, 30 KCl, 1 MgCl2, 5 HEPES, 5 EGTA, 5 Mg-ATP, and 5 Na2-creatine phosphate, pH 7.2. The transfected cells were observed for green fluorescence with a Olympus IX51 microscope with an epifluorescence attachment. The currents were recorded only from cells showing GFP fluorescence, with an excitation wavelength of 490 nm and an emission wavelength of 540 nm. For internal perfusion, a 2PK+ pipette perfusion system (Adams and List) with a perfusible pipette holder in which a polyethylene tube with quartz capillary (to reduce electrical noise) at the ends ran from a reservoir of a multireservoir carousel to the very end of the pipette tip (within 100 µm) as described previously (23). The cells were patched with the perfusible pipette containing normal internal solution with no pyridine nucleotides. After basal current was recorded, the internal solution was switched to a solution containing 1 mM NAD+ by switching the tube to the reservoir containing NAD+ internal solution and applying positive pressure in the pressure vessel, which was balanced by negative pressure at the outflow of the pipette holder.

Excised-patch recordings. Single-channel currents were measured in excised inside-out patches from COS-7 cells expressing Kv{alpha} or Kv{alpha} + Kv{beta}. For single-channel recording, cells were kept in 35-mm culture dishes in the incubator to allow them to adhere to the bottom of the dish. The cells were washed with patch pipettes in bath solution containing (in mM) 135 NaCl, 1.1 MgCl2, 1.8 CaCl2, 5.4 KCl, 10 HEPES, and 10 glucose, pH 7.2. Patch pipettes were filled with the same bath solution. With this solution the pipette resistance was 5–10 M{Omega}. After formation of a gigaohm seal (>50 G{Omega}), the bath solution was replaced with the test solution containing (in mM) 100 K-aspartate, 30 KCl, 1 MgCl2, 5 HEPES, 5 EGTA, 5 Mg-ATP, and 5 Na2-creatine phosphate, pH 7.2, and the pipette was pulled away to form an inside-out excised-patch configuration. Patches were hyperpolarized to –80 mV for 800 ms from the holding potential of –60 mV and then depolarized to voltages ranging from –20 to +90 mV for durations ranging from 4 to 10 s, followed by repolarization to –80 mV for 800 ms and then a return to the holding potential of –60 mV. After basal channel activity was recorded in the excised patch for 5–7 min, the bath solution was exchanged with the solution containing NAD+ or NADPH and single-channel activity was recorded.

Data acquisition and analysis. For whole cell recordings, the currents were filtered at 2 kHz, acquired at 4–10 kHz, and stored digitally. Single-channel currents were sampled at 2 kHz and filtered at 1.1 kHz. Whole cell membrane capacitance was determined by compensating the capacitive current transient. For measuring current-voltage relationships, the cells were depolarized for 800 ms from a holding potential of –80 mV to potentials ranging from –60 mV to +60 mV in 10-mV voltage steps at 0.1 Hz. The peak outward current (Ipeak), measured as the difference between the peak current amplitude and the zero current, and the steady-state current (Iss), measured as the difference between the current amplitude at the end of the 800-ms depolarization pulse and the zero current, were normalized by dividing the currents by the peak current obtained at +50 mV for each cell. The extent of current inactivation was quantified by calculating percent inactivation as [1 – (Iss/Ipeak)] x 100. The time course of decay was calculated with the relationship:

(1)
where I(t) is current at time t, Ioff is offset current, Ifast and Islow are fast and slow currents, respectively, and {tau}fast and {tau}slow are fast and slow current decay time constants, respectively. When the current decay had no fast inactivation phase, it was fitted by a monoexponential function. The voltage dependence of current activation was obtained from the peak amplitude of deactivating tail current measured just after the decay of the capacitive transient at –30 mV because the driving force is constant under these conditions. The tail currents were normalized to peak tail current amplitude at +50 mV, plotted against the potential of the depolarizing step, and analyzed with the Boltzmann function:

(2)
where V is membrane voltage, Vh represents the voltage at which 50% of the channels are open, and k represents the slope factor. To investigate the voltage dependence of inactivation, a two-pulse protocol was used. The cell was depolarized to conditioning potentials ranging from –70 to +60 mV in 10-mV steps for 1 s from a holding potential of –80 mV, followed by a 10-ms step to –80 mV and a 800-ms test step to +50 mV. The mean normalized values of Ipeak were plotted against prepulse potential, and the data were analyzed with Eq. 2.

Single-channel data were acquired with Clampex version 5.5 of pCLAMP and were analyzed with Fetchan version 6. To record unitary currents, the excised patches were depolarized to different potentials ranging from –20 mV to +90 mV in 20-mV steps for a 7-s duration after a 700-ms conditioning pulse at –80 mV from a holding potential of –60 mV. Outward currents are noted as upward transitions. Current amplitude histograms were made from stable and continuous recordings of >6–10 s at +80 mV. The open probability (Po) was used to measure the channel activity within a patch and was determined for the entire duration of the test pulse. NPo, the product of the number of channels and the open probability, was calculated by relative area under an all-points histogram and expressed as:

(3)
where A is the area under the Gaussian curve, N is the total number of functional channels in a patch, i is the number of channels, and Po is the open probability of an individual channel in a patch.

Statistical analysis. Data are presented as means ± SE. Data were analyzed with SigmaStat with paired or unpaired t-test or ANOVA followed by Student-Newman-Keuls test for all pairwise comparisons. P values <0.05 were considered significant.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Whole cell current measurements. Transfection of COS-7 cells with either pGFP-Kv{alpha}1.5 or pGFP-Kv{beta}1.3 resulted in a robust expression of Kv{alpha}1.5 and Kv{beta}1.3, respectively, as visualized by anti-FLAG antibody. No immunopositive bands were observed in Western blots developed from untransfected COS-7 cell extracts with anti-Kv{beta} antibody, indicating that these cells do not express detectable levels of Kv{beta}1.3 (data not shown). No significant outward currents were recorded in cells transfected with the empty vector (Fig. 1A), indicating that there are no measurable endogenous Kv currents in these cells. In contrast, cells transfected with Kv{alpha}1.5 showed rapidly activating outward currents (Fig. 1B). These currents showed minimal inactivation (4.3 ± 0.9%, n = 10; Table 1) and were followed by a decaying outward tail current. In cells transfected with Kv{alpha}1.5+{beta}1.3, outward currents displayed rapid but incomplete inactivation (Fig. 1C). The activation of Kv currents was faster in cells expressing Kv{alpha}1.5+{beta}1.3 (time to peak activation = 3.1 ± 0.6 ms; n = 10) compared with cells expressing Kv{alpha}1.5 alone (16.7 ± 3.8 ms, n = 10; P < 0.05). The overall magnitude of Kv{alpha}1.5 currents was highly variable from one cell to another and was not significantly altered on coexpression of Kv{beta} (Table 1).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1. Outward current recordings from transfected COS-7 cells. The cells were transfected with empty vector alone (A), with voltage-sensitive K+ channel (Kv){alpha}1.5 cDNA (B), or with Kv{alpha}1.5+Kv{beta}1.3 (C). Whole cell currents were elicited on depolarization for 800 ms in 10-mV incremental step pulses from a holding potential of –80 to 60 mV as described in MATERIALS AND METHODS. Currents were measured by patch pipettes containing control internal solution and are normalized to cell capacitance. Each set of current traces is representative of recordings from 10 different cells.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Pyridine coenzyme-dependent regulation of Kv currents in COS-7 cells

 
No differences in the voltage dependence of Ipeak were observed between cells expressing Kv{alpha}1.5 and Kv{alpha}1.5+{beta}1.3 (data not shown). With Kv{alpha}1.5 alone, the voltage dependence of Iss and Ipeak were similar. In the presence of Kv{beta}1.3, Iss was significantly decreased at voltages greater than +10 mV (Fig. 2A). The percent inactivation of Kv{alpha} currents was enhanced on coexpression with Kv{beta} (Fig. 1C). In cells expressing Kv{alpha}1.5+{beta}1.3, the extent of Kv current inactivation at +50 mV was 39.6 ± 4% (Table 2) vs. 4.3 ± 0.9% (Table 1) with Kv{alpha}1.5 alone (Fig. 2B). Of the total inactivation in Kv{alpha}1.5+{beta}1.3-expressing cells, 56 ± 4% was contributed by the fast component. The two exponents associated with fast and slow inactivation were 6.5 ± 0.7 and 410 ± 48 ms (Table 2), respectively, in cells expressing Kv{alpha}1.5+{beta}1.3 compared with only one rate constant of 1,946 ± 621 ms with Kv{alpha}1.5 alone (Table 1). The voltage dependence of Kv channel activation was shifted to hyperpolarizing potentials (Vh = –18.8 ± 1.7 mV) in cells expressing Kv{alpha}1.5+{beta}1.3 compared with Kv{alpha}1.5 alone (Vh = –3.4 ± 2 mV; Fig. 2C, Tables 1 and 2). The voltage dependence of inactivation as well as the tail current inactivation time constant of Kv currents were not significantly affected by Kv{beta}1.3. The voltage for half-maximal inactivation of Kv current and k were –17.8 ± 11.8 and 33 ± 5 mV, respectively, in cells expressing Kv{alpha}1.5 alone vs. –17.1 ± 2.4 and 7.2 ± 0.9 mV, respectively, in cells expressing Kv{alpha}1.5+{beta}1.3 (Fig. 2C). The Kv{beta}1.3-induced inactivation and a hyperpolarizing shift in the activation midpoint of the Kv currents (Table 2) are in agreement with previous reports that Kv{beta}1 imparts inactivation to noninactivating currents generated by the Kv{alpha}1 family (27, 47) and suggest high-affinity interaction between the two proteins.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 2. Effects of pyridine nucleotides on kinetics of the Kv current recorded from transfected COS-7 cells. The voltage dependence of outward currents is shown for normalized steady-state current (Iss; A), % inactivation (B), Kv current activation (C), and voltage dependence of inactivation (D). The currents were obtained from cells expressing Kv{alpha}1.5 alone or Kv{alpha}1.5+{beta}1.3 and patched with pipettes containing either the control internal solution or solution containing 0.1 mM NADH, 1 mM NAD+, 0.1 mM NADPH, or 0.5 mM NADP+. Data points represent means ± SE for the number of measurements given in Tables 1 and 2.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Concentration-dependent effects of NAD+ and NADP+ on Kv{alpha}-{beta} currents

 
Kv regulation by pyridine nucleotides. To examine the role of pyridine coenzymes, we included these nucleotides in the patch pipette solution. Neither NADP+ nor NADPH affected the noninactivating currents in cells expressing Kv{alpha}1.5 alone (Fig. 3). However, in cells coexpressing Kv{alpha} and Kv{beta}, the percent inactivation of currents was significantly less (14.8 ± 3%; Fig. 4A and Table 1) when patched with 500 µM NADP+ than with the control internal solution (39.6 ± 4%), and the voltage dependence of Kv current activation was shifted to depolarized potentials (Vh = –0.1 ± 0.3 mV) compared with –18.8 ± 1.7 mV for control cells (Table 2; Fig. 2C). In contrast to NADP+, no significant changes were observed in Kv current (Fig. 3B), normalized Iss (Fig. 2A), percent inactivation (Fig. 2B), or voltage dependence of Kv channel activation (Fig. 2C) with internal application of 100 µM NADPH (Table 2). Contribution of the fast component of inactivation (56 ± 7.3%) to total inactivation was not altered by NADPH. The voltages for the half-maximal inactivation of Kv currents (Fig. 2D) measured after internal application of NADPH (–18 ± 3 mV) and NADP+ (–12 ± 4 mV) were not significantly different from control (–17 ± 2 mV). Effects of 1 mM NAD+ on different parameters were even more prominent than those of 500 µM NADP+ (Table 2). Results obtained with 0.1 mM NADH and 1 mM NAD+ were similar to those obtained with 100 µM NADPH and 500 µM NADP+, respectively (Table 2, Fig. 2). Currents recorded from cells patched with 1 mM NADH in the pipette displayed 45.5 ± 1.7% inactivation after 800 ms, with a half-activation potential of –22.5 ± 0.9 mV (n = 3). These values are not different from control currents recorded with no pyridine nucleotide in the pipette (Table 2), indicating that increasing the concentration of reduced pyridine nucleotide to 1 mM does not affect inactivation.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 3. Differential regulation of Kv currents by oxidized and reduced pyridine nucleotides. Whole cell outward membrane currents were recorded from cells from COS-7 cells that were transfected with either Kv{alpha}1.5 alone or with Kv{alpha}1.5+{beta}1.3. The cells were removed from culture and were patched with pipettes containing either 100 µM NADPH or 500 µM NADP+. Membrane currents recorded in the presence of NADP+ from cells expressing Kv{alpha} (A) or Kv{alpha}+{beta} (B) and currents recorded in the presence of NADPH from cells expressing Kv{alpha} (C) or Kv{alpha}+{beta} (D) are shown. Each set of recordings is representative of similar recordings from 6–10 cells.

 


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 4. Concentration-dependent effects of NAD+ and NADP+ on functional parameters of the Kv current recorded from COS-7 cells expressing Kv{alpha}1.5+Kv{beta}1.3. The voltage dependence of outward currents is shown for % inactivation with different concentrations of NAD+ (A) or NADP+ (B) and for Kv current activation with different concentrations of NAD+ (C) or NADP+ (D). Data points represent means ± SE for the number of measurements given in Table 2.

 
The effects of NAD+ and NADP+ on Kv{alpha}1.5+{beta}1.3 currents were concentration dependent. At low concentrations, NADP+ (30 µM) or NAD+ (100 µM) produced no significant effect on percent inactivation or voltage dependence of activation (Fig. 4). NADP+ at 100 µM or NAD+ at 500 µM produced intermediate effects on percent inactivation (24.9 ± 2% and 23.9 ± 2.1%, respectively) and on voltage dependence of activation (Vh = –9.8 ± 0.9 and –11.8 ± 0.5 mV, respectively; Table 2, Fig. 4), whereas 500 µM NADP+ or 1 mM NAD+ produced maximal effects on Kv current parameters. These observations indicate that Kv{beta} is capable of inactivating Kv currents only in the presence of reduced coenzymes, whereas this ability is abolished when the concentrations of the oxidized nucleotides in the pipette solution are high. Because NAD+ and NADP+ displayed similar effects, NAD+ was used for all subsequent experiments, as it is the most abundant pyridine nucleotide in aerobic cells.

Internal pipette perfusion. Although the results presented above show that inclusion of NAD(P)+ in the patch pipette affects Kv{alpha}-{beta} currents, the major limitation in these experiments is that it is not possible to record control current before applying nucleotides. To circumvent this limitation, we used a pipette-perfusion system to deliver nucleotides to the cell after recording control currents (27, 32). For these experiments, cells were patched with a perfusible pipette containing normal internal solution. After basal recordings, the internal solution was switched to a solution containing the coenzymes and changes in the currents were examined. The Kv current recorded at +50 mV from a cell expressing Kv{alpha}1.5+{beta}1.3 with a perfusible pipette displayed characteristic inactivation (Fig. 5A). However, switching the internal solution to a solution containing 1 mM NAD+ significantly decreased the extent of inactivation (from 34.3 ± 7.5% to 10.2 ± 4.3%, n = 3; P < 0.05) and shifted the voltage dependence of activation (Fig. 5) from Vh of –14.6 ± 0.7 mV to –7.4 ± 0.4 mV (n = 3; P < 0.05), consistent with the observations described above for internal application of NAD+. In contrast, internal perfusion with 0.1 mM NADPH had no significant effect on Kv{alpha}-{beta} currents (data not shown). These results confirm that NADPH preserves, but NAD+ abolishes, the inactivation of Kv{alpha}-{beta} currents.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 5. Effect of internal perfusion with NAD+ on Kv{alpha}-{beta} currents. A: currents were recorded from a cell expressing Kv{alpha}1.5+Kv{beta}1.3 in control internal solution and after perfusion with internal solution containing 1 mM NAD+. B: voltage dependence of the activation in control solution and after internal perfusion with 1 mM NAD+. Data are means ± SE (n = 3).

 
Single-channel recordings. To further examine the regulation of Kv channels by pyridine coenzymes, we recorded single-channel activity. In cells expressing Kv{alpha}1.5 alone (Fig. 6A), unitary currents from excised inside-out patches in control solution were activated rapidly and channels remained in the open state for several hundred milliseconds, with transient or brief closures. However, in cells expressing Kv{alpha}1.5+{beta}1.3, the channels opened transiently at the onset of the voltage step and reopened infrequently during the test pulse (Fig. 6B). The mean Po was decreased from 0.80 ± 0.03 with Kv{alpha}1.5 alone to 0.16 ± 0.07 (n = 4; P < 0.05) with Kv{alpha}1.5+{beta}1.3. However, Kv channel conductance was increased from 8 pS in Kv{alpha}1.5 alone to 15 pS in Kv{alpha}1.5+{beta}1.3. This resulted in shortening of the open time and lengthening of the closed state of the channels. These data show that, in cells expressing Kv{alpha}1.5+{beta}1.3, the Kv channels open only sporadically, indicating that Kv{beta}1.3 induces only partial inactivation of Kv{alpha}1.5 currents. This is consistent with the whole cell recordings showing sustained currents remaining at the end of the depolarizing pulse.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 6. Effect of NAD+ on single-Kv channel activity in excised inside-out patches. Representative single-channel traces recorded in patches from COS-7 cells expressing Kv{alpha}1.5 alone (A) or Kv{alpha}1.5+{beta}1.3 (B) in control solution (left) and after exposure to 1 mM NAD+ (right). Data are representative of 4 similar experiments. All-points current amplitude histograms are shown below single-channel recordings. The best fit line was generated with the maximum likelihood method. The dotted line indicates closed state.

 
After basal Kv channel activity was recorded, 1 mM NAD+ or 100 µM NADPH was added to the bath solution. In patches from cells expressing Kv{alpha}1.5+{beta}1.3, application of NAD+ caused the channels to remain open for longer times, with transient or brief closings (Fig. 6B), whereas addition of NAD+ did not significantly affect channel activity in patches from cells expressing Kv{alpha}1.5 alone (Fig. 6A). Amplitude histograms show that the number of events for open state increased dramatically in the presence of NAD+. Application of NAD+ did not alter mean Po with Kv{alpha} alone but increased the mean Po in Kv{alpha}-{beta} channels from 0.16 ± 0.07 to 0.44 ± 0.09 (n = 4; P < 0.05). In contrast, addition of NADPH to the bath solution did not change channel activity (data not shown). Neither NAD+ nor NADPH changed single-channel conductance. Collectively, these observations suggest that NAD+ decreases the inactivation of Kv{alpha}-{beta} currents by a membrane-delimited mechanism.


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The results of this study show that Kv currents could be regulated differentially by oxidized and reduced pyridine nucleotides. This regulation stems from the ability of reduced nucleotides to support and oxidized nucleotides to abolish Kv inactivation. The effects of pyridine nucleotides are mediated by the {beta}-subunit of the Kv channel and appear at physiological concentrations, suggesting the presence of a novel link between the redox state of pyridine nucleotides and Kv conductance.

In general, pyridine nucleotides support oxidation-reduction reactions. However, accumulating evidence suggests that these nucleotides are regulators of several physiological processes. Sensitivity to the redox state of pyridine coenzyme nucleotides could couple individual processes to metabolism and respiration. This role of pyridine coenzymes is supported by the observations that the corepressor function of COOH terminal binding protein (57) and the DNA-binding activity of the transcription factors regulating the expression of clock genes, i.e., Clock:BMAL1 and NPAS2:BMAL1 (41), are regulated by NAD+-to-NADH ratio. In addition, NAD(P)H has also been shown to regulate the activity of the cystic fibrosis transmembrane conductance regulator (45). Our observation that oxidized and reduced pyridine nucleotides display antagonistic effects on Kv current, analogous to their effects on the transcription of clock genes, may be yet another example of the regulatory function of these coenzymes linking metabolic activity to membrane excitability.

Because inactivation could be removed by oxidized nucleotides, NAD+ and NADP+, but not by equimolar concentrations of NADPH or NADH, it appears that binding of NADPH as well as its permissive effects on inactivation could be selectively prevented by oxidized nucleotides. In the case of NAD+, this inhibition of inactivation appears at a concentration (0.5–1 mM) similar to that present in cells of most aerobic tissues (0.5–0.9 mM) (6, 16). Moreover, the half-maximal concentration of NAD+ required to remove inactivation (0.5 mM; Table 2) is similar to the NAD+ dependence of other oxidoreductases. For instance, Kd NAD+ of pig heart soluble malate dehydrogenase is 0.58 mM (13), the Kd of rabbit muscle lactate dehydrogenase is 0.91 mM (15), and the Kd of human aldehyde dehydrogenase is 0.1 mM (2). Hence, the Kv{alpha}-{beta} pair appears to be responding to NAD+ within the concentration range that affects other NAD+-utilizing enzymes. In addition to NAD+, NADP+ and NADH could also affect inactivation, but because in most aerobic cells the concentration of these nucleotides is one-third or one-fifth that of NADPH (24, 29), their basal contribution is likely to be small. Nonetheless, an increase in NADH during hypoxia or in NADP+ during oxidative stress could affect {beta}-mediated inactivation of Kv currents.

The regulatory effects of pyridine nucleotides on Kv conductance appear to be mediated by Kv{beta}, because the Kv{alpha} currents by themselves were unaffected by either reduced or oxidized nucleotides. Indeed, previous work by our group (26) showed that Kv{beta} displays a high affinity for both reduced and oxidized nucleotides. The Kv{beta} proteins interact with Kv{alpha} via their conserved oxidoreductase domain, which contains the pyridine nucleotide binding site (18). Pyridine nucleotide binding to Kv{beta} appears to be essential for imparting inactivation, because mutations at the coenzyme binding site prevent Kv{beta}-mediated inactivation of Kv{alpha} currents (36). Binding of pyridine coenzymes to Kv{beta} may be important for maintaining an appropriate conformation of the protein and for supporting oxidation-reduction reactions. Recent observations such as the rescue of Kv{beta}-3.1-dependent inactivation of Kv1.5 in Xenopus oocytes by mutations in NADPH and substrate binding sites (5) and loss of Kv1.4 inactivation by Kv{beta}2 due to mutations in the AKR active site tyrosine of the {beta}-subunit (36) are consistent with a catalytic role of Kv{beta}. However, no specific catalytic properties of the protein have been reported. On the basis of the relative affinities of the Kv{beta}2 for pyridine nucleotides and their intracellular concentration, we had hypothesized that differential pyridine coenzyme binding could regulate Kv{alpha}-Kv{beta} interactions (26). The evidence presented here is consistent with this view.

Fluorometric titrations of Kv{beta} show that protein preferentially binding to NADPH (26). Along with the observation that NADPH remains bound to crystallized Kv{beta}2 protein (17), these results suggest that NADPH is the intrinsic ligand of the protein. This is consistent with the present data showing that, even with 100 µM NADPH in the patch pipette, Kv{beta}-mediated inactivation was not affected, indicating that under basal conditions, most of Kv{beta} is saturated with NADPH. The Kv{beta}-mediated inactivation of Kv{alpha} currents was, however, abolished by oxidized nucleotides. That oxidized nucleotides can either prevent inactivation of Kv current when included in the patch pipette or instantaneously remove inactivation when introduced to the cell by internal perfusion suggests that oxidized nucleotides directly interfere with the ability of Kv{beta} to inactivate Kv{alpha}. Moreover, the observation that NAD+ prevents Kv{beta}-mediated inactivation of Kv current in excised patches is consistent with the notion that removal of inactivation by oxidized pyridine nucleotides is due to direct binding of these nucleotides to the {beta}-subunit or is mediated by a membrane-delimited mechanism imparting pyridine nucleotide sensitivity to Kv{beta}. Further experiments are required to distinguish between these possibilities.

Our results show that, in addition to removing inactivation, NAD(P)+ also prevents Kv{beta}-mediated depolarizing shift in the half-activation potential of Kv{alpha} currents and prevents the acceleration of Kv activation induced by Kv{beta}. These observations suggest that NAD(P)H not only supports inactivation but also regulates the kinetics and the voltage dependence of activation. Inactivation of Kv{alpha} currents appears to be primarily determined by the NH2 terminus of the Kv{beta} proteins, because deletion of the NH2 terminus prevents them from inactivating Kv{alpha} currents (27, 39, 51). In contrast, effects on the kinetics and voltage dependence of Kv{alpha} activation may be mediated by the binding of the COOH terminus of Kv{beta} to the T1 domain of Kv{alpha}. Hence, the effects of oxidized nucleotides on the kinetics and the voltage dependence of activation suggest that in addition to affecting the NH2 terminus inactivating peptide, pyridine nucleotides also affect other interactions between the {alpha}- and {beta}-subunits. However, oxidized coenzymes do not seem to completely abolish {alpha}-{beta} interactions, because NAD+ was unable to prevent the increase in single-channel conductance of Kv{alpha} induced by Kv{beta} binding (Fig. 6). In contrast to previous studies on Kv{alpha}-{beta} interactions in Xenopus oocytes showing that the unitary conductance of Kv1.2 is not affected by Kv{beta}1.2 or Kv{beta}1.3 (1, 50), we found a twofold increase in single-channel conductance of Kv{alpha}1.5 on coexpression with Kv{beta}1.3. Mechanisms by which association with an auxiliary subunit such as Kv{beta}1.3 increases Kv{alpha}1.5 conductance are unclear but may be similar to the three- to sixfold increase in the conductance of KCNQ1 on interaction of the channel with its ancillary KCNE1 (minK) subunit (38, 43, 52). For KCNQ1, it has been suggested that KCNE1 stabilizes the open state of the channel by altering the interaction between the pore helix and the S5/S6 domains (43). Whether Kv{beta}1.3-induced changes in the NH2 terminus T0 or T1 domain of Kv1.5 affect the ion-conducting pore is unknown, but the reported increase in the single-channel conductance of Kv1.3 due to mutations in the T0 domain (53) supports the possibility that Kv{beta}1.3-induced changes at the NH2 terminus could indirectly affect the pore region. Nevertheless, the inability of NAD+ to affect single-channel conductance suggests that the NH2-terminal association between Kv{alpha} and {beta} may be insensitive to the oxidation state of pyridine nucleotide. However, further experiments are required to address this possibility. Additional interactions at the COOH terminus are also possible. It was recently reported that binding of Kv{beta} to the T1 domain induces a conformation change in the COOH-terminal peptide of Kv{alpha} (44). It was proposed that in the {alpha}-{beta} complex the COOH terminus of Kv{alpha} is located in the crevice close to the Kv{beta} nucleotide binding site (44), suggesting the possibility that the redox state of the cofactor bound to Kv{beta} could affect the conformation of the COOH terminus of Kv{alpha} and thereby alter the voltage sensitivity and gating characteristics of the channel.

The Kv{beta}-mediated regulation of Kv inactivation by reduced and oxidized pyridine coenzymes may be a significant mechanism regulating the redox sensitivity of native Kv channels. Thus changes in the redox ratio of pyridine coenzyme caused by alterations in cellular metabolism or hypoxia could influence the Po of native Kv channels and alter their voltage dependence. Although extensive investigations are required to establish the role of pyridine nucleotides in metabolic regulation of Kv currents, the observation that NAD+ abolishes inactivation is consistent with greater inactivation of these channels during hypoxia and metabolic inhibition (4, 10, 30, 56), which decrease tissue NAD+ levels. Additionally, even though it remains to be determined whether other Kv{alpha}-{beta} complexes respond similarly to the Kv{alpha}1.5-{beta}1.3 couple studied here, it is tempting to speculate that such redox-sensitive mechanisms of Kv channel regulation may be operative during synaptic stimulation that increases oxidative activity and superoxide generation (7, 49).

In summary, our results demonstrate that oxidized and reduced pyridine coenzymes differentially regulate Kv channel activity via the {beta}-subunits. The sensitivity of the Kv{alpha}-{beta} complex to pyridine nucleotide may be a novel mechanism of redox regulation of native Kv currents. These observations could form the basis of future investigations into the role of pyridine nucleotides in regulating the activity of native Kv channels as a function of cellular metabolism and respiration.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported in part by National Heart, Lung, and Blood Institute Grants HL-55477 and HL-59378 (to A. Bhatnagar) and HL-56787 (to R. Kumar) and by an American Heart Association-Ohio Valley Affiliate Fellowship (to S. M. Tipparaju).


    ACKNOWLEDGMENTS
 
We thank Dr. Michael Tamkun for providing the Kv1.5{alpha} and Kv{beta}1.3 cDNA.


    FOOTNOTES
 

Address for reprint requests and other correspondence: A. Bhatnagar, Division of Cardiology, Dept. of Medicine, Institute of Molecular Cardiology, Univ. of Louisville, 580 South Preston St., Rm. 421, Louisville, KY 40202 (E-mail: aruni{at}louisville.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Accili EA, Kiehn J, Yang Q, Wang Z, Brown AM, and Wible BA. Separable Kv{beta} subunit domains alter expression and gating of potassium channels. J Biol Chem 272: 25824–25831, 1997.[Abstract/Free Full Text]

2. Ambroziak W, Kosley LL, and Pietruszko R. Human aldehyde dehydrogenase: coenzyme binding studies. Biochemistry 28: 5367–5373, 1989.[CrossRef][Medline]

3. Archer SL, London B, Hampl V, Wu XC, Nsair A, Puttagunta L, Hashimoto K, Waite RE, and Michelakis ED. Impairment of hypoxic pulmonary vasoconstriction in mice lacking the voltage-gated potassium channel Kv1.5. FASEB J 15: 2001.

4. Archer SL, Souil E, Dinh-Xuan AT, Schremmer B, Mercier JC, El Yaagoubi A, Nguyen-Huu L, Reeve HL, and Hampl V. Molecular identification of the role of voltage-gated K+ channels, Kv1.5 and Kv2.1, in hypoxic pulmonary vasoconstriction and control of resting membrane potential in rat pulmonary artery myocytes. J Clin Invest 101: 2319–2330, 1998.[Web of Science][Medline]

5. Bahring R, Milligan CJ, Vardanyan V, Engeland B, Young BA, Dannenberg J, Waldschutz R, Edwards JP, Wray D, and Pongs O. Coupling of voltage-dependent potassium channel inactivation and oxidoreductase active site of Kv{beta} subunits. J Biol Chem 276: 22923–22929, 2001.[Abstract/Free Full Text]

6. Bessho M, Tajima T, Hori S, Satoh T, Fukuda K, Kyotani S, Ohnishi Y, and Nakamura Y. NAD and NADH values in rapidly sampled dog heart tissues by two different extraction methods. Anal Biochem 182: 304–308, 1989.[CrossRef][Web of Science][Medline]

7. Bito H, Deisseroth K, and Tsien RW. CREB phosphorylation and dephosphorylation: a Ca2+- and stimulus duration-dependent switch for hippocampal gene expression. Cell 87: 1203–1214, 1996.[CrossRef][Web of Science][Medline]

8. Bock J, Szabo I, Jekle A, and Gulbins E. Actinomycin D-induced apoptosis involves the potassium channel Kv1.3. Biochem Biophys Res Commun 295: 526–531, 2002.[CrossRef][Web of Science][Medline]

9. Brown AM. Cardiac potassium channels in health and disease. Trends Cardiovasc Med 7: 118–124, 2004.[CrossRef]

10. Coppock EA, Martens JR, and Tamkun MM. Molecular basis of hypoxia-induced pulmonary vasoconstriction: role of voltage-gated K+ channels. Am J Physiol Lung Cell Mol Physiol 281: L1–L12, 2001.[Abstract/Free Full Text]

11. Deal KK, England SK, and Tamkun MM. Molecular physiology of cardiac potassium channels. Physiol Rev 76: 49–67, 1996.[Abstract/Free Full Text]

12. Dubois JM and Rouzaire-Dubois B. Role of potassium channels in mitogenesis. Prog Biophys Mol Biol 59: 1–21, 1993.[CrossRef][Web of Science][Medline]

13. Eberhardt NL and Wolfe RG. Malate dehydrogenase, circular-dichroism difference spectra of porcine heart mitochondrial and supernatant enzymes, binary enzyme-coenzyme, and ternary enzyme-coenzyme-substrate analog complexes. J Biol Chem 250: 2987–2992, 1975.[Abstract/Free Full Text]

14. Feng JL, Wible B, Li GR, Wang ZG, and Nattel S. Antisense oligodeoxynucleotides directed against Kv1.5 mRNA specifically inhibit ultrarapid delayed rectifier K+ current in cultured adult human atrial myocytes. Circ Res 80: 572–579, 1997.[Abstract/Free Full Text]

15. Fromm HJ. Determination of dissociation constants of coenzymes and abortive ternary complexes with rabbit muscle lactate dehydrogenase from fluorescence measurements. J Biol Chem 238: 2938–2944, 1963.[Free Full Text]

16. Glock GE and McLean P. Levels of oxidized and reduced diphosphopyridine nucleotide and triphosphopyridine nucleotide in animal tissues. Biochem J 61: 388–390, 1955.[Web of Science][Medline]

17. Gulbis JM, Mann S, and MacKinnon R. Structure of a voltage-dependent K+ channel {beta} subunit. Cell 97: 943–952, 1999.[CrossRef][Web of Science][Medline]

18. Gulbis JM, Zhou M, Mann S, and MacKinnon R. Structure of the cytoplasmic {beta} subunit-T1 assembly of voltage-dependent K+ channels. Science 289: 123–127, 2000.[Abstract/Free Full Text]

19. Heinemann SH, Rettig J, Graack HR, and Pongs O. Functional characterization of Kv channel {beta}-subunits from rat brain. J Physiol 493: 625–633, 1996.[Abstract/Free Full Text]

20. Hill B. Ionic Channels of Excitable Membranes. Sutherland, MA: Sinauer, 1992.

21. Kolb HA. Potassium channels in excitable and non-excitable cells. Rev Physiol Biochem Pharmacol 115: 51–91, 1990.[Web of Science][Medline]

22. Krick S, Platoshyn O, Sweeney M, Kim H, and Yuan JX. Activation of K+ channels induces apoptosis in vascular smooth muscle cells. Am J Physiol Cell Physiol 280: C970–C979, 2001.[Abstract/Free Full Text]

23. Kumar R, Namiki T, and Joyner RW. Effects of cGMP on L-type calcium current of adult and newborn rabbit ventricular cells. Cardiovasc Res 33: 573–582, 1997.[Abstract/Free Full Text]

24. LaNoue KF, Bryla J, and Williamson JR. Feedback interactions in the control of citric acid cycle activity in rat heart mitochondria. J Biol Chem 247: 667–679, 1972.[Abstract/Free Full Text]

25. Lewis RS and Cahalan MD. Potassium and calcium channels in lymphocytes. Annu Rev Immunol 13: 623–653, 1995.[Web of Science][Medline]

26. Liu SQ, Jin H, Zacarias A, Srivastava S, and Bhatnagar A. Binding of pyridine nucleotide coenzymes to the {beta}-subunit of the voltage-sensitive K+ channel. J Biol Chem 276: 11812–11820, 2001.[Abstract/Free Full Text]

27. Martens JR, Kwak YG, and Tamkun MM. Modulation of Kv channel {alpha}/{beta} subunit interactions. Trends Cardiovasc Med 9: 253–258, 1999.[CrossRef][Medline]

28. McCormack T and McCormack K. Shaker K+ channel {beta}-subunits belong to an NAD(P)H-dependent oxidoreductase superfamily. Cell 79: 1133–1135, 1994.[CrossRef][Web of Science][Medline]

29. Merker MP, Bongard RD, Kettenhofen NJ, Okamoto Y, and Dawson CA. Intracellular redox status affects transplasma membrane electron transport in pulmonary arterial endothelial cells. Am J Physiol Lung Cell Mol Physiol 282: L36–L43, 2002.[Abstract/Free Full Text]

30. Michelakis ED, McMurtry MS, Wu XC, Dyck JR, Moudgil R, Hopkins TA, Lopaschuk GD, Puttagunta L, Waite R, and Archer SL. Dichloroacetate, a metabolic modulator, prevents and reverses chronic hypoxic pulmonary hypertension in rats: role of increased expression and activity of voltage-gated potassium channels. Circulation 105: 244–250, 2002.[Abstract/Free Full Text]

31. Michelakis ED, Rebeyka I, Wu X, Nsair A, Thebaud B, Hashimoto K, Dyck JR, Haromy A, Harry G, Barr A, and Archer SL. O2 sensing in the human ductus arteriosus: regulation of voltage-gated K+ channels in smooth muscle cells by a mitochondrial redox sensor. Circ Res 91: 478–486, 2002.[Abstract/Free Full Text]

32. Mishra M, Wagner MB, Wang Y, Joyner RW, and Kumar R. Expression of cGMP-dependent protein kinase in human atrium. J Mol Cell Cardiol 33: 1467–1476, 2001.[CrossRef][Web of Science][Medline]

33. Nerbonne JM. Molecular basis of functional voltage-gated K+ channel diversity in the mammalian myocardium. J Physiol 525: 285–298, 2000.[Abstract/Free Full Text]

34. Pal S, Hartnett KA, Nerbonne JM, Levitan ES, and Aizenman E. Mediation of neuronal apoptosis by Kv2.1-encoded potassium channels. J Neurosci 23: 4798–4802, 2003.[Abstract/Free Full Text]

35. Park MK, Bae YM, Lee SH, Ho WK, and Earm YE. Modulation of voltage-dependent K+ channel by redox potential in pulmonary and ear arterial smooth muscle cells of the rabbit. Pflügers Arch 434: 764–771, 1997.[CrossRef][Web of Science][Medline]

36. Peri R, Wible BA, and Brown AM. Mutations in the Kv{beta}2 binding site for NADPH and their effects on Kv1.4. J Biol Chem 276: 738–741, 2001.[Abstract/Free Full Text]

37. Pozeg ZI, Michelakis ED, McMurtry MS, Thebaud B, Wu XC, Dyck JRB, Hashimoto K, Wang SH, Harry G, Sultanian R, Koshal A, and Archer SL. In vivo gene transfer of the O2-sensitive potassium channel Kv1.5 reduces pulmonary hypertension and restores hypoxic pulmonary vasoconstriction in chronically hypoxic rats. Circulation 107: 2037–2044, 2003.[Abstract/Free Full Text]

38. Pusch M. Increase of the single-channel conductance of KvLQT1 potassium channels induced by the association with minK. Pflügers Arch 437: 172–174, 1998.[CrossRef][Web of Science][Medline]

39. Rettig J, Heinemann SH, Wunder F, Lorra C, Parcej DN, Dolly JO, and Pongs O. Inactivation properties of voltage-gated K+ channels altered by presence of beta-subunit. Nature 369: 289–294, 1994.[CrossRef][Medline]

40. Ruppersberg JP, Stocker M, Pongs O, Heinemann SH, Frank R, and Koenen M. Regulation of fast inactivation of cloned mammalian IK(A) channels by cysteine oxidation. Nature 352: 711–714, 1991.[CrossRef][Medline]

41. Rutter J, Reick M, Wu LC, and McKnight SL. Regulation of clock and NPAS2 DNA binding by the redox state of NAD cofactors. Science 293: 510–514, 2001.[Abstract/Free Full Text]

42. Sanchez D, Lopez-Lopez JR, Perez-Garcia MT, Sanz-Alfayate G, Obeso A, Ganfornina MD, and Gonzalez C. Molecular identification of Kv{alpha} subunits that contribute to the oxygen-sensitive K+ current of chemoreceptor cells of the rabbit carotid body. J Physiol 542: 369–382, 2002.[Abstract/Free Full Text]

43. Seebohm G, Sanguinetti MC, and Pusch M. Tight coupling of rubidium conductance and inactivation in human KCNQ1 potassium channels. J Physiol 552: 369–378, 2003.[Abstract/Free Full Text]

44. Sokolova O, Accardi A, Gutierrez D, Lau A, Rigney M, and Grigorieff N. Conformational changes in the C terminus of Shaker K+ channel bound to the rat Kv{beta}2-subunit. Proc Natl Acad Sci USA 100: 12607–12612, 2003.[Abstract/Free Full Text]

45. Stutts MJ, Gabriel SE, Price EM, Sarkadi B, Olsen JC, and Boucher RC. Pyridine-nucleotide redox potential modulates cystic fibrosis transmembrane conductance regulator Cl conductance. J Biol Chem 269: 8667–8674, 1994.[Abstract/Free Full Text]

46. Thompson RJ, Farragher SM, Cutz E, and Nurse CA. Developmental regulation of O2 sensing in neonatal adrenal chromaffin cells from wild-type and NADPH-oxidase-deficient mice. Pflügers Arch 444: 539–548, 2002.[CrossRef][Web of Science][Medline]

47. Uebele VN, England SK, Gallagher DJ, Snyders DJ, Bennett PB, and Tamkun MM. Distinct domains of the voltage-gated K+ channel Kv{beta}1.3 {beta}-subunit affect voltage-dependent gating. Am J Physiol Cell Physiol 274: C1485–C1495, 1998.[Abstract/Free Full Text]

48. Wang J, Juhaszova M, Rubin LJ, and Yuan XJ. Hypoxia inhibits gene expression of voltage-gated K+ channel {alpha} subunits in pulmonary artery smooth muscle cells. J Clin Invest 100: 2347–2353, 1997.[Web of Science][Medline]

49. Wang X, Culotta VC, and Klee CB. Superoxide dismutase protects calcineurin from inactivation. Nature 383: 434–437, 1996.[CrossRef][Medline]

50. Wang Z, Kiehn J, Yang Q, Brown AM, and Wible BA. Comparison of binding and block produced by alternatively spliced Kv{beta}1 subunits. J Biol Chem 271: 28311–28317, 1996.[Abstract/Free Full Text]

51. Xu J and Li M. Auxiliary subunits of Shaker-type potassium channels. Trends Cardiovasc Med 8: 229–234, 1998.[CrossRef][Web of Science][Medline]

52. Yang Y and Sigworth FJ. Single-channel properties of IKs potassium channels. J Gen Physiol 112: 665–678, 1998.[Abstract/Free Full Text]

53. Yao X, Liu W, Tian S, Rafi H, Segal AS, and Desir GV. Close association of the N terminus of Kv1.3 with the pore region. J Biol Chem 275: 10859–10863, 2000.[Abstract/Free Full Text]

54. Yellen G. The voltage-gated potassium channels and their relatives. Nature 419: 35–42, 2002.[CrossRef][Medline]

55. Yuan JX. Oxygen-sensitive K+ channel(s): where and what? Am J Physiol Lung Cell Mol Physiol 281: L1345–L1349, 2001.[Free Full Text]

56. Yuan XJ, Tod ML, Rubin LJ, and Blaustein MP. Hypoxic and metabolic regulation of voltage-gated K+ channels in rat pulmonary artery smooth muscle cells. Exp Physiol 80: 803–813, 1995.[Abstract]

57. Zhang QH, Piston DW, and Goodman RH. Regulation of corepressor function by nuclear NADH. Science 295: 1895–1897, 2002.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Circ. Res.Home page
M. Liu, S. Sanyal, G. Gao, I. S. Gurung, X. Zhu, G. Gaconnet, L. J. Kerchner, L. L. Shang, C. L.-H. Huang, A. Grace, et al.
Cardiac Na+ Current Regulation by Pyridine Nucleotides
Circ. Res., October 9, 2009; 105(8): 737 - 745.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
T. J. Tamsett, K. E. Picchione, and A. Bhattacharjee
NAD+ Activates KNa Channels in Dorsal Root Ganglion Neurons
J. Neurosci., April 22, 2009; 29(16): 5127 - 5134.
[Abstract] [Full Text] [PDF]


Home page
NeuroscientistHome page
Y. Li, S. Y. Um, and T. V. Mcdonald
Voltage-Gated Potassium Channels: Regulation by Accessory Subunits
Neuroscientist, June 1, 2006; 12(3): 199 - 210.
[Abstract] [PDF]


Home page
Phil Trans R Soc BHome page
P. E MacDonald, J. W Joseph, and P. Rorsman
Glucose-sensing mechanisms in pancreatic {beta}-cells
Phil Trans R Soc B, December 29, 2005; 360(1464): 2211 - 2225.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
E. K. Weir, J. Lopez-Barneo, K. J. Buckler, and S. L. Archer
Acute Oxygen-Sensing Mechanisms.
N. Engl. J. Med., November 10, 2005; 353(19): 2042 - 2055.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/2/C366    most recent
00354.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tipparaju, S. M.
Right arrow Articles by Bhatnagar, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tipparaju, S. M.
Right arrow Articles by Bhatnagar, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.